ID: 1183929842

View in Genome Browser
Species Human (GRCh38)
Location 22:41229727-41229749
Sequence TCTACTCTTCTGTGCCCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183929842_1183929847 3 Left 1183929842 22:41229727-41229749 CCACCTGGGCACAGAAGAGTAGA 0: 1
1: 0
2: 0
3: 20
4: 218
Right 1183929847 22:41229753-41229775 AGGTTTCTTTGGCATTTTCTGGG 0: 1
1: 1
2: 4
3: 59
4: 568
1183929842_1183929845 -8 Left 1183929842 22:41229727-41229749 CCACCTGGGCACAGAAGAGTAGA 0: 1
1: 0
2: 0
3: 20
4: 218
Right 1183929845 22:41229742-41229764 AGAGTAGAGTCAGGTTTCTTTGG 0: 1
1: 0
2: 1
3: 9
4: 192
1183929842_1183929848 27 Left 1183929842 22:41229727-41229749 CCACCTGGGCACAGAAGAGTAGA 0: 1
1: 0
2: 0
3: 20
4: 218
Right 1183929848 22:41229777-41229799 ACCAAGCAGTCCTGTACCACTGG 0: 1
1: 0
2: 0
3: 6
4: 87
1183929842_1183929846 2 Left 1183929842 22:41229727-41229749 CCACCTGGGCACAGAAGAGTAGA 0: 1
1: 0
2: 0
3: 20
4: 218
Right 1183929846 22:41229752-41229774 CAGGTTTCTTTGGCATTTTCTGG 0: 1
1: 0
2: 0
3: 24
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183929842 Original CRISPR TCTACTCTTCTGTGCCCAGG TGG (reversed) Exonic
900532295 1:3160574-3160596 TCTCCTCTTCACTGCCCACGAGG + Intronic
900800291 1:4732996-4733018 TGGACTCTTCTTTGCCCAGCAGG + Intronic
901953734 1:12769328-12769350 TCTGCAGTGCTGTGCCCAGGAGG + Intergenic
902259436 1:15213700-15213722 TCTCCGCTCCTGTGCCCAGCTGG - Intronic
904004442 1:27356500-27356522 TCTACTCTTCTGCGCCCCACAGG - Exonic
910555855 1:88532090-88532112 CCTCCTCTTCTGTCCCCAGAGGG - Intergenic
912021241 1:105111139-105111161 TCTACTCTCCCCTGCCCAGAGGG + Intergenic
913989594 1:143598514-143598536 TCTACTCTTCTAGGCTCAGCAGG - Intergenic
914241740 1:145857413-145857435 TCTCCTATCCTGTTCCCAGGAGG - Intronic
914350824 1:146838725-146838747 TCTACTCATCTTTGCCCATGTGG + Intergenic
914433032 1:147636879-147636901 GCTACCTTTCAGTGCCCAGGAGG - Intronic
916439323 1:164807332-164807354 TCTTCTGTTCGGTGCCCAGATGG + Intronic
917120161 1:171638559-171638581 TCTTCCCTTTTGTGCCCACGTGG - Intronic
918800206 1:188961245-188961267 TCTACTGTTCTGGGGCCTGGAGG - Intergenic
919717625 1:200796108-200796130 GCTACTCTGCTATACCCAGGTGG - Intronic
1063071924 10:2675417-2675439 CCTCCTCTTCTGTGACCAGGAGG + Intergenic
1064158794 10:12925660-12925682 TCTTCTCTTCTTTTCCAAGGTGG + Intronic
1065544268 10:26802924-26802946 TCTCCTGTTCTGTGCCCGGTAGG - Intronic
1070917121 10:80161983-80162005 TGGACTCGTCTGTTCCCAGGCGG + Exonic
1071834805 10:89408481-89408503 TCTAATCTTCCCTGCCCAGAAGG + Intronic
1072804597 10:98416689-98416711 TCTGCTCCTCTGAGGCCAGGAGG - Exonic
1076380232 10:130020334-130020356 TCTACTCTACCGTGGCAAGGTGG - Intergenic
1076892910 10:133293558-133293580 GCTACTCCGCTGTGACCAGGTGG - Exonic
1077441140 11:2569845-2569867 TTTCCACTTCTGTGCCTAGGGGG + Intronic
1077577519 11:3395774-3395796 TTTACTGTTCTGTGCCCTGGGGG + Intergenic
1077604017 11:3594896-3594918 TTTACTATTCTGTGGCCTGGGGG + Intergenic
1077911874 11:6579543-6579565 TTTATTTTTCTGTGGCCAGGTGG + Intronic
1078551308 11:12282297-12282319 AGTACTCTCCTGTGCCCAGCTGG + Intronic
1078773123 11:14369448-14369470 TCTTCCCTTCTGTGCCCATGGGG + Intergenic
1082093133 11:48105771-48105793 TCTACCCTGCTGTGCCCACTAGG + Intronic
1082831569 11:57622361-57622383 CCTGCTCCTCTGTGCCCAAGAGG - Intergenic
1083508450 11:63183814-63183836 TGTCCTCTTCTTTGCTCAGGTGG - Exonic
1083876699 11:65527903-65527925 TATAGTGTTCTGTGCCCAGCAGG + Intronic
1083939038 11:65885273-65885295 TTTCCTCTTTTGTCCCCAGGGGG - Intronic
1084226470 11:67717713-67717735 TTTACTATTCTGTGGCCTGGGGG + Intergenic
1084229465 11:67740560-67740582 TTTACTGTTCTGTGGCCTGGGGG + Intergenic
1084259914 11:67969488-67969510 TTTACTATTCTGTGGCCTGGGGG + Intergenic
1084388620 11:68860737-68860759 TTCACTCTTGTTTGCCCAGGCGG - Intergenic
1084808722 11:71599142-71599164 TTTACTATTCTGTGGCCTGGGGG - Intronic
1084845827 11:71899152-71899174 TTTACTATTCTGTGGCCTGGGGG - Intronic
1085484550 11:76850940-76850962 TCTTCTCTGCTGTGCCAAGCTGG - Intergenic
1086309781 11:85522492-85522514 TCTACTATTCTGGGGCCTGGAGG - Intronic
1087773955 11:102240908-102240930 TCGACCCTTCACTGCCCAGGAGG + Intergenic
1088143942 11:106652109-106652131 ACTACACTTCTGTGCCCACCTGG - Intergenic
1090500007 11:127252074-127252096 TCCCCTCTTCTGTGTCCAGAGGG - Intergenic
1091410686 12:237287-237309 TCAACCCTTCTCTCCCCAGGCGG - Exonic
1092242391 12:6843294-6843316 CCTACCCTCCTGTGCCCAGCTGG + Intronic
1092434122 12:8432651-8432673 TTTACTCTTCTGTGGCCTGTGGG + Intergenic
1094323113 12:29206936-29206958 ACTCCTCTTCTGTGCCCGGCTGG - Intronic
1094356571 12:29584320-29584342 TATATTCTTCTGTGTCCAAGTGG - Intronic
1096219634 12:49820968-49820990 TCTTCTCTCCTGTGCCCTGCAGG - Intronic
1096266080 12:50123696-50123718 TCTCCTCTCCGTTGCCCAGGCGG + Intergenic
1096935126 12:55265256-55265278 TTTACTGTTATGTGCCAAGGAGG + Intergenic
1097263539 12:57733101-57733123 TCATCTTTTCTGTGACCAGGTGG + Intronic
1097275655 12:57811690-57811712 TGTGCTCCTCTGTGCCCAGAAGG + Intronic
1099378832 12:81930080-81930102 TCTAATCTTATGTCCCCAAGAGG - Intergenic
1102267993 12:111505117-111505139 GCTACTCATTTGAGCCCAGGAGG + Intronic
1104296746 12:127522704-127522726 TCTCCTCTTCTGTGTGCATGGGG + Intergenic
1105602881 13:21902727-21902749 TTTTGTCTTCTGTGCCCAGCAGG + Intergenic
1109117996 13:58414356-58414378 TCTGCCTTTCTGTGACCAGGTGG - Intergenic
1109361023 13:61294625-61294647 TATACTCTTTTCAGCCCAGGGGG - Intergenic
1110285491 13:73745203-73745225 TGTTCTCTTATGTCCCCAGGTGG - Intronic
1113231481 13:108217813-108217835 TGTACACTTCAGTGCACAGGGGG + Intronic
1117247905 14:53904082-53904104 TCTATGCTTCTCTGCCCAGAAGG + Intergenic
1117293246 14:54353841-54353863 TCTGCCCTTGTGTGCCCATGTGG + Intergenic
1121488531 14:94341055-94341077 TGTGCTCTCCTGTGCCCAGCTGG - Intergenic
1122079389 14:99256561-99256583 TTTATACTTCTGAGCCCAGGAGG - Intronic
1122179854 14:99947058-99947080 TCTGCTCTTCTGCCACCAGGTGG - Intergenic
1124400735 15:29345511-29345533 TCAACTCTCCTGTGTGCAGGGGG - Intronic
1124844328 15:33275726-33275748 TCTCCTCTCCTCTCCCCAGGTGG + Intergenic
1126961856 15:54005320-54005342 TCTATACTACTGTGCCCAGGAGG - Intergenic
1130357255 15:83144921-83144943 GTTACTCATCTGTGGCCAGGAGG - Intronic
1132397792 15:101487696-101487718 ACTTCGCTGCTGTGCCCAGGTGG - Intronic
1132468061 16:86695-86717 TCTGCTCCCCTGAGCCCAGGCGG - Exonic
1135596003 16:23743765-23743787 TCTCCTCGTCTGTGCACAGATGG - Intergenic
1138193066 16:55032418-55032440 CCCAGTCTTCTGTGCCCAGACGG - Intergenic
1140863449 16:79039443-79039465 TCTGCACAGCTGTGCCCAGGAGG - Intronic
1141800040 16:86301254-86301276 TCTCCTGCTCTGAGCCCAGGAGG + Intergenic
1142112824 16:88341289-88341311 TCTATTCTCCAGGGCCCAGGAGG + Intergenic
1142200817 16:88760320-88760342 TCAACTCTTCTTTGTCCATGAGG - Intronic
1143123456 17:4624788-4624810 TGTCCTCTTCTGTGGCCTGGAGG + Intergenic
1144670798 17:17131598-17131620 TCTCCTTTTCTCTTCCCAGGTGG + Exonic
1148687080 17:49507027-49507049 TCTCCCGTTCTGTGCCCTGGGGG - Intronic
1150399588 17:64846668-64846690 GCTACTCACCTGAGCCCAGGAGG + Intergenic
1152438670 17:80291806-80291828 TCTTCACTTCTGGGCTCAGGAGG + Exonic
1154529758 18:15331400-15331422 TCTTCCCCTCTGGGCCCAGGCGG - Intergenic
1156178221 18:34572702-34572724 TCTACTATTAGGTGCCTAGGAGG + Intronic
1156540266 18:37902934-37902956 TCTACTCTGCTTGGCCCAGTGGG - Intergenic
1161126630 19:2561443-2561465 ACTGCCCTTCTGTGCCCAGGAGG + Intronic
1161225339 19:3142150-3142172 TGTCCTCCTCCGTGCCCAGGAGG + Intronic
1162951640 19:14074687-14074709 TCTGGTCCTCTGTCCCCAGGAGG + Exonic
1163810582 19:19429102-19429124 TCTCCTCCTCCGTGCCCACGTGG + Intronic
1163934740 19:20432627-20432649 TCTCCTCATCTGTGCACAGATGG + Intergenic
1164312519 19:24058795-24058817 TCTCCTCTGCTTTGCCCACGTGG + Intronic
1164793349 19:31006318-31006340 TCTTCTCTTCTGTGGCCATCAGG + Intergenic
1167763312 19:51462677-51462699 TCTCCTCATCTGTCCCCTGGAGG + Intergenic
925437592 2:3853910-3853932 CCCACTCTTCTTTCCCCAGGGGG + Intergenic
926213062 2:10885740-10885762 TCTACTCTTCTGAGGGCAGCTGG - Intergenic
927194559 2:20538708-20538730 TGTTGGCTTCTGTGCCCAGGGGG - Intergenic
932348439 2:71011815-71011837 TTTACTATTCTGTGGCCTGGGGG - Intergenic
933920937 2:87043954-87043976 TCTACTGTTGTGTTCCGAGGAGG + Intergenic
933930690 2:87149843-87149865 TCTACTGTTGTGTTCCGAGGAGG - Intergenic
934002060 2:87725945-87725967 TCTACTGTTGTGTTCCGAGGAGG - Intergenic
936362434 2:111815611-111815633 TCTACTGTTGTGTTCCGAGGAGG + Exonic
937075754 2:119105175-119105197 CCTACTCTTTTCTGCCCATGTGG + Intergenic
937290448 2:120778632-120778654 TCTAGCTGTCTGTGCCCAGGGGG + Intronic
937524014 2:122745282-122745304 TATTCTCTTCTGTGTCCAGAAGG + Intergenic
938528852 2:132162840-132162862 TCTTCCCCTCTGGGCCCAGGCGG - Intronic
938721452 2:134070688-134070710 TCCACTCTGCTGGGGCCAGGAGG + Intergenic
938821650 2:134966660-134966682 TTTACTATTCTGTGGCCTGGGGG - Intronic
940668697 2:156640363-156640385 ACTACACTACTGTGCCCATGTGG + Intergenic
941439372 2:165514362-165514384 TCTTCTGTGATGTGCCCAGGGGG + Intronic
941537604 2:166742067-166742089 TCTAATCTCCTCTGCCCAGAAGG - Intergenic
943129266 2:183837333-183837355 TCTGCTCTTGGGGGCCCAGGAGG + Intergenic
943820331 2:192314161-192314183 TCTCCTCTTCTCTTCCAAGGTGG + Intergenic
943871656 2:193008078-193008100 TCTACCATTCTGTGCCCTGGAGG + Intergenic
947436873 2:230080437-230080459 TCACCTCTCCTGTTCCCAGGAGG + Intergenic
1169550551 20:6697445-6697467 TGTCCTGCTCTGTGCCCAGGAGG + Intergenic
1170069308 20:12347018-12347040 TCTTCTCTTCTGTGGACATGTGG + Intergenic
1171033407 20:21696643-21696665 TGTACTTTTCTGTAGCCAGGTGG + Intergenic
1171167003 20:22980907-22980929 TCTGCTCTGCTCTGCCCTGGAGG + Intergenic
1173898298 20:46567598-46567620 TCTACCCGTCTCTGCCCTGGAGG - Intronic
1174886680 20:54343382-54343404 TCCAGACTTCTGTGCCCAAGTGG + Intergenic
1175375135 20:58518944-58518966 CCTACCCTTCTTGGCCCAGGAGG - Intergenic
1175891054 20:62316122-62316144 TCCACCCTTCTGACCCCAGGAGG + Intronic
1176519104 21:7811767-7811789 TCCACTCCTCTGTCCCCACGTGG - Intergenic
1176767654 21:13037072-13037094 TCTTCCCCTCTGGGCCCAGGCGG + Intergenic
1176983067 21:15405272-15405294 TTGTCTCTGCTGTGCCCAGGAGG - Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1178443525 21:32618088-32618110 TTTACTATTCTGTGGCCTGGGGG - Intergenic
1178653132 21:34441780-34441802 TCCACTCCTCTGTCCCCACGTGG - Intergenic
1180580735 22:16834008-16834030 TCAACTGTTCAGTGCCTAGGAGG + Intergenic
1182357545 22:29729168-29729190 ACTCCTCGGCTGTGCCCAGGTGG - Exonic
1183929842 22:41229727-41229749 TCTACTCTTCTGTGCCCAGGTGG - Exonic
949271548 3:2223549-2223571 TCAACTCTTTTCTGCACAGGAGG - Intronic
952941007 3:38444353-38444375 TCTAATCTTCTCTGCCCAGAAGG - Intergenic
953369069 3:42371972-42371994 GCTGCTATTCTGTGGCCAGGAGG + Intergenic
954126702 3:48535406-48535428 TCTCCTCTCCTTTGCCCAAGGGG + Intronic
954287671 3:49630256-49630278 TCTGCTTTCCTGGGCCCAGGAGG + Intronic
956917860 3:73892117-73892139 TACAGTCTTCTGTGCCCAGGAGG - Intergenic
957046040 3:75375386-75375408 TTTACTGTTCTGTGGCCTGGGGG + Intergenic
957074867 3:75593911-75593933 TTTACTATTCTGTGGCCTGGGGG + Intergenic
958685387 3:97386659-97386681 TCTACTCTTCTGGGGTCTGGAGG + Intronic
961276338 3:125730220-125730242 TTTACTATTCTGTGGCCTGGGGG - Intergenic
961279240 3:125752802-125752824 TTTACTATTCTGTGGCCTGGGGG - Intergenic
961809727 3:129514830-129514852 CCCACACCTCTGTGCCCAGGTGG + Intronic
961878097 3:130039510-130039532 TTTACTGTTCTGTGGCCTGGGGG + Intergenic
962835185 3:139183562-139183584 TCATCTCAGCTGTGCCCAGGGGG - Intronic
962908737 3:139828355-139828377 TCTAATTTTCTGCCCCCAGGAGG - Intergenic
965270686 3:166613724-166613746 TCTACTAGGCTGTGCCCAGTGGG + Intergenic
966383353 3:179366838-179366860 TCTTCACTTCAGTGCCCAAGTGG + Intronic
968987515 4:3884567-3884589 TTTACTATTCTGTGGCCTGGGGG + Intergenic
968990314 4:3906546-3906568 TTTACTGTTCTGTGGCCTGGGGG + Intergenic
969018466 4:4121549-4121571 TTTACTATTCTGTGCCCTGGGGG + Intergenic
969730653 4:8955347-8955369 TTTACTATTCTGTGGCCTGGGGG - Intergenic
969735519 4:8987169-8987191 TTTACTGTTCTGTGGCCTGGGGG - Intergenic
969786824 4:9464977-9464999 TTTACTATTCTGTGGCCTGGGGG - Intergenic
969790253 4:9489460-9489482 TTTACTATTCTGTGTCCTGGGGG - Intergenic
969794738 4:9518624-9518646 TTTACTATTCTGTGCCCTGGGGG - Intergenic
969825009 4:9750820-9750842 TTTACTGTTCTGTGGCCTGGGGG - Intergenic
971920707 4:32935442-32935464 TCTACTCTTCTATGTTAAGGTGG - Intergenic
972191165 4:36592987-36593009 TCTCCTCTTCTGTCCCCAGCAGG - Intergenic
972930293 4:44063873-44063895 TCTACTCTTCTGGGGTCTGGAGG - Intergenic
973182986 4:47291496-47291518 TCTACTTTTCTGGGACCTGGAGG - Intronic
977222542 4:94354847-94354869 TCTACCCTTCTGTGCTCAGCTGG - Intergenic
977791730 4:101112895-101112917 TAGACACTTGTGTGCCCAGGAGG + Intronic
983225598 4:165083130-165083152 TAAACTCTTCAGTGCTCAGGGGG + Intronic
984774309 4:183467328-183467350 TCTACCATTCTGGGCCCTGGAGG - Intergenic
984924450 4:184794495-184794517 TCTGCCCTTCTGTGCTCAGCTGG - Intronic
984930601 4:184843956-184843978 TGATCTCTCCTGTGCCCAGGCGG - Intergenic
985187952 4:187337778-187337800 TCTACTTTGCTGTGCAAAGGTGG - Intergenic
985761687 5:1752200-1752222 TCTTCTTTTCTTTGCCCATGGGG - Intergenic
987599949 5:20054857-20054879 TCCAGTCTTCTGTGGCCAGATGG + Intronic
991587087 5:68212650-68212672 TGTACTCTACTGTACCCAGAGGG + Intergenic
992049290 5:72928419-72928441 TCTAATCTTCCCTGCCCAGAAGG + Intergenic
992078505 5:73213657-73213679 TCTTTTCTTCTCTGCTCAGGTGG - Intergenic
994556138 5:101306697-101306719 TTTAGTCTTCTGTGTCAAGGAGG + Intergenic
995619360 5:114006944-114006966 TCTACTTTTCTGAGGCTAGGAGG + Intergenic
997193346 5:131960556-131960578 TCCTCTCTTCTGGGCCCAGGAGG + Exonic
997600432 5:135134984-135135006 TCCACTCTCCCGTGCCCTGGTGG + Intronic
998097060 5:139401991-139402013 TCTCCTCTTCCTTGGCCAGGAGG + Exonic
999442629 5:151614384-151614406 TCTGCTGTGCTCTGCCCAGGGGG + Intergenic
999455275 5:151710393-151710415 TCTACTATTTTGTGTCCTGGTGG - Intergenic
1002607454 5:180391532-180391554 TCTGTTCTCCTGTGCCCAAGAGG - Intergenic
1002836372 6:868591-868613 TCTGCTCTGCTGTCCCCGGGTGG - Intergenic
1002963702 6:1941811-1941833 CCTGCTCTCCTGTGCCCTGGAGG - Intronic
1006423163 6:33948159-33948181 CCTACTCTTCTGAGACCACGTGG - Intergenic
1006486542 6:34347532-34347554 TTTTTTCTTCTGTGCCCATGTGG - Intronic
1009289453 6:61866042-61866064 TCTACTATTCTGGGCTCTGGAGG + Intronic
1010678126 6:78768040-78768062 TCTACTGTTCTGTGGTCTGGAGG - Intergenic
1011184239 6:84656779-84656801 TCTCCACTTCTGTACCCAGGGGG - Intergenic
1011375123 6:86679277-86679299 TCTAATCTCCCGTGCCCAGAAGG - Intergenic
1011554052 6:88556533-88556555 TCTGAGCTTCTGTGCCAAGGGGG + Intergenic
1013583246 6:111556327-111556349 TCCACTCTTCTTACCCCAGGTGG - Intergenic
1014270320 6:119329129-119329151 TCTAATCATCTATGGCCAGGGGG - Intronic
1014942987 6:127465301-127465323 TCTTCTTTTCTGTGCCGAAGTGG - Intronic
1017513719 6:155137261-155137283 TCTGCTTTTCTGTGGTCAGGGGG + Exonic
1018945223 6:168343253-168343275 CCTAATGTTCTGTGCTCAGGAGG + Intergenic
1020313143 7:6884600-6884622 TTTACTGTTCTGTGGCCTGGGGG + Intergenic
1022510888 7:30934189-30934211 TCTGCTTTTCTCTGCCCATGGGG + Intergenic
1026210163 7:68296907-68296929 TCTCTTGCTCTGTGCCCAGGAGG + Intergenic
1027757006 7:82226590-82226612 CCTCCTCTTCTGTACTCAGGAGG - Intronic
1029172595 7:98641542-98641564 TCTACTATCCTGTGCCTGGGTGG - Intergenic
1030628156 7:111866605-111866627 TCCACTCTGCTGTACCCCGGTGG + Intronic
1031978811 7:128110946-128110968 TTTCTTCTTCTCTGCCCAGGTGG + Intergenic
1032529534 7:132608892-132608914 CCTGCTCTGCCGTGCCCAGGTGG + Intronic
1032869385 7:135966602-135966624 GCATCTCTTCTGTGCCCAGGTGG - Intronic
1033466070 7:141590917-141590939 TCTGCTCCCCTGTGCCCAGGTGG - Intronic
1035120705 7:156564364-156564386 TCTACTCTTCTGGGGTCTGGAGG + Intergenic
1035299042 7:157885314-157885336 TCCACTCCACAGTGCCCAGGTGG + Intronic
1037680766 8:21095654-21095676 TCTACTCTTCTGCTTCCAGATGG + Intergenic
1041212574 8:55567766-55567788 TTTCCTTTTCTGTGTCCAGGAGG - Intergenic
1041842253 8:62285546-62285568 TCTCCTCTTCTGCTCCCAGTGGG + Intronic
1042595184 8:70439751-70439773 TCTGCTGCTCTGTGCCAAGGTGG + Intergenic
1044666435 8:94639062-94639084 TCAGCTCTGCTGGGCCCAGGAGG - Intergenic
1048181738 8:132201655-132201677 TCTACTCCAGTGTGTCCAGGAGG - Intronic
1048276273 8:133068312-133068334 TCTACCCTTGAGTGCCCAGGAGG + Intronic
1048768299 8:137867961-137867983 TCTACTCTTCTGGGGTCTGGAGG - Intergenic
1049806865 8:144545044-144545066 TCTTCACCTCAGTGCCCAGGTGG + Intronic
1057198479 9:93128000-93128022 TCTAAAATTATGTGCCCAGGAGG + Intronic
1059165075 9:112069617-112069639 TCTCCTCTTCTCAGCCAAGGTGG + Intronic
1059654790 9:116347734-116347756 TCTGCTCTTCTCTGCCCAGCTGG - Intronic
1060495777 9:124117831-124117853 TCTCCTCTTCTTTGGCCTGGAGG - Intergenic
1061821334 9:133228510-133228532 TCTCCTCGTCTGAGGCCAGGAGG + Intergenic
1061834114 9:133317853-133317875 TCTCCTCGTCTGAGGCCAGGAGG - Intergenic
1062178686 9:135179080-135179102 TCTAGTCTTCTGTTTCCTGGTGG - Intergenic
1062237912 9:135521557-135521579 TCTCCTCGTCTGAGGCCAGGAGG - Exonic
1062250270 9:135590393-135590415 TCTACTCCTCCGTGACCCGGAGG - Intergenic
1062695845 9:137876027-137876049 TCTCCACTTCTGTCCCCAGTAGG + Intergenic
1062730442 9:138105465-138105487 TCTACTTTTCTGCAGCCAGGAGG + Intronic
1186869603 X:13757354-13757376 TCTCCTCTACTGTGCACAGAAGG - Intronic
1186932778 X:14412965-14412987 TCTCCTCTTCTCTCCTCAGGTGG - Intergenic
1187934516 X:24322598-24322620 TCTACTGGTCTCTTCCCAGGTGG - Intergenic
1192104908 X:68306074-68306096 TCCACTCTTCAGTCCCCAGCTGG + Intronic
1193562919 X:83041810-83041832 TCTATTCTTCTATGGCCAGGTGG + Intergenic
1194057276 X:89151313-89151335 TGTGCTGCTCTGTGCCCAGGTGG + Intergenic
1195200571 X:102546849-102546871 TCTCCTCTTCTTCGCCCTGGTGG + Intergenic
1195227663 X:102814923-102814945 TCTTCTCTTGTGTGTCCAGTAGG + Intergenic
1198478632 X:137019797-137019819 TCTACTCTTCAGTGCTCATCAGG - Intergenic