ID: 1183919539

View in Genome Browser
Species Human (GRCh38)
Location 22:41153860-41153882
Sequence CTGGGGGGTTGCCATGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183919539 Original CRISPR CTGGGGGGTTGCCATGGAGT GGG (reversed) Intronic
900571829 1:3362439-3362461 CTGGGGAGGTGCCCGGGAGTGGG + Intronic
900659684 1:3776330-3776352 CCGGGGGGCTGCCAGGGAGGTGG - Intergenic
901139816 1:7021251-7021273 ATGGGGCGGTGCGATGGAGTAGG + Intronic
902730337 1:18364846-18364868 CCAGGTGGTTGCCATGGTGTAGG + Intronic
904315322 1:29656328-29656350 CAGGGGTGTTGCCAAGGAGATGG - Intergenic
904632411 1:31852344-31852366 CTGGGGGCCTGTCATGGGGTGGG - Intergenic
904752128 1:32747565-32747587 CTGGGGGCTAGGCATGGAGATGG + Intronic
905456625 1:38092541-38092563 CTGGGAGGCTGCTCTGGAGTGGG + Intergenic
905897365 1:41557584-41557606 TTGGGGGGATGGCAGGGAGTGGG + Intronic
907297025 1:53461747-53461769 CTCGGGGGCTGGCATGGCGTGGG - Intronic
907513272 1:54978168-54978190 CTGGGAGGTGGCCAGGGATTTGG + Intergenic
912381045 1:109248530-109248552 CTGGGGGGATGCCCTGGCCTGGG - Intergenic
912978928 1:114353283-114353305 CTGAGGGCCTGCCACGGAGTAGG - Intergenic
917028677 1:170666912-170666934 CTGGGAGGCTGCCCTGGACTGGG + Intronic
917694605 1:177509040-177509062 TTGGGGGGCTGCCATGCATTAGG - Intergenic
917793416 1:178514317-178514339 CTGAGTGGCTGCCGTGGAGTGGG + Intronic
919331720 1:196180858-196180880 CTGTGGTGTGGCCATGGAGCTGG + Intergenic
919976443 1:202615969-202615991 GTCGGGGGTAGCCATGGAGAAGG - Intronic
922916618 1:229263278-229263300 CTGGGGGGATGAAATGGAGAGGG + Intergenic
923871936 1:238004556-238004578 AGGGGTGGTTGCCAGGGAGTGGG - Intergenic
924331687 1:242946296-242946318 GTGGGGGTTTGCCATGGATCTGG - Intergenic
1063108592 10:3015460-3015482 CTGCGGGATTGCCCTTGAGTTGG + Intergenic
1067346667 10:45443028-45443050 CTGTGGCGTTGGCCTGGAGTGGG - Exonic
1068565387 10:58568894-58568916 CTCTTGGCTTGCCATGGAGTGGG + Intronic
1069732968 10:70631178-70631200 CTGGGCGGTTGCCAGGCAGAGGG - Intergenic
1069793510 10:71038580-71038602 CTGGGGGGTTGCCGAGGGGAGGG - Intergenic
1069954683 10:72042734-72042756 CAGGGGGGCTGCCATGAAGTTGG + Intergenic
1070397104 10:76020700-76020722 CTTGGAGGTTGCCATGGTGAGGG - Intronic
1070654498 10:78262083-78262105 TCGGGGGGTGGCCATGGTGTAGG + Intergenic
1072583256 10:96758843-96758865 CCGGTGGGTTGGAATGGAGTTGG - Intergenic
1072976310 10:100062047-100062069 CTGAGGAGTTGCCATGTACTGGG - Intronic
1075182581 10:120225198-120225220 CTGGAAGGTGGCAATGGAGTGGG + Intergenic
1075263201 10:120980192-120980214 GTCGTGGGTTGCTATGGAGTTGG + Intergenic
1075319143 10:121476031-121476053 ATTGGGGGTTGCCAAGGACTGGG + Intergenic
1075719484 10:124576514-124576536 CTGGGGGCAGGCCATGGAGGGGG - Intronic
1075852855 10:125603200-125603222 CTGGCGGGGGGCCATGGAGAGGG - Intronic
1075874020 10:125791790-125791812 TTGAGTGGTTGCCAAGGAGTGGG + Intronic
1076425293 10:130363231-130363253 CTGGGAGGCTGCCATGGTGCTGG - Intergenic
1076438842 10:130465312-130465334 CTGGGGGTTTTCTGTGGAGTAGG + Intergenic
1080432528 11:32211973-32211995 CTATGGGGTTGACAAGGAGTTGG - Intergenic
1080641980 11:34163616-34163638 CTGCGGGGTAGCCGTGGAGCAGG - Intronic
1081850293 11:46270935-46270957 CGGGGGGGTTTCCAGAGAGTTGG - Intergenic
1082804344 11:57438047-57438069 CGTGGGGGTGGCAATGGAGTTGG - Intergenic
1083323677 11:61862692-61862714 CTGAGGGGCAGCCATGGGGTAGG - Intronic
1083925060 11:65801128-65801150 CTGGGAGGTTGCCCTGCAGGAGG + Intergenic
1083945487 11:65920510-65920532 CTTGGGGGTGGCCAAGGAGTAGG + Intronic
1084329923 11:68424268-68424290 CTGGGGGGCTGGCATGAAGACGG + Intronic
1084956306 11:72693471-72693493 CTGGGGGGTGGGACTGGAGTGGG + Intronic
1085445306 11:76597411-76597433 CTGGGAGGCCTCCATGGAGTGGG - Intergenic
1085544344 11:77303088-77303110 TTGGGGGGTTGCAAAGGAATAGG - Intergenic
1085960570 11:81456742-81456764 CTGGGGGCCTGTCATGGGGTGGG + Intergenic
1087917329 11:103826251-103826273 CTGAGAAGTTGCCATAGAGTAGG + Intergenic
1088843236 11:113644154-113644176 CAGGGGTGTTGCCAGGTAGTTGG - Intergenic
1091291801 11:134444651-134444673 CTGGTGGTTTGCCATGGGGGAGG - Intergenic
1092059964 12:5540565-5540587 CTGGGTGGATGCCCAGGAGTGGG + Intronic
1092153963 12:6270233-6270255 CTCGGGGGTTACCATGGTGCTGG - Intergenic
1094312353 12:29098146-29098168 CTGGGGGCCTGTCATGGAGTTGG + Intergenic
1096215783 12:49796794-49796816 CTGGGTGGTCCCCATTGAGTGGG + Exonic
1096357550 12:50954247-50954269 CTGGGGGCTTACCATGTATTAGG - Intronic
1096670527 12:53195832-53195854 CTGGAGGCTTGCTATGGAATAGG + Intronic
1097358777 12:58632768-58632790 CTCTGGGATTGCCATTGAGTGGG - Intronic
1100140972 12:91618567-91618589 CATGGGGATTGCCATGTAGTTGG - Intergenic
1101254395 12:102963507-102963529 CAGGGAGGTTACCATGTAGTAGG - Intergenic
1101796066 12:107975403-107975425 CTGGGTTGTTGCCATGGACAGGG + Intergenic
1101928458 12:108992730-108992752 CTAGGGGATTGCCAGGGAATGGG + Intronic
1102013148 12:109631360-109631382 GTGGGGGGTTTCCATGGGGTGGG + Intergenic
1102590189 12:113950895-113950917 CTAGGGTGTGGCCATGGAGAGGG - Intronic
1103800261 12:123533473-123533495 CAGGAGGGTGGCCATGGAGGAGG - Exonic
1103870317 12:124086536-124086558 CTGGAGGGCAGCCATGGAGAAGG + Intronic
1103990788 12:124797946-124797968 CTGGGGGGATGCCCGGCAGTGGG - Intronic
1104230367 12:126878505-126878527 CTGAGCTGGTGCCATGGAGTAGG + Intergenic
1104310806 12:127652893-127652915 ATGGGGAGCTGCCATGGAGGTGG + Intergenic
1106115918 13:26817402-26817424 CTGGGGGGGTGACATAGAGACGG + Intergenic
1110233931 13:73196674-73196696 CTGGGGAACTGCCTTGGAGTGGG - Intergenic
1110410669 13:75201035-75201057 CTGGGCTGCTGTCATGGAGTGGG - Intergenic
1110827465 13:79989346-79989368 CTAGGGTGTGACCATGGAGTGGG - Intergenic
1113695062 13:112339614-112339636 TTGGGGGGTTGCTCTGGATTAGG - Intergenic
1114042952 14:18695603-18695625 CTAGGGGCTTGCCCTGGATTAGG + Intergenic
1114047244 14:18886043-18886065 CTAGGGGCTTGCCCTGGATTAGG + Intergenic
1114116971 14:19633354-19633376 CTAGGGGCTTGCCCTGGATTAGG - Intergenic
1115130316 14:30046495-30046517 CAGGTGGGTTCCCATGGTGTTGG + Intronic
1115805615 14:37047825-37047847 CTTGGAGGATGGCATGGAGTGGG - Intronic
1117663260 14:58030164-58030186 CTGGGTGGGTGCCATAGAGAGGG + Intronic
1118250433 14:64155024-64155046 CTGGCCGGGTTCCATGGAGTTGG + Intronic
1119517154 14:75257343-75257365 CTGGGGAGTGGCAATTGAGTGGG + Intronic
1119601290 14:75978982-75979004 TTGGTGGGTTCCCAGGGAGTTGG + Intronic
1120023617 14:79557035-79557057 CTGCAGGGTTGACATTGAGTTGG + Intronic
1121570695 14:94944586-94944608 CTTGGGGGTTCCCAGGGAGGAGG + Intergenic
1123195868 14:106616029-106616051 CTGGTGGGTTCCCATGGTCTTGG + Intergenic
1124206760 15:27727446-27727468 CAAAGGGATTGCCATGGAGTGGG + Intergenic
1126688588 15:51269506-51269528 TTATGGGGTTGCCATGGAGGTGG + Intronic
1128081453 15:64859626-64859648 CTGGGGGAGTCCCATGGAGCTGG + Intronic
1128988206 15:72236568-72236590 GTGGGGGGTGGCCATGGGGAGGG + Intergenic
1129227975 15:74180813-74180835 CTGGGGGGCTGCCATGGTCCTGG + Exonic
1132497526 16:270886-270908 GTGGGGGGTTCCCAGGGAGCTGG + Intronic
1132689084 16:1174498-1174520 CTGGGGTGTGGCCATGGGGAGGG + Intronic
1133378213 16:5307119-5307141 CTGGGGCTTAGCAATGGAGTTGG + Intergenic
1134183105 16:12063249-12063271 CTGGGGCGTTGGCATGGAGGGGG + Intronic
1134600217 16:15527977-15527999 CTGGGTGGTGGCCATGGAGATGG - Intronic
1135134884 16:19880249-19880271 AGGGGTGGTTGCCATGGAGATGG + Intronic
1135896393 16:26408677-26408699 ATGGGGGCTTGTCATGGGGTGGG - Intergenic
1136226586 16:28864133-28864155 CTGGGGGGTGTCCAGGGAGTAGG + Intronic
1136605168 16:31329091-31329113 CTGGGGGGTGGAGATGGGGTGGG - Intronic
1136748906 16:32615698-32615720 CTCAGGGGCTGCTATGGAGTGGG - Intergenic
1137327994 16:47461036-47461058 CTGAGGGGCTGCCATGGCGGCGG - Exonic
1138510203 16:57504228-57504250 CTGGGGTCTGGCCATGGAGCTGG - Intergenic
1139397656 16:66653362-66653384 CTGGGGGGTTGCCAGGGTAGTGG - Intronic
1139549268 16:67664480-67664502 CTGTGGGGTTCCCAGGGGGTGGG - Intronic
1141623785 16:85250835-85250857 ATGGGTGGTTGCCAGGGAGGGGG - Intergenic
1141638470 16:85328223-85328245 CTGGGGGCTTGCTGTGGAGGAGG - Intergenic
1203051039 16_KI270728v1_random:874912-874934 CTCAGGGGCTGCTATGGAGTGGG - Intergenic
1203139883 16_KI270728v1_random:1755714-1755736 CTGGCATGTTGCTATGGAGTTGG + Intergenic
1142544345 17:688819-688841 CTGTGGGGCAGCCCTGGAGTCGG - Intronic
1143456934 17:7074131-7074153 CTGGTGGGTTGGCTTGGGGTTGG - Intergenic
1144424846 17:15132221-15132243 CTGGGTTGTTGCCATGGAAAGGG - Intergenic
1146498424 17:33343609-33343631 CTGGTGGGTTGACATGGCTTTGG + Intronic
1148943999 17:51242273-51242295 CTGTGGGGATGGCTTGGAGTTGG - Intronic
1152093329 17:78258646-78258668 CTGGGCGGGTGCCAGGGAGCCGG - Intergenic
1157442847 18:47723525-47723547 CTGGGGGGGCGCCATGGAGAAGG - Intergenic
1158401975 18:57129191-57129213 CTGAGGGCTCGCTATGGAGTTGG + Intergenic
1160341647 18:78094404-78094426 CTGGGCTGTTGCCATGGCATTGG + Intergenic
1160537752 18:79604052-79604074 CTGAGGGGTTTCCAGGGTGTGGG - Intergenic
1160790386 19:920267-920289 CTGGGGGGGTGCCGTGAAGGTGG - Intronic
1160808140 19:1001416-1001438 TTGGGGGGTGGGAATGGAGTCGG - Intronic
1160953590 19:1679334-1679356 CTGGGGGGATGCCATGGGGGAGG - Intergenic
1160969006 19:1759224-1759246 CAGGGGGGATGCCAGGGACTGGG + Intronic
1160981920 19:1820116-1820138 CGGTGGGGTCGCCATGGGGTCGG + Intronic
1163279748 19:16308446-16308468 ATGGGTGGTTGCCAGGGACTGGG + Intergenic
1164629843 19:29754884-29754906 CTGGGGGGATGACACAGAGTAGG + Intergenic
1166763188 19:45237164-45237186 GTTGGGGGTTGCCATGGTGTTGG + Intronic
1167054430 19:47100440-47100462 TTGGGTGGTTGCCGTGGCGTAGG - Intronic
1167409122 19:49334701-49334723 ATGGGGTCTTGCTATGGAGTGGG - Intergenic
1167780724 19:51597195-51597217 CTAGGGTGCTGCCATGGAGATGG + Intergenic
925453287 2:3990341-3990363 GTGGGGGGTTCCCATGGCCTTGG + Intergenic
927704187 2:25286847-25286869 CTGGGAGGAGGACATGGAGTTGG - Intronic
931250258 2:60524388-60524410 CTGGGGGGCTGCCATTCATTCGG + Intronic
932491592 2:72126502-72126524 CTGATTGGTTGCCTTGGAGTGGG - Intergenic
932571988 2:72943066-72943088 GTGTGGGGGTGCCATGGTGTTGG - Exonic
932749976 2:74365368-74365390 CTGGGGTGATGCAATGGGGTTGG + Intronic
937264847 2:120608916-120608938 CAGTGGGGTGGCCAGGGAGTGGG + Intergenic
937347627 2:121136387-121136409 GTGGGTGGTTGCCATGGAAAGGG + Intergenic
937492410 2:122383591-122383613 ATGGGGGCCTGTCATGGAGTAGG - Intergenic
937598362 2:123697404-123697426 ATGGGGGCTTGCCTTGGAGATGG + Intergenic
937973457 2:127566920-127566942 ATGGGTGTGTGCCATGGAGTAGG - Intronic
938227838 2:129632191-129632213 ATTAGGGGTTGCCATGGAATGGG - Intergenic
938424623 2:131174589-131174611 CTAGGGGCTTGCCCTGGATTAGG + Intronic
940194997 2:151084028-151084050 CTGGGGAGTTGGAATGGAGGCGG + Intergenic
941387377 2:164870045-164870067 CTGGGCGGTGGCAATGGAATAGG - Intergenic
943926550 2:193791219-193791241 CAGAGGGCTGGCCATGGAGTAGG - Intergenic
945326405 2:208487515-208487537 CTGGGAGGTTTTCCTGGAGTGGG - Intronic
945767143 2:213995256-213995278 CAGGTGGGTTTCCATGGAGGAGG + Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946419850 2:219558460-219558482 CTGGTGGGTGGGCATGGAGAGGG + Intronic
947386063 2:229591709-229591731 CTGTCGGGGTGCCATGGATTCGG + Exonic
948916140 2:241035879-241035901 GTGGGGGCGTGCCATGGGGTGGG + Intronic
1169033470 20:2431040-2431062 CTGGGGGGCTGGCAGGGAATGGG + Intronic
1169271048 20:4199673-4199695 TTGGGTGGTTGCCATGGAAAGGG + Intergenic
1172112361 20:32554622-32554644 CTGGGGGGTTTCCCAGGAGAGGG - Intronic
1172164167 20:32888775-32888797 CTGGGTGGTGTCCATGGTGTGGG + Intronic
1172447606 20:35001368-35001390 CTGGGGAGTGGCCCTGGAGCTGG + Intronic
1172673137 20:36648162-36648184 CTGGAGGGGTCCCAGGGAGTTGG - Intergenic
1173508336 20:43607112-43607134 CTGGGTGGTTGCCAGGCAGAGGG + Intronic
1173865254 20:46308717-46308739 CTGGGGGGTTTCCTGGGACTGGG - Intergenic
1174278667 20:49422281-49422303 GTGTGGGGCTGCCATGGAGATGG + Intronic
1174837036 20:53866220-53866242 CTGGCCTGTTGCTATGGAGTCGG + Intergenic
1175753467 20:61514880-61514902 CTGGGCGGCAGCCATGGGGTGGG + Intronic
1178450689 21:32696720-32696742 CTGAGGGGCTGGCAGGGAGTTGG - Intronic
1178492344 21:33060755-33060777 CTGGAGGGTGGCCATTGGGTTGG + Intergenic
1179780129 21:43694236-43694258 ATGGGGAGCTGCCATGGAGCCGG - Exonic
1179895143 21:44357645-44357667 TTGGGTGGTTGCCATGCAGAGGG - Intronic
1179907012 21:44427673-44427695 CTGGGGGGTTGCCGGGATGTGGG + Intronic
1179940995 21:44638817-44638839 CTGGGGGGCAGCCATGGAGCTGG - Intronic
1180465777 22:15608698-15608720 CTAGGGGCTTGCCCTGGATTAGG + Intergenic
1182767510 22:32768986-32769008 GTGAAGGGTTTCCATGGAGTAGG - Intronic
1183319685 22:37157372-37157394 CTGGGGGGCTGGCGTGGAGGTGG - Intronic
1183361169 22:37384270-37384292 GTGGGGGTTTGCCAGGGAGTGGG - Intronic
1183919539 22:41153860-41153882 CTGGGGGGTTGCCATGGAGTGGG - Intronic
1184453774 22:44597785-44597807 CTGGGGTGTTGCCATGGTGACGG + Intergenic
1184866901 22:47206406-47206428 CTGGGCTGTTGCCATGGAAAGGG - Intergenic
1185128611 22:49025226-49025248 CTGGGGGGCAGCCCGGGAGTGGG + Intergenic
1185242819 22:49755619-49755641 ATGGGGCGTTGCCATGGAAAGGG - Intergenic
1185242829 22:49755652-49755674 ATGGGGCGTTGCCATGGAAAGGG - Intergenic
1185242848 22:49755718-49755740 ATGGGGCGTTGCCATGGAAAGGG - Intergenic
1185242858 22:49755751-49755773 ATGGGGCGTTGCCATGGAAAGGG - Intergenic
1185242885 22:49755850-49755872 ATGGGGCGTTGCCATGGAAAGGG - Intergenic
949700108 3:6746833-6746855 CTGGGGAGTCCCCATGGGGTGGG - Intergenic
950444042 3:13025907-13025929 CAGGGGTGTTGTGATGGAGTGGG - Intronic
953610432 3:44443184-44443206 CTGGGGGGCTGGCATGGGGAAGG + Exonic
954416829 3:50397386-50397408 CTGGTGGGGTGCAGTGGAGTGGG + Intronic
954442803 3:50530935-50530957 CTGGGGGCTTGGCACGGAGGAGG + Intergenic
956453493 3:69397293-69397315 GTTGGTGGTTGCCAGGGAGTTGG + Intronic
956839267 3:73121892-73121914 TTGGGTTGTTGCCATGGAATGGG + Intergenic
961391085 3:126552711-126552733 GTGGGGGGTGAGCATGGAGTGGG + Intronic
961798733 3:129428308-129428330 GTGAAGGGTTGCCATGGAGTCGG - Intronic
962454203 3:135550023-135550045 CTGGGGGGTGGCGGTGGGGTAGG - Intergenic
964548954 3:157865558-157865580 CTGTGGGGTGGCCAGTGAGTGGG - Intergenic
968653933 4:1770663-1770685 CTGGGGGGTGGGCACAGAGTGGG - Intergenic
968685151 4:1952898-1952920 CTGTGGGGCTGCCATGGCCTGGG - Intronic
968707301 4:2085845-2085867 CTGATGGGTTGGGATGGAGTTGG + Intronic
969218475 4:5743078-5743100 CTGGGTTGTTGCCATGGAAAAGG + Intronic
973602483 4:52555861-52555883 CTGGGGGCCTGTCATGGGGTTGG - Intergenic
973785950 4:54332825-54332847 CTGGGGCGTTGCCATGGCAACGG - Intergenic
977057778 4:92215043-92215065 CTGGGGGGCTGTCATGGGGTGGG + Intergenic
985001034 4:185483305-185483327 CTGGGGGGTTGCGGTGAAATGGG - Intergenic
985545044 5:505201-505223 CTGGGGGGTGACCATCGAGGGGG + Intronic
985749339 5:1665475-1665497 CTGGAGGGCTGCCATGGTGATGG - Intergenic
986928905 5:12794649-12794671 CTGGGGGGTTGCCACAGCGTTGG + Intergenic
988578169 5:32445931-32445953 CTGGGGGATGGGCATGGAGAAGG - Intergenic
996549124 5:124711840-124711862 CTGGGGGGTTATTATGAAGTTGG + Intronic
997398096 5:133580639-133580661 CTGGGGGCTGGCACTGGAGTAGG + Intronic
997514547 5:134477739-134477761 CTGGGTCGTTGCCATGGAAAGGG - Intergenic
998643918 5:144041832-144041854 CTGCGGGGCTGGCACGGAGTTGG - Intergenic
999505650 5:152193208-152193230 CAGAGTGGTAGCCATGGAGTGGG - Intergenic
1000406166 5:160890456-160890478 CTGAGTGGTTGCCAGGGACTGGG - Intergenic
1001701280 5:173708228-173708250 CTTGGGGGGTGGCGTGGAGTTGG + Intergenic
1001990798 5:176114105-176114127 CTCAGGGGCTGCTATGGAGTGGG - Exonic
1002090596 5:176803223-176803245 CTGTGTGGTGGCCATGGAGCAGG + Intergenic
1002226076 5:177724035-177724057 CTCAGGGGCTGCTATGGAGTGGG + Exonic
1003255196 6:4469157-4469179 CTCAGGGGTTGCCATGCAGCTGG + Intergenic
1004395847 6:15245821-15245843 CTGCGGGGGTGCCCTGGACTGGG + Intergenic
1006232474 6:32596197-32596219 CTGGGTGGTTGCCAGGCAGAGGG + Intergenic
1006272250 6:32973306-32973328 CTGTAGGGTTGCCATGGTGACGG + Intronic
1006797745 6:36742133-36742155 CTGGGAGGCTGCCAGGGGGTGGG - Exonic
1008161341 6:48079782-48079804 ATGAAGGGTTGCCATGGAGGTGG - Intergenic
1008761626 6:54859045-54859067 CTGGGGGGTGGGCACGGTGTCGG - Intronic
1011506052 6:88045301-88045323 CTGGGGGATTACTATGGAGAAGG + Intergenic
1011675470 6:89729007-89729029 CTGGAGGGTTCCCCTGGTGTTGG - Exonic
1013173330 6:107657131-107657153 CTGGGGCTTTACCATGCAGTTGG + Intronic
1013312329 6:108907683-108907705 CTCGGGGGTTACCATGGTGCTGG - Intronic
1018030328 6:159836650-159836672 CTGGGGGCTTCCCAGGGAGTGGG + Intergenic
1018902921 6:168060213-168060235 GTGGGGGGTTTCCTAGGAGTGGG + Intronic
1020774573 7:12436778-12436800 CTGGAGGGTTGTATTGGAGTAGG - Intergenic
1023340144 7:39211222-39211244 ATTGGGGGATGCCATGGACTGGG - Intronic
1023498934 7:40827828-40827850 CTGGATGGTTTCCATGGTGTGGG - Intronic
1025277174 7:57593327-57593349 CTGGGGGATTGCCATTGACAAGG - Intergenic
1025727585 7:64081486-64081508 ATGGGGAGTTGCCATGGTCTTGG + Intronic
1025764882 7:64434648-64434670 ATGGGGAGTTGCCAAGGGGTGGG - Intergenic
1026459590 7:70602018-70602040 CTGGGGGGTTGGGATGGACATGG - Intronic
1026805693 7:73428838-73428860 CTGGGAGCCTGCCCTGGAGTGGG - Intergenic
1028229320 7:88287440-88287462 CAGGGGGATTGCAATGGAGAAGG + Intronic
1031303703 7:120097504-120097526 CTGGGTAGTTTCCATGGACTTGG + Intergenic
1032322845 7:130900270-130900292 CTGGGGGGATGCCCTGGGCTGGG + Intergenic
1032560344 7:132884287-132884309 CTGGGGTTTAGGCATGGAGTTGG - Intronic
1036919521 8:12837990-12838012 CTGGGGTGTTGCCATGGCAATGG - Intergenic
1037100025 8:15032992-15033014 CTGGCCTGTTGCCTTGGAGTAGG - Intronic
1037281361 8:17246490-17246512 CTGGGGGTTTGTCAAGGGGTTGG - Intronic
1037709288 8:21342817-21342839 CTTTGGGGTTTCCATGGAGAAGG - Intergenic
1037841533 8:22248676-22248698 CTGGGGAGCAGCCATGGAATTGG - Intronic
1040540305 8:48347760-48347782 ATGGGGAGTTGCCATGGACTTGG - Intergenic
1041664437 8:60429078-60429100 CAGGGTGGTGGCCATGGAGAAGG - Intergenic
1042978209 8:74494551-74494573 TTGGAGGGTTGCCATGTAGAAGG + Intergenic
1043789516 8:84446771-84446793 CTGAGGGGGTGCCATGCAGGGGG + Intronic
1044739028 8:95306595-95306617 CATGGGGGCTGCCATGGAGAGGG + Intergenic
1047874860 8:129124485-129124507 ATGGGTGGTTGCCAGGGACTGGG - Intergenic
1049033110 8:140051537-140051559 CTGTGTGGGTGCCATGGGGTGGG - Intronic
1049159721 8:141089492-141089514 CTGTGGGGTTGGCATGGAGCTGG + Intergenic
1052347874 9:27428147-27428169 CTGAGGGGCTGCTATGGACTAGG + Intronic
1056409575 9:86312332-86312354 CTGGGCGGTTGCCAGGCAGAGGG - Intronic
1057211247 9:93202236-93202258 CTTGGGGTCAGCCATGGAGTGGG - Intronic
1057690581 9:97280560-97280582 GTGGAGGGTTTCCATGGACTAGG + Intergenic
1060756725 9:126219322-126219344 CAATGGGGTTGCCATGGAGGAGG - Intergenic
1061123187 9:128656712-128656734 CGCGCGGGTTGCCATGGAGACGG + Exonic
1061978217 9:134084032-134084054 CTGGGAGGTTGCCAAGGGCTGGG + Intergenic
1185535577 X:858912-858934 CTGGGGGTTGACCATGGAGGGGG - Intergenic
1187065971 X:15838289-15838311 CTCAGTGGTTCCCATGGAGTGGG - Intronic
1187930793 X:24292019-24292041 GTGAGGGGTTGACATGAAGTGGG + Intergenic
1188831942 X:34909184-34909206 GTGAGGGGTTGCCAGGGAGGTGG - Intergenic
1190628649 X:52363469-52363491 CTGGGTGGTTGCCATGGAAAGGG - Intergenic
1190985039 X:55492292-55492314 CAGGGAGGGTGCCATGGACTGGG + Intergenic
1191164476 X:57373231-57373253 CTGGGTAGTTACCAAGGAGTGGG + Intronic
1192117306 X:68423577-68423599 CTGGGGGGTTGGAATGTATTGGG - Intronic
1194720095 X:97330311-97330333 ATGGGGAGTTGCTATTGAGTAGG - Intronic
1196778515 X:119362068-119362090 CTGGGCGGTTGCCAGGCAGAGGG - Intergenic
1199305719 X:146265349-146265371 CTGGGGGCTTGCCAGGCAGAGGG - Intergenic
1199629830 X:149769860-149769882 CTGGGGGGGGACCAGGGAGTGGG + Intergenic
1201229025 Y:11845461-11845483 GTGGGGGTTTGCCATGGATCTGG - Intergenic
1202172792 Y:22068697-22068719 GTTGGGGGTGGCCTTGGAGTGGG + Intergenic
1202218570 Y:22517674-22517696 GTTGGGGGTGGCCTTGGAGTGGG - Intergenic
1202324616 Y:23678381-23678403 GTTGGGGGTGGCCTTGGAGTGGG + Intergenic
1202546155 Y:25991673-25991695 GTTGGGGGTGGCCTTGGAGTGGG - Intergenic