ID: 1183919972

View in Genome Browser
Species Human (GRCh38)
Location 22:41157948-41157970
Sequence CTGTTAACTCATCTGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183919972 Original CRISPR CTGTTAACTCATCTGGAGTA GGG Intronic
900624655 1:3602681-3602703 GTGTCAGCTCATCTGGAGTGAGG + Intronic
902141609 1:14361438-14361460 CTGTTCACTCCTCTGGAAGAGGG - Intergenic
902282225 1:15383033-15383055 CTGGTATCTCATCTGTAGCATGG + Intronic
902731994 1:18375795-18375817 CAGTTAACTCAACTGGACAATGG + Intronic
903859416 1:26355987-26356009 CAGTTTCCTCATCTGCAGTAAGG - Intergenic
906474332 1:46157912-46157934 CTGTTAACTCTTCTGAAATTGGG - Intronic
907474740 1:54698224-54698246 CTGTTTCCTCACCTGTAGTATGG + Intronic
908822867 1:68105834-68105856 CTGTCCACTCATCTGGTGTTAGG - Intronic
910452646 1:87362701-87362723 CTGTTTCCTCATCTGCAGAATGG + Intergenic
910660740 1:89669628-89669650 CTGTTTTCTCATCTTGAGAATGG - Intronic
911322491 1:96432161-96432183 CTGTTAAGTCATTTGTTGTAAGG + Intergenic
913569800 1:120109316-120109338 CTGTTTACTCATCTGCAAAATGG + Intergenic
914290609 1:146270282-146270304 CTGTTTACTCATCTGCAAAATGG + Intergenic
914551653 1:148721065-148721087 CTGTTTACTCATCTGCAAAATGG + Intergenic
916211874 1:162366358-162366380 CTGTTACCTCATCTGTAAAATGG - Intronic
916504513 1:165415949-165415971 CTGTTTTCTCATCTGGCGGATGG + Intronic
918101107 1:181375640-181375662 CTGTTTCCTCATCTGTAGAATGG - Intergenic
918975808 1:191484333-191484355 CTGTGATCTCATCTGAAGTTTGG - Intergenic
920547626 1:206831705-206831727 CTGTTTACTCATCTGTAAAATGG - Intronic
920949763 1:210561455-210561477 CTGTTTCCTCATCTGGAAAATGG + Intronic
920979127 1:210815629-210815651 CTGTTAACTCTTCAGGAGTTAGG - Intronic
924374609 1:243391954-243391976 CTGGTAGCTCATCTGAAGTGTGG + Intronic
1067082852 10:43221427-43221449 CTGTTCCTTCATCTGGAGAAGGG - Intronic
1067804019 10:49380996-49381018 CTGCTCACTCATCTGCAGAATGG - Intronic
1067805720 10:49391625-49391647 CTATTAAAGGATCTGGAGTAGGG - Intronic
1068144092 10:53044100-53044122 CTGTTAAGTCATCTGATGAATGG - Intergenic
1069877102 10:71569700-71569722 CTGTTAACTCATCTGAATAATGG + Intronic
1070110429 10:73481885-73481907 CTTTTTACTCATCTAGAATAAGG + Intronic
1070320249 10:75349535-75349557 CTGTTACCTCATCTGCAAAATGG - Intergenic
1072051220 10:91705474-91705496 CTGTCAACCCAGATGGAGTAGGG - Intergenic
1076999416 11:315278-315300 CTGTGACTTCATCTGGAGTGGGG + Intergenic
1078423777 11:11233311-11233333 CTGTTTCCTCATCTGGAAAATGG - Intergenic
1079405838 11:20144891-20144913 CTGTTTACTCATCTGTAAAATGG + Intergenic
1079636176 11:22744179-22744201 CTGTGAACTCATCTGGCCCAGGG - Intronic
1080801170 11:35611649-35611671 CACTTAACTCATCTGTAGAATGG - Intergenic
1080849756 11:36057945-36057967 CAGTTTTCTCATCTGGAGGAGGG + Intronic
1081780274 11:45705747-45705769 CTGTTTCCTCATCTGGAAAATGG + Intergenic
1084102204 11:66957258-66957280 CTGTTTTCTCAGCTGGAGAACGG + Intronic
1084888952 11:72227264-72227286 CTGTTTCCTCAGCTGGAGAATGG + Intronic
1085151820 11:74258480-74258502 CTCCTAACTCCTCTGGAGTGGGG + Intronic
1088512214 11:110589422-110589444 CTGGGCACTCAGCTGGAGTAGGG + Intronic
1089631130 11:119784926-119784948 CTGTTATCTCATCTGTAAAATGG + Intergenic
1092658743 12:10716275-10716297 GTGTTAACTCATCTGCAAAATGG - Intronic
1096598458 12:52713159-52713181 CTGTGCTCTCATCTGGGGTAGGG + Intergenic
1101812801 12:108122247-108122269 CAGTTTACTCATCTGTAGAATGG - Intergenic
1103931295 12:124452466-124452488 CGGTTTCCTCATCTGGAATATGG + Intronic
1103946934 12:124532078-124532100 CAGTTTCCTCATCTGGAGAATGG + Intronic
1105451115 13:20501269-20501291 CTGTTTCCTCATCTGGGATATGG - Intronic
1106217117 13:27712720-27712742 CAGTTTTCTCATCTGGAATATGG + Intergenic
1106569353 13:30913029-30913051 CTGTTCACTCATCTGTGGAAAGG - Intronic
1106573619 13:30954001-30954023 CTGTTTACTCAGCTGGAACATGG + Intronic
1107078735 13:36351089-36351111 CTGTTTTCTCATCTGTAATATGG + Intronic
1107638078 13:42413573-42413595 CTGGTAACACTTCTGGAGCAGGG + Intergenic
1107805117 13:44146413-44146435 CTGTTATATCATCTGGCCTATGG - Intronic
1107824765 13:44318528-44318550 CTGTTACCTCATCTGAAAAATGG + Intergenic
1108236809 13:48416587-48416609 CTGTTAACTCCCCTGGAACAGGG + Intronic
1109886535 13:68552714-68552736 CTGTCAACGAATGTGGAGTAAGG + Intergenic
1109940120 13:69350818-69350840 CTGTTAACTGATGTGAAGTAGGG + Intergenic
1110209120 13:72952069-72952091 CTGTTGCCTCGTCTGGAGTGCGG + Intronic
1111693168 13:91590978-91591000 TTGTTTTCTCATCTGTAGTATGG + Intronic
1112045104 13:95588628-95588650 CTGTTTTCTTATCTGTAGTATGG - Intronic
1113682184 13:112252279-112252301 CTGTTAACTCAAGTGGAGCCTGG + Intergenic
1114362188 14:21986345-21986367 CAGATAACTCATCTGGATTCTGG + Intergenic
1120381168 14:83781595-83781617 CTGATATCTCATCTGTAGAATGG + Intergenic
1120633199 14:86916765-86916787 CTGTTAAGTCACCTGGTCTATGG - Intronic
1121465702 14:94114339-94114361 CTGTTAGCTCATCCGAAGCAGGG - Intronic
1122267992 14:100555552-100555574 CTGTTTCCTCATCTGGAAAACGG - Intronic
1122559787 14:102604536-102604558 CTGTTTCCTCATCTGGAAAATGG - Intronic
1122660208 14:103290143-103290165 CTGTTGACTCACCAGGAGCAGGG + Intergenic
1124112561 15:26805537-26805559 ATGTCAACTTGTCTGGAGTATGG + Intronic
1124613521 15:31225158-31225180 CTGTTTTCTCATCTGTAGAATGG - Intergenic
1125891345 15:43269255-43269277 CTGGTGACTCATTTGGAGAAAGG - Intergenic
1129229730 15:74190523-74190545 CTGTTAGCTCATCTGTAAAAAGG - Intronic
1129689926 15:77707423-77707445 CTGTTTTCTCATCTGCAGAATGG - Intronic
1131419542 15:92293229-92293251 TTGTTAACTCATCTCCAGTCGGG - Intergenic
1132239086 15:100243917-100243939 CTGTTTTCTCATCTGGAAAATGG - Intronic
1134891337 16:17844228-17844250 CTGTTTTCTCATCTGTAATATGG + Intergenic
1135927325 16:26707025-26707047 CAGTTATCTCATCTGGAAAATGG - Intergenic
1135974939 16:27102477-27102499 CTGTTAACCAAACTGGAGTGTGG + Intergenic
1135993324 16:27230544-27230566 CTGTTTCCTCATCTGCAGGATGG - Intronic
1137491705 16:48938477-48938499 CTGTTTCCTCATCTGGAAAATGG - Intergenic
1138577428 16:57916916-57916938 CTGTTTCCTCATCTGTAGAATGG - Intronic
1139824229 16:69744629-69744651 GTGGGAACTCATTTGGAGTAAGG - Intronic
1139939077 16:70591765-70591787 CAGTTTCCTCATCTGCAGTATGG - Intronic
1140634844 16:76899953-76899975 CTGTTAACTCACTTGTAGAAAGG + Intergenic
1140682518 16:77399230-77399252 CTGTTAACTGATAGGTAGTAAGG + Intronic
1143089126 17:4438320-4438342 CTGTTTCCTCATCTGTAGAATGG + Intronic
1144308963 17:13994869-13994891 GATTTATCTCATCTGGAGTAAGG + Intergenic
1145000662 17:19302296-19302318 CTGTTTTCTCATCTGCAGAATGG - Intronic
1145026879 17:19475083-19475105 CTGTGGATTCATCTGGAATAGGG + Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1146695210 17:34903721-34903743 CTGTTTCCTCATCTGCAGAATGG - Intergenic
1148254325 17:46115411-46115433 CTATTTTCTCATCTGTAGTAAGG - Intronic
1149136931 17:53378216-53378238 CTGTGAACTCATCTGGTCCAAGG + Intergenic
1150603390 17:66670356-66670378 CTGTAAAATTATCTGGAGTATGG - Intronic
1153588534 18:6648953-6648975 CTGTTTTCTCATCTGTAATATGG - Intergenic
1156014262 18:32530115-32530137 ATGTTAAGTCATCTGCAGAAAGG - Intergenic
1156953821 18:42937107-42937129 CTATTTTCTCATCTGGATTATGG + Intronic
1157070132 18:44396996-44397018 CTGTTAACTCTTCTACAGAATGG - Intergenic
1159485946 18:69057431-69057453 CTGATACCTCATCTGGGGTGAGG + Intergenic
1161212170 19:3072746-3072768 CAGTTTCCTCATCTGGAATATGG - Intergenic
1161834953 19:6639596-6639618 CCGTTAGCTCATCTGTAGTTAGG + Intergenic
1162351533 19:10153008-10153030 TTCTTAACCCATCTGGAGAATGG - Intronic
1163003023 19:14380943-14380965 CTGTTTCCTCATCTGGAAAATGG + Intronic
1163597377 19:18227905-18227927 CTGTTTTCTCATCTGTAGAATGG - Intronic
1163727054 19:18928806-18928828 CAGTTTCCTCATCTGGAGAATGG + Intronic
1163882400 19:19937165-19937187 CTGATCACTCATCTGGAGCAGGG - Intergenic
1164239655 19:23373792-23373814 CTGATTACTTATCTGGAGCAAGG - Exonic
1164557348 19:29263718-29263740 CTGTTTCCTCATCTGGAAAATGG - Intergenic
1165412990 19:35673693-35673715 CTGTTTACTCATCCGCAGAACGG - Intronic
1165941567 19:39417058-39417080 CTGTTGGTTCATCTGGAGGATGG + Intronic
1166136346 19:40779303-40779325 CTGTTACCTCATCCGGAAAATGG + Intronic
1166767997 19:45263838-45263860 CTATTTTCTCTTCTGGAGTAGGG + Intronic
1168345227 19:55647566-55647588 CTGTTAACTCACCTGCAAAATGG - Intronic
927026308 2:19072470-19072492 CTGATGACACATCTGGAGAAAGG - Intergenic
929103972 2:38345838-38345860 CTGTTTTCTCATCTGGAAAATGG + Intronic
933909737 2:86929587-86929609 CTGTTTCCTCATCTGTAGAAAGG - Intronic
933988956 2:87619850-87619872 CTGTTTCCTCATCTGGAAAATGG - Intergenic
934022991 2:87973792-87973814 CTGTTTCCTCATCTGTAGAAAGG + Intergenic
935851321 2:107222680-107222702 CTGTTTACTCATCTGAAATTTGG - Intergenic
936304887 2:111330976-111330998 CTGTTTCCTCATCTGGAAAATGG + Intergenic
936413556 2:112282522-112282544 CTGTTTCCTCATCTGTAGAAAGG - Intronic
936845057 2:116821192-116821214 GTGTTAACTTAACTGGAGTGAGG - Intergenic
937000779 2:118465347-118465369 CAGTTTACTCATCTGGAAAATGG + Intergenic
938565200 2:132512614-132512636 CTGTGATCTCATCTGTACTAGGG + Intronic
939637104 2:144595425-144595447 CTGTTTCCTCATCTGTAGAACGG + Intergenic
941235464 2:162966666-162966688 CTGTTTCCTCATCTGCAGAATGG + Intergenic
942786424 2:179707295-179707317 ATTTTAACTCATCTTGAGTCTGG - Intronic
944019276 2:195081453-195081475 GTGCTAACCCATCTGAAGTATGG - Intergenic
944838138 2:203599832-203599854 CAGTTAACTCATCTGCAACATGG + Intergenic
946220412 2:218221104-218221126 CTGTCAACTTAGCTGGAGTCTGG + Intronic
946615045 2:221500163-221500185 CTGTTTCCTCACCTGGAGAATGG - Intronic
1168961385 20:1872371-1872393 CTGTTACCTCATCTGTAAAATGG + Intergenic
1169002251 20:2176653-2176675 CTTTCAAATCCTCTGGAGTAAGG + Intronic
1169358405 20:4926993-4927015 CTGTTAAGGCATCTAGAGAAAGG - Intronic
1169362887 20:4966029-4966051 CTGTTATCCAAGCTGGAGTATGG - Intronic
1170020867 20:11835328-11835350 CTGTTTCCTTATCTGTAGTATGG - Intergenic
1170358926 20:15523172-15523194 CTTTTAAATCATATGGAGTCAGG - Intronic
1171265128 20:23765616-23765638 CAGTTAACTCATCTGTACAATGG - Intergenic
1171287210 20:23951165-23951187 CAGTTAACTCATCTGTACAATGG - Intergenic
1172774507 20:37399180-37399202 CAGTTATCTCATCTGGAAAATGG - Intronic
1172848942 20:37946874-37946896 CTGTTTCCTCAACTGGAATAAGG - Intergenic
1173934565 20:46850072-46850094 CTGTTAACTCATCAAAAGTGAGG - Intergenic
1174307505 20:49624590-49624612 CTGTTTTCTCATTTGGAGAAGGG - Intergenic
1174680320 20:52400186-52400208 CAGTTGAGTCATGTGGAGTAAGG + Intergenic
1175053453 20:56176528-56176550 CTGTTTTCTCATCTGCAGGATGG - Intergenic
1175974353 20:62702880-62702902 CAGTTTCCTCATCTGAAGTACGG - Intergenic
1176076422 20:63250395-63250417 CAGTTTCCTCATCTGGAGAATGG + Intronic
1177184434 21:17777905-17777927 CTGTTTCCTCATCTGTAGAATGG + Intergenic
1181755217 22:25019270-25019292 CAGTTTACTCATCTGTAGAATGG + Intronic
1181921114 22:26321206-26321228 CAGTTTACTCATCTGGAAAATGG - Intronic
1182062205 22:27406360-27406382 CAGTTTCCTCATCTGGAATATGG - Intergenic
1182096057 22:27626814-27626836 CTGTTACCTCATCTGCAAAATGG - Intergenic
1183919972 22:41157948-41157970 CTGTTAACTCATCTGGAGTAGGG + Intronic
1185043808 22:48518862-48518884 CTTTTCACTCACCTGGAGGAGGG + Intronic
951612244 3:24503418-24503440 CTGTTTTCTCATCTGTAGTATGG + Intergenic
951879731 3:27468687-27468709 CTGTTTCCTCATCTGTAGAATGG + Intronic
955379857 3:58429132-58429154 CTGTTAACTCATTTTGATGAGGG - Intronic
955715170 3:61821867-61821889 CTGTTTACTCATCTGTAAAATGG - Intronic
955777198 3:62446545-62446567 CTGTTACCTCATCTGCAAAATGG + Intronic
956779038 3:72589931-72589953 CTGTTTACTTATCTGTAATATGG - Intergenic
961062667 3:123844569-123844591 CTGTTAACTCATCTTAAGACAGG + Intronic
961398406 3:126615413-126615435 GTGTTTACTCCTCTGGAGTATGG - Intronic
962684849 3:137837524-137837546 CAGTTAACTCCTCGGGAGTAGGG + Intergenic
963043738 3:141087611-141087633 CTGTTTGCTCATCTGGAAAATGG - Intronic
963877801 3:150496090-150496112 CTGTGAATGCATCTGGAGTGGGG - Intergenic
964799667 3:160541688-160541710 CTGTTAACTCATGTTGGGGAGGG - Intronic
966224996 3:177588764-177588786 CTGTTTACTTATCTGTAATATGG + Intergenic
970690761 4:18617936-18617958 TTGTTAACTCTTTTGGGGTAGGG - Intergenic
973636609 4:52867003-52867025 CTGTTTCCTCATCTGTATTATGG - Intergenic
974020036 4:56684979-56685001 CTGTTTCCTCATCTGTAATATGG + Intergenic
977059904 4:92244714-92244736 CTGATAACTCCTCTGGGGGATGG - Intergenic
977091097 4:92676568-92676590 CTGTTGATTCATATGGAGCATGG + Intronic
978010911 4:103682773-103682795 CTGTTTTCTCATCTGGAGGCTGG + Intronic
979607826 4:122657740-122657762 CAGTTTCCTCATCTGGAGAATGG + Intergenic
984563857 4:181303768-181303790 CTTTTAATTCATGTGGATTAGGG + Intergenic
985893740 5:2737262-2737284 CTTCTAACTCAGCTGGAGAATGG - Intergenic
986059867 5:4177951-4177973 CTGTTATCTCATCTGAGGTGTGG + Intergenic
986180838 5:5391635-5391657 CTGTTGACTCTTCAGAAGTATGG - Intergenic
987985291 5:25138049-25138071 CTGTTAACTGAGCTAGTGTAAGG + Intergenic
991328124 5:65461007-65461029 CTGTTACTTCATCTGCAGAATGG - Intronic
994380600 5:99066545-99066567 CTGTTGATTCATCTGGAGGATGG - Intergenic
994856656 5:105130351-105130373 CTGTTAATTCTTCTGGTGTATGG - Intergenic
995413069 5:111880182-111880204 CTGTTTACTCATCTGTAAAATGG + Intronic
995453695 5:112330580-112330602 CAGTTTTCTCATCTGCAGTATGG - Intronic
995968507 5:117938996-117939018 CTGTGTTCTCATCTGGAGTTTGG - Intergenic
997612140 5:135222793-135222815 CAGTTTACTCATCTGGAAAATGG - Intronic
997690868 5:135826691-135826713 CTGTTTACTCAGCTGTAGAATGG - Intergenic
998762556 5:145448730-145448752 CTGTTATCTCATCTGTAATTGGG + Intergenic
1000158847 5:158579732-158579754 CTGTTAAGTCATTTGTTGTAGGG + Intergenic
1000989738 5:167899527-167899549 CTGTTACCTCATCTGCAAAATGG - Intronic
1001515117 5:172350232-172350254 CTGTTTTCTTATCTGGAGGATGG + Intronic
1001759771 5:174197722-174197744 CTGTTTTCTCATCTGCAGAAGGG + Intronic
1003545450 6:7054197-7054219 CTGTTGCCTCAGCTGGAGTGCGG - Intergenic
1004039729 6:11963623-11963645 CCGTCAACTCAACTGGATTAAGG + Intergenic
1006460791 6:34156578-34156600 CTGTTAACGGACCTGGAATAGGG - Intergenic
1008423290 6:51328082-51328104 CTGTTAACTGGTCTGGGATATGG + Intergenic
1010002338 6:70959670-70959692 CTGTTTCCTCATCTGGAAAATGG + Intergenic
1010690370 6:78903947-78903969 CTGTGAACTCCTCAAGAGTAGGG + Intronic
1010938738 6:81890897-81890919 CTGTTAACTCATTTGCTGGATGG + Intergenic
1011075820 6:83437626-83437648 TTTTTAACTCATCTGAAATAAGG + Intergenic
1011653346 6:89527070-89527092 GTGTGAACTCAACTGGGGTAAGG - Intronic
1014340513 6:120200472-120200494 CTGTAATCTCATCTGGAGTTTGG - Intergenic
1019023479 6:168939007-168939029 CACTTAACTCTTCTGGAGGACGG - Intergenic
1022495643 7:30851336-30851358 CTGTTTACTCATCTGGAAAATGG + Intronic
1023542437 7:41280256-41280278 CTGTTAATTAATCAGCAGTAGGG + Intergenic
1024214054 7:47231801-47231823 CAGTTTACTCATCTGCAGAATGG - Intergenic
1028919576 7:96296361-96296383 CTTTTATCTCATGTGGTGTAAGG - Intronic
1030790990 7:113728847-113728869 CTGTTATCTCTTGTGGGGTATGG + Intergenic
1031863554 7:127012105-127012127 CTGTCAACTCACCTGGATTCTGG + Intronic
1033436021 7:141334310-141334332 CTGTTATCTCATCTGAAAAATGG + Intronic
1034715135 7:153234984-153235006 CTGTTCACTCCTCTGGATAAAGG - Intergenic
1035847706 8:2882873-2882895 TTGTTCTCTCTTCTGGAGTAAGG + Intergenic
1035962664 8:4155132-4155154 CTTTTATCTCATCTGTAGCATGG - Intronic
1036782418 8:11658783-11658805 CTGTTTTCTCATCTGGAGAATGG - Intergenic
1037005543 8:13775232-13775254 CAGTTATTTCATCTGGAATAGGG + Intergenic
1037680802 8:21095967-21095989 CTGTTATCTCATCTGTAGAATGG - Intergenic
1038163421 8:25061966-25061988 CAGTTAACTCATCTGTAAAATGG - Intergenic
1038915109 8:32012707-32012729 CTGTTAACAACTCTGAAGTATGG - Intronic
1039079251 8:33719729-33719751 CTGTTACCTCATGTGGTGGAAGG + Intergenic
1040439171 8:47423258-47423280 CTGTTACCTAGTCTGGAGTGTGG - Intronic
1041366646 8:57113500-57113522 CAGTTACCTAATCTGGAATATGG + Intergenic
1041550182 8:59091573-59091595 CTGTTACCTCATCTGTAAAATGG + Intronic
1043916140 8:85924661-85924683 CTGTTATCACATCTGGAGCAAGG + Intergenic
1045642239 8:104263416-104263438 CTGTTAACTCATCTGTAAATTGG + Intergenic
1045981578 8:108195459-108195481 CTGTGAACTCATGTAGAGAAGGG + Intergenic
1046109853 8:109709524-109709546 CAGTTGAATCATCTGGAGTGGGG - Intergenic
1046832881 8:118765612-118765634 CTTTTAACTCCATTGGAGTAAGG - Intergenic
1047846201 8:128808073-128808095 CTGTTACCTCATATGGTGGAAGG - Intergenic
1048836660 8:138525128-138525150 CTGTTTCCTCATCTGGAAAATGG + Intergenic
1048841687 8:138572348-138572370 CTGTAACCTCATATGGAGGAGGG + Intergenic
1049223768 8:141440054-141440076 CTGTTTCCTCATCTGTAGAATGG - Intergenic
1050164759 9:2753365-2753387 CTGTGAATTCATCTGGTCTAGGG - Intronic
1056083210 9:83119042-83119064 CTGTTACCCAATCTGGAGTGTGG + Intergenic
1056342976 9:85656162-85656184 CTGGTATCTAATCTGGAGAAGGG + Intronic
1056650144 9:88452228-88452250 CAGTTTCCTCATCTGCAGTAAGG - Intronic
1058506342 9:105669884-105669906 CTTTTAGCTCCTCTGGAGTTGGG + Intergenic
1059667946 9:116466836-116466858 CTGTTTTCTCATCTGTAGAATGG + Intronic
1060488012 9:124061777-124061799 CAGTTACCTCATCTGGAAGATGG + Intergenic
1060902926 9:127276920-127276942 CAGTTAACTCATCTGTAAGATGG - Intronic
1061051906 9:128201767-128201789 CAGTTAACTAATCTGGATAATGG - Intronic
1061081601 9:128374185-128374207 CTGTCAGCACATCTGGAGTGGGG - Intronic
1061092681 9:128435475-128435497 CTGTTTCCTCATCTGGAAAATGG + Intronic
1061497724 9:130985150-130985172 CAGTTAACTGATCTGCAGAATGG - Intergenic
1186808165 X:13160901-13160923 TTGGTAACTCATCTGGAATTAGG + Intergenic
1190982156 X:55465756-55465778 CAGTTTACTCATCTGGAAAAAGG - Intergenic
1190986542 X:55507426-55507448 CAGTTTACTCATCTGGAAAAAGG + Intergenic
1191920857 X:66255526-66255548 CTGTTTTCTCATCTGGAAAATGG + Intronic
1192119696 X:68443640-68443662 CAGTTTTCTCATCTGGAGAATGG - Intergenic
1192233799 X:69283791-69283813 CAGTTTCCTCATCTGGAGAATGG + Intergenic
1196174097 X:112621391-112621413 CTGTTTATTCATCTGTAGTAGGG - Intergenic
1196186236 X:112747811-112747833 CTCTTTACTCATCTGTAGAATGG + Intergenic
1197717614 X:129720637-129720659 CTGTTCCCTCATCTGGAAAATGG - Intergenic
1198439444 X:136648149-136648171 CTCTTAACTAATCCTGAGTAAGG + Intergenic
1201979371 Y:19890942-19890964 CTGTTCACTCATCTGGAAAGGGG - Intergenic