ID: 1183921863

View in Genome Browser
Species Human (GRCh38)
Location 22:41176291-41176313
Sequence CAGGATCAACAATGGGAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183921863_1183921874 12 Left 1183921863 22:41176291-41176313 CCTGCCTCCCATTGTTGATCCTG 0: 1
1: 0
2: 3
3: 16
4: 221
Right 1183921874 22:41176326-41176348 CCTGCGATCTGATGGATGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 84
1183921863_1183921875 13 Left 1183921863 22:41176291-41176313 CCTGCCTCCCATTGTTGATCCTG 0: 1
1: 0
2: 3
3: 16
4: 221
Right 1183921875 22:41176327-41176349 CTGCGATCTGATGGATGGTCGGG 0: 1
1: 0
2: 0
3: 8
4: 67
1183921863_1183921870 8 Left 1183921863 22:41176291-41176313 CCTGCCTCCCATTGTTGATCCTG 0: 1
1: 0
2: 3
3: 16
4: 221
Right 1183921870 22:41176322-41176344 ATCCCCTGCGATCTGATGGATGG 0: 1
1: 0
2: 0
3: 3
4: 59
1183921863_1183921869 4 Left 1183921863 22:41176291-41176313 CCTGCCTCCCATTGTTGATCCTG 0: 1
1: 0
2: 3
3: 16
4: 221
Right 1183921869 22:41176318-41176340 TCTCATCCCCTGCGATCTGATGG 0: 1
1: 0
2: 0
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183921863 Original CRISPR CAGGATCAACAATGGGAGGC AGG (reversed) Exonic
901654584 1:10762108-10762130 CAGGTCCAACCTTGGGAGGCAGG - Intronic
902043971 1:13512101-13512123 CAGGGTCACAAGTGGGAGGCTGG + Intronic
902488657 1:16764665-16764687 CAGGCTCAGCTGTGGGAGGCTGG + Intronic
905386388 1:37607052-37607074 TAGCATCAAGAATGTGAGGCCGG - Intergenic
906513676 1:46425542-46425564 CTGAAACCACAATGGGAGGCTGG - Intergenic
906520578 1:46464667-46464689 CAGGATCAAAGAGGTGAGGCAGG - Intergenic
907272595 1:53299581-53299603 CTGGATGACCAATGTGAGGCTGG - Intronic
908851037 1:68375883-68375905 CAGGATCAAGAATTGTAAGCAGG + Intergenic
911036383 1:93553755-93553777 CAGAATCACAAATGCGAGGCAGG - Exonic
912285548 1:108364854-108364876 CAGGATGAGGAATGGGAGGAAGG + Intergenic
913109617 1:115646249-115646271 CAAGGTCAACAATGGGAGATAGG - Intronic
914343448 1:146778838-146778860 CATGCTCAGCTATGGGAGGCGGG + Intergenic
920040870 1:203095642-203095664 TAGGATGAAGAATGGGAGGTGGG + Intronic
920305413 1:205015311-205015333 CAGGATGAGCAGTGGGAGTCTGG - Intronic
920945196 1:210522522-210522544 CAGGAGCAACGATGGAAGGGGGG - Intronic
923042970 1:230332974-230332996 CAGCATGGACAGTGGGAGGCCGG + Exonic
923531783 1:234817852-234817874 CAGGCTCAGCTGTGGGAGGCTGG - Intergenic
1063510745 10:6642916-6642938 CAGGATTCACAATGGGGTGCAGG - Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1069233733 10:66044285-66044307 CTGGATAAAAAATGGAAGGCCGG - Intronic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1072280842 10:93863854-93863876 CAGGATAAAGAATGGGAAGAAGG - Intergenic
1072563328 10:96596997-96597019 CAGGAGCAAGAGAGGGAGGCAGG + Intronic
1072803806 10:98411317-98411339 CAGGAGAAGCAATGGGTGGCTGG + Intronic
1073750038 10:106515022-106515044 TAGGATCACCAAGGGGAGGGCGG - Intergenic
1074154008 10:110782742-110782764 CAGGATGAGAGATGGGAGGCAGG - Intronic
1074835081 10:117283966-117283988 CAGCATCAACACGAGGAGGCAGG + Exonic
1076104326 10:127808602-127808624 TAGGAACCAAAATGGGAGGCAGG - Intergenic
1076343949 10:129767812-129767834 CAGGATCGACACTGGGGTGCTGG - Exonic
1077388676 11:2288826-2288848 CAAGAGCAACAGTTGGAGGCAGG - Intergenic
1077884988 11:6380790-6380812 CAGGATCAACAATGACAATCAGG - Intergenic
1078240774 11:9529413-9529435 CAGGACCAGCACTGGGAGGCTGG - Intergenic
1078525286 11:12096326-12096348 CAGAGTCCAAAATGGGAGGCAGG + Intronic
1078826725 11:14936939-14936961 CAGGCTCAAGAATGTAAGGCAGG - Intronic
1081458106 11:43245218-43245240 CAGGAACCACCATAGGAGGCAGG - Intergenic
1081551521 11:44117263-44117285 CACTATCAAGAATGTGAGGCCGG - Intronic
1088023994 11:105155819-105155841 CAGGATCAAGCAGGGGAGGTAGG + Intergenic
1088812921 11:113403577-113403599 CTGGATCAGCACTGGGAGGATGG + Intergenic
1090421582 11:126579139-126579161 CAGGATCATCAATGGCTGGCAGG - Intronic
1091826214 12:3514703-3514725 CAGGAGCACCAGTGGGAGGGTGG + Intronic
1093880293 12:24396491-24396513 CAGCATGAACAATGGGAACCGGG - Intergenic
1096127138 12:49128221-49128243 CAGGCACCACAGTGGGAGGCTGG + Exonic
1096134090 12:49185273-49185295 CAGGCACCACAGTGGGAGGCTGG + Exonic
1096145049 12:49272948-49272970 CAGGCACCACAGTGGGAGGCTGG - Exonic
1098185521 12:67892311-67892333 CAGGATCAAAATTGGGAGCAGGG + Intergenic
1099327018 12:81229826-81229848 CAGGATCACTACTGGGAGGCTGG + Intronic
1100959757 12:99949392-99949414 CAGGATCAACATTTGGAGAATGG + Intronic
1101364556 12:104059744-104059766 CAGCCTCAATAATGAGAGGCAGG + Intronic
1102198025 12:111038020-111038042 CAGGATGAGCAAAGAGAGGCCGG + Intronic
1102287001 12:111665761-111665783 CAGGTCCATCACTGGGAGGCTGG + Exonic
1102352999 12:112208529-112208551 CATCATCTGCAATGGGAGGCGGG + Exonic
1103488988 12:121302322-121302344 TAGGAACCAAAATGGGAGGCGGG - Intergenic
1104074780 12:125379297-125379319 CAGGATCTTCAATGGGACGAGGG + Intronic
1104090666 12:125514391-125514413 CAGGAGATACAATGGGAGACGGG - Intronic
1104715469 12:131013317-131013339 CAGCAACAGCAATGGGATGCTGG - Intronic
1105328649 13:19393941-19393963 CAGGATCATCAATGTGAGCTGGG - Intergenic
1105863242 13:24435593-24435615 CAGGATCATCAATGTGAGCTGGG + Intronic
1106242914 13:27924687-27924709 CAGGAACCACGATGAGAGGCAGG + Exonic
1107396992 13:40028170-40028192 CATGTGCAACAGTGGGAGGCTGG - Intergenic
1108041718 13:46345503-46345525 CAGGATCAAGAAAGGGCTGCTGG - Exonic
1108088041 13:46816663-46816685 CAGAGTGAACAATGTGAGGCAGG - Intergenic
1109815117 13:67571690-67571712 TAGGATTAAAAATGGGAGGAGGG + Intergenic
1111369002 13:87291435-87291457 CAGGAACTACTAGGGGAGGCGGG - Intergenic
1113556497 13:111239742-111239764 CATGAAAAACAATGGGAGCCAGG - Intronic
1114673975 14:24429206-24429228 CAGGAGTAAGAGTGGGAGGCAGG - Exonic
1116798687 14:49419312-49419334 CAGGTTCTACATTGGGAGGAAGG - Intergenic
1117410996 14:55450972-55450994 CAGGATCTATAATAGGATGCTGG - Intronic
1117673807 14:58135175-58135197 CAGGACAAACAATGTGAGTCAGG + Intronic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1124667915 15:31609604-31609626 AAGGACCATCAATGGGGGGCAGG - Intronic
1126378745 15:48023832-48023854 CAGGAGCCACAACTGGAGGCAGG + Intergenic
1129262682 15:74377456-74377478 CAGGCTTAACCATGGGAGGAGGG - Intergenic
1131011119 15:89019280-89019302 CAGGGTCAACAATGCAAAGCAGG + Intergenic
1131929858 15:97429731-97429753 CAGGAGCAAGAAGGGGAGGGAGG - Intergenic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1133236791 16:4391121-4391143 CAGTATCAAAAATGAGAGGTGGG + Intronic
1133295081 16:4747691-4747713 CAGGAACAACAAGGGGACACCGG - Intronic
1134176465 16:12010821-12010843 CAGGAACAACAAAGGGCAGCTGG - Intronic
1135805135 16:25535848-25535870 CAGGAGCAAGAATGAGAGGTGGG - Intergenic
1136281455 16:29213932-29213954 CAGTACCAAGGATGGGAGGCAGG + Intergenic
1139990542 16:70936496-70936518 CATGCTCAGCTATGGGAGGCGGG - Intronic
1140730569 16:77852309-77852331 CAGGATCAAGGGTGGGAGGGAGG - Intronic
1140862176 16:79027432-79027454 CAGGGTGTAAAATGGGAGGCAGG - Intronic
1141045979 16:80716474-80716496 CTGGATGAACAATGGGTGGGTGG + Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1145230493 17:21170161-21170183 AGGGATAAACAGTGGGAGGCAGG - Intronic
1145961677 17:28890031-28890053 CAGGGACAACACTGGGGGGCTGG + Intronic
1147116939 17:38307692-38307714 AAGAATCAACATTAGGAGGCTGG + Intronic
1147235861 17:39057045-39057067 CAGGCTCAGCGAAGGGAGGCTGG + Intergenic
1147481101 17:40763904-40763926 CAACAGCAACAATGGAAGGCAGG - Intergenic
1148542090 17:48488933-48488955 CAGGATCAACCAAGGAAGTCAGG + Intergenic
1148823990 17:50378660-50378682 CATGATCGACAATGGAAAGCAGG + Exonic
1151167411 17:72217315-72217337 CAGCACCAACTATGGGATGCCGG + Intergenic
1152259546 17:79259674-79259696 CAGGCTCAGCAAAGGGAGCCCGG - Intronic
1153363189 18:4222533-4222555 CAGCAACAACAATGGAAGTCAGG + Intronic
1154498610 18:14981054-14981076 CAGGAGAAACCAAGGGAGGCAGG - Intergenic
1159970671 18:74648276-74648298 CAGGATCAACCATGGCGTGCGGG + Intronic
1160918039 19:1507001-1507023 CAGGATCAAAGTGGGGAGGCTGG - Intronic
1162265740 19:9572469-9572491 CAGGGACAAAGATGGGAGGCAGG + Intronic
1162933204 19:13967247-13967269 CAGGATCAAGGATGTGTGGCTGG + Intronic
1165551001 19:36585740-36585762 CAGTGGCAACATTGGGAGGCTGG + Intronic
1166925434 19:46263818-46263840 CAGGATCCACAATGCCAGGCAGG + Intergenic
925663165 2:6224273-6224295 CAGGAAAAACAAGGGGAGACAGG + Intergenic
925799404 2:7583262-7583284 CAGGAGAAAGAATGGGAGGAAGG + Intergenic
926238737 2:11069120-11069142 CAGGCTCAACCATGGAAGCCAGG + Intergenic
926250136 2:11150738-11150760 CAGGAATTAAAATGGGAGGCAGG - Intergenic
926493365 2:13553627-13553649 CATGAGCAACAAAGGGAGGCCGG - Intergenic
926761413 2:16282053-16282075 CAGGAGCTAGAGTGGGAGGCGGG - Intergenic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
930605241 2:53486461-53486483 CAGGATCCACTAGGTGAGGCCGG + Intergenic
930698057 2:54431396-54431418 CAGGATGAAGAATGGGTGGACGG + Intergenic
932448528 2:71795116-71795138 CCTGCTCAAGAATGGGAGGCTGG - Intergenic
932513549 2:72321280-72321302 CACGATAAACTTTGGGAGGCTGG + Intronic
936394697 2:112115673-112115695 CAGAATCTCCAATGAGAGGCAGG - Intronic
936474011 2:112824051-112824073 CAGCATGAACAATGGGTGGAGGG - Intergenic
937102603 2:119283256-119283278 CATGACAAAGAATGGGAGGCAGG - Intergenic
938185413 2:129227541-129227563 CAGGACCCAGAGTGGGAGGCAGG - Intergenic
938319739 2:130355240-130355262 CGGGATCACCGAGGGGAGGCTGG - Intergenic
942949024 2:181701843-181701865 CAGGCTCTACAATGAGATGCAGG + Intergenic
943238638 2:185356129-185356151 CAGGAGCAAGAGAGGGAGGCAGG - Intergenic
943557645 2:189425805-189425827 CAGGACCAAGAATGGGAGGGAGG - Intergenic
945491000 2:210455126-210455148 CAAGATGAACAATGAGAAGCAGG - Exonic
946004610 2:216512847-216512869 AAGGAACAAGAATGGAAGGCTGG + Intronic
946158128 2:217820285-217820307 GAACATCAACAATGGGTGGCTGG + Intronic
946366202 2:219250606-219250628 CAGGCACCACAGTGGGAGGCTGG + Exonic
946369465 2:219271860-219271882 CAGGCACCACAGTGGGAGGCTGG - Intronic
947255863 2:228163170-228163192 CAGCAGCAACAATGACAGGCTGG + Intronic
947327295 2:228992560-228992582 CATGAACAGCAATGGGAGGGAGG - Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948211582 2:236197079-236197101 CAGGATCAACCATGGGTTGATGG - Intronic
948322228 2:237079730-237079752 TAGGAACCAAAATGGGAGGCAGG + Intergenic
1173209071 20:41017770-41017792 CAGGATCAGCTATGGGTGCCTGG - Intergenic
1173899290 20:46575526-46575548 CAGCAGGAACAGTGGGAGGCAGG - Intronic
1176170371 20:63693875-63693897 CAGGACCATGCATGGGAGGCAGG - Intronic
1176964755 21:15199618-15199640 TAGGATCAGCTATGTGAGGCAGG + Intergenic
1178586992 21:33879045-33879067 CAGGATGAAGCATTGGAGGCAGG + Intronic
1179714907 21:43281619-43281641 CAGGATGAACATCGGGAGGAGGG - Intergenic
1179790497 21:43753507-43753529 GAGGATCAGGGATGGGAGGCTGG + Intronic
1181304864 22:21909997-21910019 CAGCATCAACAAAGGCAGGATGG - Intergenic
1181967766 22:26668622-26668644 CAGGAACAAGGATGGGAGTCGGG + Intergenic
1181991904 22:26843452-26843474 CAGGGCCAAGAATGGAAGGCAGG + Intergenic
1183921863 22:41176291-41176313 CAGGATCAACAATGGGAGGCAGG - Exonic
1185244631 22:49766332-49766354 CAGGAGCCAGAGTGGGAGGCTGG + Intergenic
1203296488 22_KI270736v1_random:47422-47444 CAGCATCGTCAATGGGAGTCTGG + Intergenic
954405044 3:50340899-50340921 CAGGATCCAGACTGGGCGGCGGG + Intronic
954414520 3:50386611-50386633 CAGGATCCACAGTGCCAGGCTGG - Intronic
954532762 3:51335019-51335041 AAGAAGCAACACTGGGAGGCTGG - Intronic
954622400 3:52003610-52003632 CAGGAACACCAATGGTAGGGAGG - Intergenic
956901942 3:73726143-73726165 CAGGTTCAACACTGGGAGCTGGG + Intergenic
957966240 3:87324669-87324691 CAAGACCCACAATGGGATGCTGG + Intergenic
960319384 3:116215774-116215796 CAGGATACACCATGGTAGGCGGG + Intronic
966359172 3:179115833-179115855 TAGGAGCCAAAATGGGAGGCAGG - Intergenic
966389739 3:179439422-179439444 TAGGAACCATAATGGGAGGCAGG - Intronic
966816355 3:183893088-183893110 CAGGATCAAAGACAGGAGGCTGG + Intergenic
967823372 3:193859001-193859023 CAGGCCCCACAAAGGGAGGCAGG - Intergenic
971273323 4:25171917-25171939 CTGGAGCAACAAGGGGAGCCAGG - Intronic
972595142 4:40523352-40523374 CAAGATCAGCCATGGTAGGCCGG + Intronic
972713751 4:41624920-41624942 CAGGATCGCCAGTTGGAGGCAGG + Intronic
976778989 4:88737837-88737859 CAGGGGCAGCGATGGGAGGCAGG - Intronic
984960589 4:185093705-185093727 AAAGATCAACAATGGGATGTAGG + Intergenic
985285107 4:188329300-188329322 TAGGAACTAAAATGGGAGGCAGG + Intergenic
985887669 5:2692615-2692637 TAGGAACCAAAATGGGAGGCAGG - Intergenic
988889579 5:35599932-35599954 CACCATCAACAAGGGGAGCCTGG + Intergenic
988935394 5:36077045-36077067 CTGGTTCAACTTTGGGAGGCTGG + Intergenic
990618955 5:57539331-57539353 CAGGGTCAAAAATGGAATGCTGG - Intergenic
990681050 5:58244891-58244913 TAGCAGCAACAGTGGGAGGCAGG + Intergenic
992726180 5:79609466-79609488 CAGCATCAAAAATTTGAGGCGGG - Intergenic
993305598 5:86271576-86271598 CAGGATGAGGAATGGGAGGAAGG + Intergenic
993560595 5:89402590-89402612 CAGGGGCAACAAAGGGAGACAGG + Intergenic
994348019 5:98710668-98710690 CAGGAGCTACAATGGGAGATTGG + Intergenic
995793885 5:115922237-115922259 CTGGATCAGCATTGGCAGGCTGG + Intergenic
997825264 5:137100617-137100639 CAGGCTGTACAATGGCAGGCAGG - Intronic
999112966 5:149137991-149138013 CAATAACAGCAATGGGAGGCAGG + Intergenic
999501777 5:152154090-152154112 TAGGATCAACAAAGGAAGGAGGG + Intergenic
999843091 5:155449879-155449901 CAGCCACAACAATGGGAGGAAGG - Intergenic
999845393 5:155473995-155474017 CAGGCTCAACACTGGTAGTCTGG + Intergenic
1003215743 6:4109101-4109123 CAGAATCACAAATGCGAGGCAGG - Intronic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1007528404 6:42517885-42517907 CAGCATGAAGAATGGGAGGAAGG - Intergenic
1010591043 6:77712673-77712695 AAGGAACAACAAAAGGAGGCCGG + Intronic
1011037414 6:82992759-82992781 CAGGTTCAACAATGAGAGGCTGG + Intronic
1013689759 6:112627552-112627574 AAGAATAAAGAATGGGAGGCTGG - Intergenic
1015346386 6:132164326-132164348 CAGGATCAACAATTGGGGAATGG - Intergenic
1016735124 6:147469648-147469670 CAAGATCAAGAAGGGGAGGCAGG + Intergenic
1017689772 6:156952500-156952522 CACGACCAACCATGGGGGGCAGG - Intronic
1018735935 6:166687238-166687260 CAGGGTCAACGAAGCGAGGCAGG - Intronic
1019665028 7:2247521-2247543 CAGGAGCAGCGATGGGAAGCAGG + Intronic
1023002387 7:35823529-35823551 GAGGATCAAGGATGGAAGGCAGG - Intronic
1023004248 7:35846276-35846298 CAGGTCCAACAATGGGAGGCAGG - Intronic
1023305989 7:38827465-38827487 CAGGTACAATAATGGGAGACAGG + Intronic
1024582863 7:50814244-50814266 CAGGAACCAAAATGGGAGGCAGG - Intergenic
1025024142 7:55502483-55502505 CAGCATCCACAATGGGAGCCGGG - Intronic
1025219354 7:57092509-57092531 CAGGTGCAACAATGGGAGGTAGG + Intergenic
1025630146 7:63264080-63264102 CAGGTGCAACAATGGGAGGTAGG + Intergenic
1025652124 7:63479955-63479977 CAGGTGCAACAATGGGAGGTAGG - Intergenic
1026946211 7:74317808-74317830 CCTGATCAACACTGGGAGGTTGG + Intronic
1028369861 7:90078985-90079007 CAGGAAAAACCCTGGGAGGCAGG + Intergenic
1032803288 7:135333614-135333636 CAGGATGGACAATGTGAGGCTGG + Intergenic
1033362042 7:140644701-140644723 AAGGTTGAAGAATGGGAGGCAGG + Intronic
1033742283 7:144284476-144284498 CAGGAGCAGAAATGGGAGGAAGG + Intergenic
1033751619 7:144365138-144365160 CAGGAGCAGAAATGGGAGGAAGG - Exonic
1034429494 7:151034056-151034078 GAGCATCAACACTGGGTGGCTGG + Intronic
1035038650 7:155911658-155911680 CTGGATCACCACAGGGAGGCCGG + Intergenic
1037097850 8:15006781-15006803 CAGGTTCAAACATGGGAGACAGG - Intronic
1037432865 8:18832167-18832189 CAGCATCTAAAATGGCAGGCTGG - Intronic
1037569037 8:20142933-20142955 CAGGATGATGAATGGGTGGCAGG - Intergenic
1040093817 8:43423315-43423337 GAGGATCTTCACTGGGAGGCAGG + Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1045910949 8:107409392-107409414 CAGGTTCACCAATGGGACTCAGG + Intronic
1048013767 8:130479902-130479924 CAGGATCAAGAGTGTGAGGGGGG + Intergenic
1048323023 8:133416358-133416380 CAGGAGCAAGAAAGTGAGGCAGG - Intergenic
1048388406 8:133935583-133935605 TAGGAACCAAAATGGGAGGCAGG + Intergenic
1048437128 8:134428710-134428732 CAGGATCCAAAATGGGTGGGAGG + Intergenic
1049660609 8:143818183-143818205 CAGGAACATCAAGGTGAGGCAGG - Exonic
1049880460 8:145058615-145058637 CAGGATCAACAATGGGCTGTGGG - Intergenic
1053064682 9:35059603-35059625 CAGGATCAATGATGTCAGGCCGG + Exonic
1053139516 9:35673982-35674004 CGGGATCAACAGAGGGAGCCAGG - Exonic
1054442727 9:65282242-65282264 CAGGATCATAAATGGAAGGGAGG - Exonic
1055599206 9:77897775-77897797 CAGGGGCCACAATGTGAGGCTGG + Intronic
1059277226 9:113107199-113107221 AAGGATCAAAGAGGGGAGGCAGG + Intergenic
1059279025 9:113117352-113117374 AAGGATCAAAGAGGGGAGGCAGG - Intergenic
1059795351 9:117688793-117688815 CATCAGAAACAATGGGAGGCCGG + Intergenic
1061867723 9:133502836-133502858 CAGGAGCAACAATGGGAATTAGG + Intergenic
1061954484 9:133954543-133954565 CAGGTCCAGCCATGGGAGGCTGG + Intronic
1062095005 9:134698606-134698628 CAGGTACAACACTGGGAGGAAGG - Intronic
1185932847 X:4222061-4222083 CAAGCTCCACAATGGAAGGCTGG - Intergenic
1187114413 X:16334463-16334485 CAGGAGCAACAGAGTGAGGCAGG + Intergenic
1187491589 X:19757255-19757277 CAGGAACCAAAAGGGGAGGCAGG - Intronic
1187683019 X:21787037-21787059 CAGTATCAACTATGAGAGGAGGG - Intergenic
1188743505 X:33813940-33813962 CTGGCTCAATAATGGGAGGTTGG + Intergenic
1189211389 X:39286968-39286990 CAAGATCATTAATGGGAGGCTGG - Intergenic
1189409336 X:40755923-40755945 CAGGATCTACTATGGGATGGAGG + Intergenic
1189518578 X:41741716-41741738 CAGGATCATGACTGGGAGGGTGG - Intronic
1193322960 X:80146201-80146223 TAGGAACCAAAATGGGAGGCAGG - Intergenic
1194674993 X:96783683-96783705 CAGAATCAAGACTGGGAGGAGGG - Intronic
1197192493 X:123663404-123663426 CAGGAACAGCAATGGAAGGAGGG + Intronic
1197763243 X:130042432-130042454 CAGGCTTAATAATGGGAGTCAGG + Intronic
1197903091 X:131394300-131394322 CAGGATAGAGAAGGGGAGGCTGG - Intronic
1197996218 X:132377594-132377616 AAGGAGGAACAATGGGAAGCAGG + Intronic
1199081967 X:143587210-143587232 TAGGAACAAAAATGGGAGGCAGG - Intergenic