ID: 1183915766

View in Genome Browser
Species Human (GRCh38)
Location 22:41117519-41117541
Sequence GACTGCGTAGGACCCTGATT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183915766_1183915769 18 Left 1183915766 22:41117519-41117541 CCAAATCAGGGTCCTACGCAGTC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1183915769 22:41117560-41117582 TCCAGTAAATCAGCCTGCCATGG 0: 1
1: 0
2: 0
3: 8
4: 186
1183915766_1183915771 19 Left 1183915766 22:41117519-41117541 CCAAATCAGGGTCCTACGCAGTC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1183915771 22:41117561-41117583 CCAGTAAATCAGCCTGCCATGGG 0: 1
1: 0
2: 0
3: 12
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183915766 Original CRISPR GACTGCGTAGGACCCTGATT TGG (reversed) Exonic
901054879 1:6444402-6444424 GACTGAGTAGGACCCTGGCCTGG + Intronic
907205338 1:52765522-52765544 GACAGAGTAAGACCCTGACTGGG - Intronic
917882663 1:179353675-179353697 GATTGGGTAGCTCCCTGATTTGG + Exonic
922914113 1:229241443-229241465 GACTGTTCAGGGCCCTGATTTGG - Intergenic
1063648535 10:7909915-7909937 GACTGCTCAGGTCCCTGATATGG + Intronic
1088735511 11:112724774-112724796 GACTCTGGAGGACCCTGACTGGG - Intergenic
1114369276 14:22067886-22067908 GACTTCATATGACTCTGATTTGG - Intergenic
1122630388 14:103104903-103104925 GTCTGCGTAGGGACCTGATTGGG + Intronic
1125175020 15:36811240-36811262 GACTGCTTAGAGCCCTGATGAGG + Intergenic
1127822367 15:62669978-62670000 GACTGCATAGGAGGCAGATTCGG + Intronic
1137346385 16:47665868-47665890 GAATGCATGGGGCCCTGATTGGG - Intronic
1148466859 17:47870277-47870299 GAGAGGGTAGGACCCTGACTGGG - Intergenic
1148640173 17:49181590-49181612 GACTTAGCAGGACACTGATTTGG - Intergenic
1150426947 17:65084747-65084769 GACAGAGTAAGACCCTGACTGGG + Intergenic
1154371374 18:13765829-13765851 CACTGGGGAGCACCCTGATTGGG - Intergenic
1159249739 18:65859315-65859337 GACAGCATAGTACGCTGATTGGG + Intronic
1161565213 19:4998077-4998099 GACTGGGTGGGAGCCTGCTTGGG + Intronic
926052880 2:9755985-9756007 GCCTCCGAAGGACCCTTATTTGG + Intergenic
927237443 2:20887135-20887157 GGCTGCTTAGCACCCTGAGTTGG + Intergenic
929068251 2:38002168-38002190 CACTTCTTAGCACCCTGATTTGG + Intronic
936488510 2:112948054-112948076 GACTCCAGAGGACCCTGATAGGG - Intergenic
1173388956 20:42614445-42614467 CAGTGCTCAGGACCCTGATTGGG - Intronic
1176095496 20:63342184-63342206 GGCTGCGTGGAACCCTGATGAGG + Intergenic
1178744863 21:35239425-35239447 GATTGCGTATGACCATGTTTTGG - Intronic
1183003452 22:34880525-34880547 GACTGCTTAGGAGCCAGATGAGG - Intergenic
1183747750 22:39701480-39701502 GACCCGGTAGGACCCTGATGAGG - Intergenic
1183915766 22:41117519-41117541 GACTGCGTAGGACCCTGATTTGG - Exonic
960956415 3:123034565-123034587 ACCTGAGTAGGATCCTGATTGGG + Intergenic
962736503 3:138329906-138329928 GACTGCGTTGGGCCCAGAGTGGG - Intergenic
964716903 3:159732263-159732285 GACTGCTTTGGAACCTGTTTGGG - Intronic
969600397 4:8172654-8172676 CACTGCTTGGGACCCTCATTAGG - Intergenic
970257549 4:14184337-14184359 TTCTGTGTATGACCCTGATTTGG + Intergenic
997812756 5:136988339-136988361 GACTGCGTATGACTATGAATTGG - Intronic
1005847960 6:29796770-29796792 AACTGCAAAGCACCCTGATTAGG + Intergenic
1005868138 6:29952610-29952632 AACTGCAAAGCACCCTGATTAGG + Intergenic
1007110660 6:39311842-39311864 GACTGCCTGGGACCTAGATTAGG + Intronic
1012390339 6:98730871-98730893 GACTGCTTAGGTCCCTATTTAGG + Intergenic
1015779031 6:136844350-136844372 GACTGCGCAAGACCCTGTTTTGG + Intronic
1017254056 6:152313389-152313411 GACTTCGTAGGGGCCTGAATAGG - Intronic
1027829219 7:83155850-83155872 GTCTGGGTAGGACCCTGAATTGG + Exonic
1029282478 7:99444979-99445001 GACAGGCTAGGACCCTGATGGGG + Intronic
1037061990 8:14524500-14524522 GACTGAGTAGGAGGCTGACTGGG - Intronic
1043939163 8:86177152-86177174 TACTGAGTAGCAGCCTGATTTGG + Intergenic
1045542648 8:103101331-103101353 GACTGAGGAGGGCCCTGCTTTGG + Intergenic
1053485868 9:38455713-38455735 GAGTGGGAAGAACCCTGATTAGG + Intergenic
1061472520 9:130837870-130837892 GAATGCCTGGGACCCTGAGTGGG - Intronic
1192502232 X:71661815-71661837 GACTGGGTGGGCCCCAGATTCGG - Intergenic
1194938064 X:99975134-99975156 GAGTGAGAAGGACCCTGGTTGGG - Intergenic