ID: 1183922118

View in Genome Browser
Species Human (GRCh38)
Location 22:41177682-41177704
Sequence CAACAGCCACCCTGGAGCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 292}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183922116_1183922118 -8 Left 1183922116 22:41177667-41177689 CCGACAGGGATGCAGCAACAGCC 0: 1
1: 0
2: 0
3: 13
4: 216
Right 1183922118 22:41177682-41177704 CAACAGCCACCCTGGAGCCAAGG 0: 1
1: 0
2: 0
3: 37
4: 292
1183922105_1183922118 30 Left 1183922105 22:41177629-41177651 CCAGAGGTCCCAGTGGGCATTTG 0: 1
1: 1
2: 9
3: 111
4: 345
Right 1183922118 22:41177682-41177704 CAACAGCCACCCTGGAGCCAAGG 0: 1
1: 0
2: 0
3: 37
4: 292
1183922107_1183922118 22 Left 1183922107 22:41177637-41177659 CCCAGTGGGCATTTGGAGCCAGG 0: 1
1: 0
2: 2
3: 16
4: 270
Right 1183922118 22:41177682-41177704 CAACAGCCACCCTGGAGCCAAGG 0: 1
1: 0
2: 0
3: 37
4: 292
1183922115_1183922118 4 Left 1183922115 22:41177655-41177677 CCAGGGATGGGACCGACAGGGAT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1183922118 22:41177682-41177704 CAACAGCCACCCTGGAGCCAAGG 0: 1
1: 0
2: 0
3: 37
4: 292
1183922109_1183922118 21 Left 1183922109 22:41177638-41177660 CCAGTGGGCATTTGGAGCCAGGG 0: 1
1: 0
2: 1
3: 19
4: 227
Right 1183922118 22:41177682-41177704 CAACAGCCACCCTGGAGCCAAGG 0: 1
1: 0
2: 0
3: 37
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183922118 Original CRISPR CAACAGCCACCCTGGAGCCA AGG Exonic
900814367 1:4832040-4832062 CTACAGCCACCCTAGAGTTATGG - Intergenic
901424767 1:9175009-9175031 CAACAGCCAGCAAGAAGCCAAGG + Intergenic
901437490 1:9256584-9256606 CAGCAGCCACTCTGGGTCCATGG - Intronic
901526605 1:9826875-9826897 CATCAGAGGCCCTGGAGCCATGG + Intergenic
903063797 1:20687254-20687276 CAGCAGACACAGTGGAGCCACGG + Intronic
903780195 1:25815868-25815890 TACCCGCCACCATGGAGCCAAGG - Exonic
905605752 1:39297733-39297755 CAACACCCACCATGGAGTCCTGG - Exonic
907315926 1:53572570-53572592 CAACAGCCTCCGTGCAGTCAGGG + Intronic
909796593 1:79747049-79747071 CAACATCCATTCTGAAGCCATGG - Intergenic
911764806 1:101661588-101661610 CAGCAGCCAGCCTGGAGCCTGGG + Intergenic
912450803 1:109766408-109766430 CAGCAGCCAGCCTGGTACCAGGG - Intronic
912871548 1:113311353-113311375 CAACTTCCATCCTAGAGCCAAGG - Intergenic
913111439 1:115660888-115660910 CATCAGCCATCCCAGAGCCAAGG - Intronic
914357911 1:146903918-146903940 CAACAGCCAGCAGGGAGCTAAGG - Intergenic
915278709 1:154807777-154807799 CACCACCCAACCAGGAGCCAGGG - Intronic
915752857 1:158228274-158228296 CAAATGCCATCCAGGAGCCAAGG - Intergenic
916082311 1:161242093-161242115 CAGCAGTGACCCTGAAGCCAGGG - Intergenic
916189778 1:162167540-162167562 CCACAACCACCCTGGCACCAGGG - Intronic
916659523 1:166908821-166908843 AAACAGCCTCCCTGAAGCCTTGG + Exonic
917358395 1:174150311-174150333 CAACAACAACCCTTTAGCCATGG + Intergenic
917724221 1:177813895-177813917 CAAAACCCAGCCTGTAGCCAGGG + Intergenic
918132058 1:181638173-181638195 CAACAGCCATTCTGTTGCCAGGG - Intronic
918407553 1:184225844-184225866 CAGCAGCCACGCAGGAGGCAGGG + Intergenic
919887643 1:201946516-201946538 CAGCAGCCTCCCTGAAGCCCAGG + Exonic
920180740 1:204130385-204130407 CAAAAAGCACCCTGGTGCCATGG - Intergenic
920516376 1:206587488-206587510 CAACAGGCACCTTGGGGCCGCGG - Exonic
921483448 1:215689711-215689733 CAACAGCCAACAGGAAGCCAGGG + Intronic
922796711 1:228343107-228343129 CCACAGCCACCCCTGAGCCTGGG - Intronic
923113201 1:230909763-230909785 TAACAGCCACCTTGGAGCCCTGG - Intronic
1063474145 10:6313928-6313950 CAACACTCACCCTAGCGCCAAGG + Intergenic
1063543239 10:6955543-6955565 TGACAGCCAGCCTGGAGACAGGG + Intergenic
1063942703 10:11146880-11146902 CAGCAGCCAGCCTGTAGCCTTGG + Intronic
1065687219 10:28298334-28298356 CAACATCCACTCTGTACCCATGG - Intronic
1067559606 10:47295681-47295703 CTACAGCCACCTTAAAGCCATGG + Intergenic
1069125478 10:64627465-64627487 CCACAGTCATCCTGTAGCCATGG + Intergenic
1069638221 10:69938373-69938395 CACCACCCTCCCTGGAGCCCGGG + Intronic
1070680366 10:78444822-78444844 ACACAGCCACCTGGGAGCCAAGG - Intergenic
1071301076 10:84256652-84256674 CAGCAGCCAGCTGGGAGCCAGGG - Intronic
1072299022 10:94041155-94041177 CAACTCCCACCCTGGACCCTAGG + Intronic
1072772051 10:98150323-98150345 CAACAGCAAACAGGGAGCCAAGG - Intronic
1073453585 10:103623438-103623460 CAGCTGGCACCCTGGAGCCCTGG - Intronic
1074692906 10:116022929-116022951 CAATTGCCTCCCTGGAACCAGGG + Intergenic
1074891185 10:117737770-117737792 CAGCAGGGACCCTGGAGCAAAGG - Intergenic
1075330048 10:121567244-121567266 CAACAGCCACACAGGAGGCCCGG + Intronic
1075586892 10:123665060-123665082 CAACAGAGACCCTGGACACAGGG - Intergenic
1077315406 11:1917444-1917466 CAACAACTGCCCTAGAGCCAAGG + Intergenic
1079334517 11:19559592-19559614 CCTCAGCCACCCTAGTGCCAAGG - Intronic
1080652316 11:34232668-34232690 CAACCACCACCCTGCACCCAAGG - Intronic
1080749673 11:35140179-35140201 CATCAGGGACCCTGGAGCTAGGG + Intronic
1080928912 11:36787077-36787099 CAACAGCCAGCAAGGAGACAGGG - Intergenic
1081910620 11:46697596-46697618 CAACAGCCACCCTATCACCAGGG + Intronic
1086401046 11:86461144-86461166 CAACAGGCAGCCTGATGCCATGG + Intronic
1089150720 11:116361755-116361777 CAGCAGTTACACTGGAGCCAGGG - Intergenic
1089589545 11:119531689-119531711 AGACAACCACCCTGGAGCCCTGG + Intergenic
1090074517 11:123571631-123571653 CACCAGCCACCTTTAAGCCATGG - Intronic
1090428569 11:126627521-126627543 CGTCAGTCACCATGGAGCCAGGG - Intronic
1090659074 11:128869107-128869129 CACCAGCCACCCTGGTCCCGGGG + Intergenic
1090878473 11:130812704-130812726 CCACTGCAAACCTGGAGCCAGGG + Intergenic
1092277078 12:7069543-7069565 CCACAGCCCCCCTGGAGGCAGGG - Intronic
1092300941 12:7249554-7249576 CCACCACCTCCCTGGAGCCAGGG - Intergenic
1092784100 12:12012282-12012304 CATCAGCCCCCCTGGTGCCCAGG + Intergenic
1093686940 12:22067342-22067364 CAACATCCATTCTGAAGCCATGG - Intronic
1096152284 12:49322251-49322273 CAAAAGGCAACCTGGAGGCAAGG + Intergenic
1096981111 12:55728671-55728693 CAACACCCAGCCTGGAGAAACGG + Intronic
1097896819 12:64832802-64832824 CAACAGCCAGCAAGGAACCATGG - Intronic
1098667364 12:73180634-73180656 GAATAGTCACCCTGGAGCTAGGG + Intergenic
1099614022 12:84912447-84912469 CATTAGCCACCCAGGAGCCTGGG - Intronic
1100596024 12:96072859-96072881 CAACCGCCACCCTGAGGCAAGGG + Intergenic
1101850545 12:108398688-108398710 CAACTGCCACCCTGTAACCAAGG - Intergenic
1101858119 12:108461074-108461096 CAGCACCCACTCTGCAGCCAAGG + Intergenic
1104762921 12:131308286-131308308 CGACAGTCATCCTGGAGACATGG - Intergenic
1104801631 12:131558655-131558677 AAACAGCTACCCTGGGGCCAGGG - Intergenic
1107393148 13:39988207-39988229 AAACAGCAACCCTGGAGATATGG + Intergenic
1110148359 13:72221378-72221400 CAACATCAACCCTGGCCCCAGGG + Intergenic
1114062542 14:19032172-19032194 CAAAAGCCAGGCTGGAGTCAAGG - Intergenic
1114099719 14:19367825-19367847 CAAAAGCCAGGCTGGAGTCAAGG + Intergenic
1115950238 14:38713030-38713052 CAACAGCCAGCAAGAAGCCAGGG + Intergenic
1118662439 14:68028910-68028932 CTTCAGCCAGCATGGAGCCAAGG - Intronic
1119682579 14:76603992-76604014 CAGCAGCCTCCCGGGAGACACGG - Intergenic
1122092987 14:99352288-99352310 CGACAGCCTGACTGGAGCCACGG - Intergenic
1124143582 15:27099386-27099408 CAACAGCCACCTAGGAACCAAGG - Intronic
1124595242 15:31086548-31086570 CCACAGGCACCCAGAAGCCAGGG - Intronic
1126169307 15:45681350-45681372 CAAGAGCCACCCTCCACCCAAGG + Intronic
1128123544 15:65172866-65172888 CAAATGCCACCCTAGAGACAGGG - Intronic
1128547227 15:68576573-68576595 CACCAGTCACCCTGCACCCATGG - Intergenic
1128721780 15:69955492-69955514 TCACAGCCACCGTGGAGCCTGGG - Intergenic
1130427256 15:83813721-83813743 CAGCAGTCACCCAGGAGCCATGG - Intronic
1130651228 15:85763209-85763231 CAACCGCAACACTGGAGCAAGGG + Intronic
1132399347 15:101495988-101496010 CGAAACCCACCCTGGAGCCAAGG - Intronic
1132713836 16:1280791-1280813 CAACAGCCACACTGAAGCCGTGG + Intergenic
1133051633 16:3120365-3120387 GAACAGCCCCACTGGAGTCAAGG + Exonic
1134220066 16:12346783-12346805 CAACAGCCCTCCAAGAGCCAAGG - Intronic
1137734516 16:50713900-50713922 CATCAGCCTCCCAGGAGCCAGGG + Intronic
1137925823 16:52540777-52540799 CAGCAGCCAACTTGTAGCCATGG + Intronic
1138174299 16:54882767-54882789 GAAGTGCCACCCTGGAGCAAAGG + Intergenic
1139976273 16:70813374-70813396 CAACAGCCAGCAGGGAGCTAAGG + Intronic
1140940160 16:79713912-79713934 CAACAGCCAGCCAGGAACTAAGG + Intergenic
1141651179 16:85393954-85393976 CTCCAGGCACCCTGGGGCCACGG + Intergenic
1141693211 16:85607899-85607921 CACCAGCCACCCTGCAGGCCGGG - Intergenic
1142005128 16:87686059-87686081 CTCCAGCCACCCTCCAGCCACGG - Intronic
1142203595 16:88772396-88772418 CAACAGCCACGCTGGAGCTGAGG + Intronic
1142607063 17:1087788-1087810 CACCACCCTCCCAGGAGCCAGGG + Intronic
1142960802 17:3551398-3551420 CTACAGCAGGCCTGGAGCCAGGG - Intronic
1143500221 17:7334571-7334593 CAACAGACACCTGGGAGGCATGG + Intergenic
1144094792 17:11890416-11890438 CAAGAAACACCCTGGAACCATGG + Intronic
1144971061 17:19110263-19110285 CCACAGCTTCCCTGAAGCCAAGG + Intergenic
1144991363 17:19236426-19236448 CCACAGCTTCCCTGAAGCCAAGG + Intronic
1145202255 17:20956909-20956931 TAACAGCCAACGTGGAGCCAGGG - Intergenic
1145886303 17:28384654-28384676 CAAAAGCGACCCTGGCGCCGCGG - Intronic
1146405354 17:32532092-32532114 CAGCAGCCACATTGGAGCCAGGG - Intronic
1146576824 17:34001440-34001462 CACCAGCCCCACTGGACCCAGGG - Intronic
1147670133 17:42172073-42172095 CACCAGACAACCTGGAGCCAGGG + Intronic
1148079709 17:44960890-44960912 CAGCAACCACCCTGGAACCAGGG + Intronic
1148954656 17:51343697-51343719 CCACTGCCAACCTGCAGCCAGGG + Intergenic
1149584613 17:57777318-57777340 CAGCAGCCACTGTGAAGCCATGG - Intergenic
1151714663 17:75825231-75825253 CAAGAGCCTCCCTGGCCCCAGGG + Exonic
1152263188 17:79278242-79278264 CTGCAGGCAGCCTGGAGCCACGG - Intronic
1152278406 17:79371444-79371466 CAAGGGCCACTCTGCAGCCAGGG - Intronic
1152592330 17:81219829-81219851 CAACAGCCCTCCAGGAGGCAGGG + Intronic
1152878238 17:82800564-82800586 CCACAGGCACACTGCAGCCACGG - Intronic
1152936434 17:83140035-83140057 AAACAGCCAGCCAGGACCCACGG - Intergenic
1152936481 17:83140219-83140241 AAACAGCCAGCCAGGACCCACGG - Intergenic
1152936527 17:83140391-83140413 AAACAGCCAGCCAGGACCCACGG - Intergenic
1152943018 17:83182287-83182309 CAACAGGCACTCAGGAGCCATGG + Intergenic
1154337211 18:13475297-13475319 CAACAGGATCCCTGGAGCCCAGG + Intronic
1155073069 18:22333085-22333107 CAACAGCCAGCAAGGAGCTAAGG + Intergenic
1155818365 18:30344708-30344730 CAAAAGCCAACCTTGAGCCAAGG + Intergenic
1157573405 18:48728628-48728650 CAACAGCCAGTGAGGAGCCAAGG - Intronic
1157811239 18:50697723-50697745 CATCAGCCACCCCTGAGCCTGGG + Intronic
1158559729 18:58503890-58503912 CCACAGCATCCCTGGAGCCTGGG + Intronic
1158623195 18:59049988-59050010 CAACAGCCTCCCTGGGTCCTAGG - Intergenic
1160408606 18:78659808-78659830 CCACAGCCACCCTGGGGCATGGG + Intergenic
1160552172 18:79701152-79701174 CCACATCCACCCTGCAGCCCAGG + Intronic
1161516190 19:4697948-4697970 CAACGGCCACCAAGAAGCCATGG + Intronic
1162015719 19:7845534-7845556 CCACAGCCACCCTTGAGGCTAGG + Intronic
1163034647 19:14563732-14563754 CCACTGCCACCCAGGAGCCCAGG - Intronic
1163631063 19:18418120-18418142 CAACTGCCACCGCGCAGCCAGGG + Intergenic
1164534296 19:29073593-29073615 CAACAGCCTCCCTGATGCCAAGG - Intergenic
1165675468 19:37719160-37719182 CAGCAGGGAACCTGGAGCCAAGG + Intronic
1165712818 19:38024208-38024230 AAACAGCTCACCTGGAGCCATGG + Intronic
1165843858 19:38805638-38805660 CAACTGCAACCCTTCAGCCAGGG + Intronic
1165937279 19:39397102-39397124 CAACACCAGGCCTGGAGCCAGGG + Intronic
1166623080 19:44322537-44322559 CAACAGCAAACGGGGAGCCATGG - Intergenic
1166915930 19:46196219-46196241 CTCCAGCCACCCCAGAGCCATGG + Intergenic
1166925112 19:46261570-46261592 CTCCAGCCACCCCGGAGCCATGG - Intergenic
1167594885 19:50422398-50422420 CAACCCCCACCCTGGACCCTTGG - Intronic
1167793043 19:51692516-51692538 CATCAGGGACCCTGGAGTCAAGG - Intergenic
1168166196 19:54549624-54549646 CAACAGCCACCCCGTGGGCAAGG - Intergenic
925265735 2:2565305-2565327 ACACAGCCACACTGGAGCGAGGG - Intergenic
926051256 2:9746285-9746307 CAACAGCCATCCTGGAACTGAGG - Intergenic
927141660 2:20135172-20135194 CAGCTCCCACCCTGGGGCCATGG + Intergenic
927487620 2:23499511-23499533 CCATAGCTACCCTAGAGCCAGGG - Intronic
928586594 2:32765234-32765256 CAACAACCACTCCGCAGCCATGG - Intronic
929600221 2:43199996-43200018 CACCACATACCCTGGAGCCAGGG - Intergenic
930032985 2:47069597-47069619 CCACAGGCCTCCTGGAGCCAGGG - Intronic
931284729 2:60822470-60822492 CATCAGAATCCCTGGAGCCATGG - Intergenic
932114274 2:69031888-69031910 CAGGAGCCACCCTGGAGCAGTGG - Intronic
932122137 2:69111849-69111871 CCACAGCAGCCCTGGAGCCCAGG - Intronic
933012088 2:77078925-77078947 GGACAGCCACCCATGAGCCAGGG - Intronic
933177407 2:79191119-79191141 CCACACCCACCCTGGACCCTGGG - Intronic
933714562 2:85350574-85350596 CAGCAGCAGCCGTGGAGCCAAGG + Intronic
934554446 2:95279947-95279969 CCCCAGCCACCCAGAAGCCAAGG + Exonic
934771461 2:96910264-96910286 CAAAAGTCCCCATGGAGCCACGG + Intronic
938115739 2:128602026-128602048 CCCCAGCCAGCCTGGGGCCAAGG - Intergenic
938227349 2:129627298-129627320 CCACAGCCACCCTGGCACCCAGG - Intergenic
938479906 2:131652378-131652400 CAAAAGCCAGGCTGGAGTCAAGG - Intergenic
939668317 2:144978045-144978067 CATCAACTACCCTGGAGGCAGGG - Intergenic
941962087 2:171263522-171263544 CAGCTGCCTCCCTGGCGCCAGGG + Intergenic
942457734 2:176149493-176149515 CAAAAGCCCCACTCGAGCCAGGG + Intergenic
943012589 2:182468788-182468810 CAACATCCATTCTGAAGCCATGG - Intronic
945851562 2:215014410-215014432 ACACAGCAACTCTGGAGCCAGGG + Intronic
945949937 2:216029556-216029578 CAAGGGCCAGCCTGGAGGCAGGG - Intronic
946176862 2:217927639-217927661 CATCAGGCACCCTGAAGCCTAGG + Intronic
946466319 2:219915033-219915055 CAACAGCCAGCATGGGGCCTGGG - Intergenic
946594226 2:221288418-221288440 CAACAGCCAGCAAGGAACCAAGG - Intergenic
948511164 2:238466253-238466275 CTAGAGCCGCCCTGGAGCCCAGG - Intergenic
948535267 2:238641664-238641686 CTACAGCCATGCTGGAGACAGGG - Intergenic
948860233 2:240749401-240749423 CAGGAGCCCCCCTGCAGCCATGG + Intronic
1169220885 20:3822099-3822121 TAGCACCCACCCTGGAGCCATGG + Exonic
1169988762 20:11475098-11475120 AAACTGCCATCCAGGAGCCAAGG - Intergenic
1170931686 20:20774355-20774377 CACCTGCCACCTTGGAGACATGG + Intergenic
1171108249 20:22456576-22456598 CAACAGCCTCCAAAGAGCCACGG - Intergenic
1175857158 20:62127919-62127941 CAACAGAGAACCTGGACCCAGGG - Intronic
1176156497 20:63624594-63624616 CAACAGCCTCACTGCAGGCAGGG + Intronic
1176246168 20:64098193-64098215 GAGGAGCCACCCGGGAGCCAGGG - Intronic
1176366805 21:6038149-6038171 CAGAAGCCACCCCTGAGCCACGG + Intergenic
1176415964 21:6474965-6474987 CAAGCGCCACCCGGCAGCCAAGG - Intergenic
1178909101 21:36659954-36659976 CAACTACCACCTTGGAGCCCAGG + Intergenic
1179033434 21:37740025-37740047 CACAAGCCACACTGGAGTCATGG - Intronic
1179691464 21:43083299-43083321 CAAGCGCCACCCGGCAGCCAAGG - Intergenic
1179756713 21:43500395-43500417 CAGAAGCCACCCCTGAGCCACGG - Intergenic
1179906071 21:44424013-44424035 CCACAGCCTCCCTGGAGGCCGGG - Intronic
1180481034 22:15754799-15754821 CAAAAGCCAGGCTGGAGTCAAGG - Intergenic
1181279360 22:21707998-21708020 CAACAGGCTCCCTCGAGCCAGGG + Intronic
1181510456 22:23386578-23386600 CCCCGGCAACCCTGGAGCCAGGG + Intergenic
1181870602 22:25895737-25895759 CACCTGCCACACTGCAGCCAAGG + Intronic
1183279059 22:36922538-36922560 GAGCAGCCATCCTGGAGCCTAGG - Intronic
1183284448 22:36953374-36953396 GAGCAGCCACCCTGGAGCCTGGG + Intergenic
1183317115 22:37142868-37142890 CACCACCCACCCAGAAGCCAGGG + Intronic
1183922118 22:41177682-41177704 CAACAGCCACCCTGGAGCCAAGG + Exonic
1184477479 22:44729451-44729473 CTACTGCCAGGCTGGAGCCAAGG + Intronic
1184718527 22:46295900-46295922 AAACAGCCACCCGGGGCCCAGGG - Exonic
1184799009 22:46748797-46748819 CAACAGCCTCCCAAGAACCAGGG + Intergenic
1185229459 22:49671855-49671877 CCTCAGCCCCGCTGGAGCCAGGG + Intergenic
950203821 3:11062842-11062864 GAAGAGCGACCCTGGAGCAAGGG + Intergenic
950530568 3:13550242-13550264 CCACAGCCACCCAGGTCCCATGG - Intronic
952676173 3:36032698-36032720 CCGCAGACACCCAGGAGCCAGGG + Intergenic
952969389 3:38641356-38641378 ACACACCCACCCTGAAGCCAGGG + Intronic
954825774 3:53372155-53372177 CAACAGAAACCCTGGAGCATAGG - Intergenic
955059464 3:55483217-55483239 CTACCTCTACCCTGGAGCCAGGG - Intronic
955118461 3:56030981-56031003 CAGGGGCCAGCCTGGAGCCAGGG - Intronic
956901006 3:73716068-73716090 CAAAAGCCACCATTGAGCCATGG - Intergenic
957041001 3:75335512-75335534 CAACAGCCAGTGAGGAGCCAAGG + Intergenic
961369974 3:126423140-126423162 CAGCTGCCACACTGCAGCCAGGG - Intronic
962207422 3:133446465-133446487 AGACAGCCACACTGGAGCAAGGG + Intronic
962252010 3:133841303-133841325 CCACAGCCACCGTGGAGTCCCGG + Exonic
962265743 3:133943063-133943085 CAACCCCCAGCTTGGAGCCAGGG + Intronic
963084977 3:141428065-141428087 CAACTGCCACCCGGGATCAAGGG + Intronic
964501566 3:157353802-157353824 GAACAGCCTCCATGGAGGCAAGG + Intronic
965469046 3:169067181-169067203 GATCAGCCACGCTAGAGCCAGGG + Intergenic
966821527 3:183928639-183928661 CCACAGGCATCCTGGAGGCACGG + Intronic
967668865 3:192207769-192207791 CATCAGCCACTCTGATGCCAAGG - Intronic
967710704 3:192704262-192704284 CAACAGCCATCCTATAGCTATGG - Intronic
967710708 3:192704312-192704334 CAACAGCCATTCTGCAGCCATGG - Intronic
968520043 4:1031066-1031088 GAACAGCCCCAGTGGAGCCAGGG - Intergenic
968978570 4:3834635-3834657 CAACAGCCACCATAAAGCCACGG - Intergenic
970977192 4:22055787-22055809 AAACAGCCACCCTGTGGCCATGG + Intergenic
972642126 4:40934455-40934477 CAACAGTGACCCAGAAGCCAAGG - Exonic
980807874 4:137837280-137837302 CATCACCCACCCTGGTGTCAGGG - Intergenic
981168342 4:141589961-141589983 CAACAGTCACCCTGTAGGTATGG + Intergenic
982969955 4:161972543-161972565 CAACAGCCAGCAAGGAACCAAGG + Intronic
983967527 4:173831198-173831220 CAACAGCCACCCTGGAAGAAGGG + Intergenic
985570798 5:643731-643753 CACCAGACACCCTGGGGCCAGGG + Intronic
985707216 5:1408499-1408521 GAAAACCCAGCCTGGAGCCAGGG - Intronic
985821680 5:2164766-2164788 CAAGAGCCAGCCTGGAGGCAAGG + Intergenic
986130706 5:4927241-4927263 CAACAGCAACCCTGGTCCCTGGG - Intergenic
990128361 5:52548041-52548063 CACCATCAAACCTGGAGCCATGG + Intergenic
990922135 5:60979376-60979398 GAAATGCCACCCAGGAGCCAGGG - Intronic
991920317 5:71650227-71650249 CCATAAACACCCTGGAGCCAAGG + Intronic
992669454 5:79044227-79044249 CTACAGCCATCCTCCAGCCATGG + Intronic
993181972 5:84564700-84564722 CCACAGCCACTCGGAAGCCATGG - Intergenic
993765713 5:91855062-91855084 CACTAGCAACCCTGGAGTCACGG - Intergenic
994354497 5:98779866-98779888 TCACAGCCACGCTGGAGCCAGGG + Exonic
997400994 5:133602234-133602256 CAAAAGCTACCCTGGAGCAGGGG + Intronic
998407365 5:141881792-141881814 AAACAGGTACCCTGGAGCCTAGG - Intergenic
999134101 5:149306358-149306380 CAGCAGCTACCCTGCAACCAGGG + Exonic
999743240 5:154572993-154573015 CAGCAGGCTGCCTGGAGCCAGGG + Intergenic
1000017325 5:157289523-157289545 AAACAGCCATCTGGGAGCCAAGG - Intronic
1000793063 5:165630686-165630708 CAAAAGTCACCCTGCACCCAGGG + Intergenic
1001381114 5:171307352-171307374 CAGGAGGCCCCCTGGAGCCAGGG + Exonic
1001966618 5:175914226-175914248 CAACGGCCACTCTGGAGTGAGGG + Intergenic
1002250329 5:177924978-177925000 CAACGGCCACTCTGGAGTGAGGG - Intergenic
1003110983 6:3252093-3252115 CGCCAGCCTGCCTGGAGCCAGGG + Intronic
1005733137 6:28718329-28718351 CCACAGCCACAATGGAGTCAGGG - Intergenic
1007684966 6:43660926-43660948 CAACATCCATCCTGCAGCCATGG - Intronic
1009430056 6:63556249-63556271 CAGGAGGCACCCTGGAGCCTCGG - Intronic
1009530586 6:64808221-64808243 CAACTGGCACACTGGAGCAAGGG + Intronic
1010569970 6:77464137-77464159 CCACCGCCACCCTGGTCCCACGG + Intergenic
1012476369 6:99618770-99618792 CAATAGCAACCCTGGCTCCAAGG - Intergenic
1014328476 6:120029080-120029102 AAACTGCCATCCAGGAGCCAGGG - Intergenic
1016781404 6:147963438-147963460 AAACAGCCACTGTGGAGTCAGGG + Intergenic
1018038136 6:159898942-159898964 CACCAGACACACTGGAGCAAAGG + Intergenic
1018287726 6:162258479-162258501 ACACAGGCACCCTGGAGCCCAGG + Intronic
1019150648 6:170003366-170003388 CAACTGTGACCCTGGAGACAAGG - Intergenic
1019161201 6:170067949-170067971 CAAAGGCCACCCTGCGGCCACGG + Intergenic
1019221952 6:170479966-170479988 CACCATATACCCTGGAGCCATGG + Intergenic
1019413074 7:914995-915017 CAGCAGCCTCCCTGCAGCCGGGG + Intronic
1019643920 7:2119085-2119107 CAGCAGTCACCCTGAAGCCCTGG - Intronic
1021095063 7:16526730-16526752 CAACACCCACCCTTGTGCCTCGG - Intronic
1021340527 7:19458021-19458043 CTGCAGCCACCATTGAGCCATGG - Intergenic
1024348085 7:48333889-48333911 CAACAAGCACCCAGGAGACAGGG - Intronic
1026441211 7:70446043-70446065 CAGGAGCCACCATGGAACCATGG - Intronic
1029196732 7:98810656-98810678 GAAAAGCCACCCAGGAGGCAAGG - Intergenic
1031704905 7:124968368-124968390 CAACAGACACTGTGGAGGCAGGG + Intergenic
1031794102 7:126149439-126149461 GCACAGCCACCCTGGAGTCAGGG - Intergenic
1032088005 7:128893747-128893769 CTACAGCCTCTCTGCAGCCAAGG + Intronic
1032502917 7:132413401-132413423 CAACTCTGACCCTGGAGCCAGGG + Intronic
1032761500 7:134947502-134947524 CCACAGCCGCCCTGGAGGGAGGG + Exonic
1033541348 7:142358625-142358647 CCACAGCCCCCATGGAGGCAGGG + Intergenic
1034286917 7:149890875-149890897 TGGCAGCCACCCTGGACCCAGGG + Intergenic
1034664202 7:152802024-152802046 TGGCAGCCACCCTGGACCCAGGG - Intronic
1035635776 8:1143105-1143127 CAGCGGCCACCCTCCAGCCAGGG + Intergenic
1035678154 8:1469261-1469283 CAGCAGCCACCCTGGCTCCCAGG + Intergenic
1037329175 8:17726863-17726885 CCACAGCCACAGTGCAGCCAAGG + Intronic
1037815805 8:22111170-22111192 CCACAGGCTCCCTGGAGGCAGGG + Intergenic
1037878608 8:22561741-22561763 CACCATCCACCCAGGAGCAAGGG + Intronic
1037882963 8:22581787-22581809 CACCAGCCACCTTGAAGCCCGGG + Intronic
1040054203 8:43043352-43043374 CAACTGCCACTCTGGTGCCTTGG + Intronic
1040564883 8:48556304-48556326 CGGCAGCCACTCTGGAGCCGCGG + Intergenic
1041184421 8:55284497-55284519 CAACAGCCAGCATGGAACCCAGG - Intronic
1046880401 8:119300738-119300760 CAACAACTAACCTGGAGCCTAGG - Intergenic
1047117702 8:121862829-121862851 CAACAGGCAAACTGCAGCCACGG - Intergenic
1048074697 8:131056666-131056688 ACACAGCCACCCAGGAGGCATGG - Intergenic
1048984967 8:139730408-139730430 CAGACGCCACCCTGGGGCCAGGG + Exonic
1049222563 8:141434661-141434683 CTACAGCCCCCCAGGAGACAGGG - Intergenic
1049317241 8:141975819-141975841 CACCACCAACCCAGGAGCCAGGG + Intergenic
1049519064 8:143079074-143079096 CAGCAGTCACGCTGGGGCCAGGG + Intergenic
1049679203 8:143909975-143909997 CAACAACCAACCTGGGGCCATGG + Intergenic
1052903700 9:33816865-33816887 CAACCGTCACTCTGGGGCCACGG + Intergenic
1053425505 9:38007474-38007496 CAACTCCCACCCTGACGCCAAGG + Intronic
1053556512 9:39143423-39143445 AATCAGGCATCCTGGAGCCAAGG + Intronic
1053820625 9:41963722-41963744 AATCAGGCATCCTGGAGCCAAGG + Intronic
1054089490 9:60831850-60831872 AATCAGGCATCCTGGAGCCAAGG + Intergenic
1054110901 9:61107408-61107430 AATCAGGCATCCTGGAGCCAAGG + Intergenic
1054609956 9:67223717-67223739 AATCAGGCATCCTGGAGCCAAGG - Intergenic
1055266098 9:74497809-74497831 CAAACGTCACCCTGCAGCCACGG + Exonic
1056804091 9:89714481-89714503 CAACAGCCAATGAGGAGCCAAGG - Intergenic
1057220784 9:93256736-93256758 CTCCAGCCAGCCTGGAGCCAGGG - Intronic
1057391311 9:94643471-94643493 CAACAGCCGCCCTCAACCCAGGG + Intergenic
1058806996 9:108602507-108602529 AAACAGCCAGTCTGGAGGCAGGG + Intergenic
1059165466 9:112072889-112072911 CTTCAGCCCCCTTGGAGCCAGGG + Intronic
1060665399 9:125429572-125429594 CAGCAGCCACCCTAGAGTGAAGG - Intergenic
1061053012 9:128207097-128207119 CAACACCCACCCAGGAGCTCAGG - Intronic
1061118685 9:128630007-128630029 CTGCAGCCACCCTGCACCCATGG + Intronic
1061649949 9:132039605-132039627 CAAAGGCCACACTGGATCCAAGG + Intronic
1061778923 9:132984514-132984536 CAGCAGCCTCCCAGAAGCCAGGG - Intronic
1061972209 9:134050870-134050892 CAAGGGCCACCCTGGAGTCATGG + Intronic
1062366900 9:136214522-136214544 CAACAGCCAGCATGGAGCTCAGG + Intronic
1062566170 9:137164900-137164922 CCAGGGCCACCCAGGAGCCAGGG + Intronic
1062658576 9:137616528-137616550 CAACAGCCATCTGGGAGCCAGGG - Intronic
1187268957 X:17762480-17762502 CAAAAGCCACAGTGGAGTCAAGG - Intergenic
1187320569 X:18234176-18234198 CAAAAGCCACAGTGGAGTCAAGG + Intergenic
1189135740 X:38547462-38547484 CAACAGCCAGCAAGGAACCAAGG + Intronic
1192212466 X:69136722-69136744 CAACAGGCTTCCTGGAGTCACGG + Intergenic
1192261909 X:69510654-69510676 AAACAGCCTCCCGGGAGCCATGG + Intronic
1195294615 X:103463676-103463698 CAACAGACCCCTTGGGGCCAGGG + Intergenic
1195965605 X:110427501-110427523 GAACTGGCACCCTAGAGCCATGG + Intronic
1196320560 X:114334905-114334927 CAGGAGCCAGCCTGGAGCCTGGG + Intergenic
1196969783 X:121096279-121096301 TAATAGCCACCCAGAAGCCATGG - Intergenic
1199982897 X:152930623-152930645 CAACTGCCACCCTTGAAGCAGGG - Intronic