ID: 1183929978

View in Genome Browser
Species Human (GRCh38)
Location 22:41230326-41230348
Sequence TCAGTCTCCAAGCCAAAGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183929978_1183929986 24 Left 1183929978 22:41230326-41230348 CCTGACTTTGGCTTGGAGACTGA 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1183929986 22:41230373-41230395 GTGCTGTGAAGGCTGGACGGTGG 0: 1
1: 0
2: 1
3: 13
4: 209
1183929978_1183929982 17 Left 1183929978 22:41230326-41230348 CCTGACTTTGGCTTGGAGACTGA 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1183929982 22:41230366-41230388 CTGCCCGGTGCTGTGAAGGCTGG 0: 1
1: 0
2: 0
3: 14
4: 196
1183929978_1183929981 13 Left 1183929978 22:41230326-41230348 CCTGACTTTGGCTTGGAGACTGA 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1183929981 22:41230362-41230384 AATTCTGCCCGGTGCTGTGAAGG 0: 1
1: 0
2: 0
3: 7
4: 127
1183929978_1183929985 21 Left 1183929978 22:41230326-41230348 CCTGACTTTGGCTTGGAGACTGA 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1183929985 22:41230370-41230392 CCGGTGCTGTGAAGGCTGGACGG 0: 1
1: 0
2: 0
3: 29
4: 216
1183929978_1183929980 2 Left 1183929978 22:41230326-41230348 CCTGACTTTGGCTTGGAGACTGA 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1183929980 22:41230351-41230373 CTCTCTGTGTAAATTCTGCCCGG 0: 1
1: 0
2: 1
3: 22
4: 289
1183929978_1183929987 27 Left 1183929978 22:41230326-41230348 CCTGACTTTGGCTTGGAGACTGA 0: 1
1: 0
2: 0
3: 12
4: 182
Right 1183929987 22:41230376-41230398 CTGTGAAGGCTGGACGGTGGAGG 0: 1
1: 1
2: 3
3: 19
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183929978 Original CRISPR TCAGTCTCCAAGCCAAAGTC AGG (reversed) Exonic
901503493 1:9668989-9669011 ACAGTCACCAAGACAAATTCTGG - Intronic
903762838 1:25711304-25711326 TAAGTCTCATGGCCAAAGTCAGG + Intronic
905239079 1:36570940-36570962 GCAGCCTCCAGGCCACAGTCAGG - Intergenic
908104555 1:60828019-60828041 TCAGTGCCAAAGCCAAGGTCAGG + Intergenic
909588248 1:77315728-77315750 TCAGTCTTTATGCCAAAGACTGG + Intronic
915056972 1:153142013-153142035 ACAGTCTCCAACCCAGAGCCAGG - Intergenic
915231211 1:154446587-154446609 TAAGTATCCAAGCGAAAGCCTGG - Intronic
916086497 1:161273904-161273926 TCAATCTCCAATCAAAAGTATGG - Intronic
918189426 1:182158413-182158435 TCAGTGCCAAACCCAAAGTCAGG + Intergenic
920904567 1:210149994-210150016 TTAGTCTCCCAACCAAAATCTGG - Intronic
921250160 1:213290031-213290053 TCAGTCTCCAAGGCTGAGGCAGG + Intergenic
1063953828 10:11247670-11247692 TCAGTCTCTAGGCCAAAAACTGG - Intronic
1064443633 10:15374300-15374322 CCAGTCTCAAAGCCAAAAACAGG + Intergenic
1064566230 10:16641681-16641703 TCAGGCTCCAAGTCACATTCTGG - Intronic
1064617306 10:17173528-17173550 TCAGTCTCCAACCCCAACCCAGG - Intronic
1065554441 10:26901021-26901043 TCAGTATCAAAGCTAAAGACTGG - Intergenic
1066578116 10:36848899-36848921 TCAGTATCAAAGCTAAAGACTGG + Intergenic
1067715944 10:48691252-48691274 TCAGTCTGCCACCCTAAGTCAGG - Intronic
1068309774 10:55262736-55262758 TCATTCTCCAAGCCCATGTGTGG + Intronic
1069618345 10:69820567-69820589 TGAGCCCCCAGGCCAAAGTCTGG - Intronic
1069872363 10:71540920-71540942 CCAGTTTCCACCCCAAAGTCTGG + Intronic
1070685643 10:78478384-78478406 CCAGTCTCCCAGCCTAAGTCTGG - Intergenic
1071369452 10:84936426-84936448 ACAGTCTCCAGGCCCAAATCTGG + Intergenic
1071788108 10:88925720-88925742 TCATTCTGCCAGCCAAAGTCAGG - Intronic
1072162472 10:92781383-92781405 TCATTCTCCAAGCCTAGGTATGG + Intergenic
1073287218 10:102396237-102396259 TCTGTCTCCAAACCAGGGTCTGG + Exonic
1076145489 10:128116314-128116336 TCAGTCACCAAGGGAAAGTTAGG + Intronic
1076461845 10:130653218-130653240 TCTGTCTCCAGGCCACTGTCAGG + Intergenic
1077125445 11:933390-933412 TCAGCTTTCAAGCTAAAGTCAGG - Intronic
1077593447 11:3510983-3511005 TAAGTCCCCAGGCCTAAGTCAGG - Intergenic
1081714335 11:45237879-45237901 TCAGTTTCCATGGCAACGTCTGG + Intergenic
1083410914 11:62491731-62491753 TCAGTCTCCACCCCAAATGCAGG - Intronic
1084249267 11:67883698-67883720 TAAGTCCCCAGGCCTAAGTCAGG - Intergenic
1084277462 11:68061492-68061514 CCAGCTTCCAACCCAAAGTCGGG + Intronic
1084478479 11:69402315-69402337 TAAGTCTCCCAGCAACAGTCTGG + Intergenic
1091177370 11:133573726-133573748 CCAGTTCTCAAGCCAAAGTCAGG + Intergenic
1091400438 12:177712-177734 TCAGTCCCCAGGCCAAGGTTGGG + Exonic
1091870982 12:3891101-3891123 TCAATCACCAAGAAAAAGTCAGG + Intergenic
1095184626 12:39187126-39187148 TCATTCTCCAAGCCCAGGTGTGG + Intergenic
1096480090 12:51934321-51934343 TCAGTTTCCATGGCAAAATCAGG - Intergenic
1097655656 12:62359212-62359234 ACAGTTTGAAAGCCAAAGTCTGG + Intronic
1101758225 12:107638296-107638318 TCAGTCTGGAAGGCAAATTCTGG + Intronic
1102613719 12:114134644-114134666 TCAGTCCCAAAGCCAAAGGCTGG + Intergenic
1104203771 12:126617050-126617072 TCAATCTTCTAGCCAAAGTTTGG - Intergenic
1110132261 13:72022568-72022590 CCTGTATCCATGCCAAAGTCAGG - Intergenic
1114667017 14:24384042-24384064 CCACTCTCCAAGCCTATGTCAGG - Intergenic
1117068880 14:52038539-52038561 ACAGTGTCCCTGCCAAAGTCAGG - Intronic
1117140944 14:52791100-52791122 TCATTTCCCACGCCAAAGTCTGG + Intronic
1117342562 14:54804714-54804736 TCAGTCTCCCATTCAAAGGCTGG + Intergenic
1118836132 14:69479312-69479334 TCAGTGTTAGAGCCAAAGTCAGG + Intergenic
1120871075 14:89338036-89338058 TCATTCTTCAAGCCTAAGACAGG - Intronic
1126223836 15:46246238-46246260 TCTCTCTCCAAGCCAAGTTCTGG + Intergenic
1129059906 15:72852559-72852581 TCTTTTTCCAAGACAAAGTCTGG + Intergenic
1131457575 15:92595210-92595232 GGAGTCTCCAAACCAAAGCCTGG - Intergenic
1134845713 16:17438257-17438279 TCAGCCACCAAACCAAAGTTAGG - Intronic
1139213364 16:65102818-65102840 TGAGTCTCCACCCCAAAGTTGGG - Intronic
1139303988 16:65967831-65967853 TCAGCCTACAAGTCAAGGTCAGG - Intergenic
1144317922 17:14081585-14081607 TCAGTCAGCTAGCCAAAGCCAGG - Intronic
1145092896 17:20000493-20000515 CCAGGCTCCGAGCCAAAGCCAGG - Intergenic
1146165488 17:30585039-30585061 CCAGGCTCCGAGCCAAAGCCAGG - Intergenic
1147962445 17:44176406-44176428 TCTGTCTCCACCCCAAGGTCTGG - Intronic
1148074684 17:44928501-44928523 TCAGTCGCCTCGCCATAGTCCGG + Exonic
1149361650 17:55901693-55901715 TCTGTTTCCCAGCCAGAGTCAGG + Intergenic
1154069652 18:11141806-11141828 TCATTCTGCAACCCAAACTCAGG - Intronic
1154409196 18:14127335-14127357 TATGTCTTCAACCCAAAGTCTGG + Intronic
1155232958 18:23792652-23792674 TGGGTTTCCAAGCCAAAATCTGG - Intronic
1156636881 18:39042419-39042441 TCAGTCACAAAGCCAAATTTTGG + Intergenic
1157549524 18:48571729-48571751 ACAGTGTCCAAGCAAAAGACTGG - Intronic
1159070519 18:63618328-63618350 TCAATTTCAAAGCCAAAATCAGG - Intergenic
1160948592 19:1654872-1654894 TCAGGGTCCAAGCCATAGTGTGG + Intergenic
1162117484 19:8439787-8439809 TCAGTCTTCAAGTAAAAATCAGG + Intronic
1163001318 19:14369632-14369654 TCAATCTCCTTGCCAATGTCAGG + Intergenic
1163947326 19:20550948-20550970 TCAAACTCCCAGCCACAGTCTGG + Intronic
1164004193 19:21133910-21133932 TCAGTCTCCACCCCAAGCTCTGG - Intergenic
1165128695 19:33619081-33619103 TCAGCCTCCAGCCCAAAGACGGG + Intergenic
1165750948 19:38259358-38259380 TCAGTCTAAAGGCCAAACTCTGG + Intronic
1168700745 19:58437984-58438006 TGAGTCCCCAAGCCAAGGTGGGG - Intronic
925971068 2:9107033-9107055 TCCGTCTCCCTGCCAAAGGCAGG + Intergenic
926825511 2:16901861-16901883 TCATTCTCCAAGCCCATGTGTGG + Intergenic
929050195 2:37829880-37829902 TCAGACTCCAAAGCAAACTCAGG - Intergenic
929229303 2:39542691-39542713 TCAGCCTCCAGGGCAAAGGCAGG + Intergenic
929286223 2:40138280-40138302 TCAGACTCAAACCAAAAGTCAGG + Intronic
929379325 2:41331778-41331800 ACTGTCTCAAAGTCAAAGTCAGG - Intergenic
932191098 2:69742066-69742088 TCAGTCTCCACCCCACAGTGGGG + Exonic
935548545 2:104426956-104426978 TCAGTTGCCAAGCCAAAATATGG + Intergenic
936713001 2:115154694-115154716 TCAGTCTCCTTGCCTAAGTAGGG - Intronic
947106197 2:226670241-226670263 TCAGACTCCCACCCACAGTCAGG + Intergenic
1170372498 20:15664817-15664839 TCAGGGTCAAACCCAAAGTCAGG + Intronic
1173614341 20:44393109-44393131 TCACTCCCCAAACCAGAGTCTGG + Intronic
1173742804 20:45413462-45413484 TCAGTCTCCAAGCTACAGCGTGG + Intergenic
1174690252 20:52497012-52497034 TCTGTCTCGAAGCAGAAGTCTGG + Intergenic
1175145411 20:56892537-56892559 GCCGTCTCCAAGTCAGAGTCAGG + Intergenic
1176864024 21:14032554-14032576 TATGTCTTCAACCCAAAGTCTGG - Intergenic
1176933431 21:14841344-14841366 TCATTCTCCAAGCCCACGTGTGG - Intergenic
1179213486 21:39347877-39347899 ACAGTTTCCAAGCCAACTTCGGG - Intronic
1181040617 22:20190860-20190882 TCATTCTCCAAGCCCACGTGTGG + Intergenic
1181390149 22:22574374-22574396 ACAGTCTCCAAGCCACATTTAGG - Intergenic
1181519288 22:23436178-23436200 TCGGGCTCCAGGCCAAAGTTGGG + Intergenic
1182017369 22:27052136-27052158 TCTGTCTCCAGGCCAGACTCAGG - Intergenic
1183929978 22:41230326-41230348 TCAGTCTCCAAGCCAAAGTCAGG - Exonic
949386292 3:3506008-3506030 TCAGCCTCCAAGCCAATAACTGG - Intergenic
949617510 3:5770253-5770275 TCATTCTCCAAGCCCACGTGTGG - Intergenic
950172765 3:10851026-10851048 GCAGTGTCCAGGCCAAAGGCCGG - Intronic
951844512 3:27071250-27071272 TCAGTCATCAAGCCAGAGTGTGG - Intergenic
953192150 3:40698103-40698125 CCAGTTTCTAAGCCAAAATCGGG - Intergenic
954601946 3:51877012-51877034 TCAGTCTCCATCTCAAAGTCTGG - Intergenic
955605745 3:60701416-60701438 TCAGTCTCCCCCCCAAACTCAGG + Intronic
961289854 3:125837689-125837711 TAAGTCCCCAGGCCTAAGTCAGG + Intergenic
961897252 3:130178318-130178340 TAAGTCCCCAGGCCTAAGTCAGG - Intergenic
962399519 3:135046032-135046054 TCAGTCTGGAAGCAAAAGTGAGG + Intronic
962933113 3:140055794-140055816 TCAGTCTCCCAGTCCCAGTCTGG + Intronic
967073568 3:185982745-185982767 ACAGTCTCCAGGCCAAAGGAGGG + Intergenic
967134002 3:186497683-186497705 TTAGGCCCCAAGGCAAAGTCAGG - Intergenic
968385023 4:128183-128205 TATGTCTTCAACCCAAAGTCTGG - Intronic
968411052 4:390340-390362 TATGTCTTCAACCCAAAGTCTGG - Intergenic
969007426 4:4031878-4031900 TAAGTCCCCAGGCCTAAGTCAGG - Intergenic
969746188 4:9074180-9074202 TAAGTCCCCAGGCCTAAGTCAGG + Intergenic
969805545 4:9605593-9605615 TAAGTCCCCAGGCCTAAGTCAGG + Intergenic
970836598 4:20416281-20416303 GCCATCTGCAAGCCAAAGTCAGG - Intronic
972045958 4:34664505-34664527 TTGGAGTCCAAGCCAAAGTCTGG + Intergenic
976315551 4:83655365-83655387 CCAGCCTCCAAGCCCAAGTGGGG - Intergenic
976468617 4:85400738-85400760 TCAGTCTCCAATTCTAATTCTGG - Intergenic
981276768 4:142909077-142909099 TAAGTCTCCAAGCAAAAACCTGG + Intergenic
982496667 4:156103195-156103217 TCAGTTTCCAGGGAAAAGTCTGG - Intergenic
982843179 4:160218870-160218892 TCAGTCTCCAAACCAGAGACTGG - Intergenic
984263588 4:177470714-177470736 TCATTCTCCAAGCCCACGTGTGG - Intergenic
986640903 5:9871132-9871154 TCAGTCTCCAGGGCACAATCAGG + Intergenic
986832128 5:11591881-11591903 TCTGTTACCAAGCAAAAGTCAGG - Intronic
988067979 5:26246831-26246853 TAAGTCTCCAAGGCAAATGCAGG + Intergenic
991560635 5:67947812-67947834 TCAGTATCCAGGCCAAATTTTGG + Intergenic
996458943 5:123719123-123719145 CCAGTCTCCAGGCCACAGACTGG + Intergenic
1002329610 5:178432597-178432619 TCAGTCTGCAAGCCCAGCTCTGG - Intronic
1002476985 5:179472607-179472629 TCATTCTCCAAGCCCACGTGTGG - Intergenic
1003200995 6:3960219-3960241 TGAGGCTGAAAGCCAAAGTCAGG - Intergenic
1004458686 6:15815889-15815911 TCAGTTTCCCAGACAAACTCAGG - Intergenic
1004572279 6:16858670-16858692 TCTTTCTCCAAGCAAAATTCGGG + Intergenic
1006109661 6:31736874-31736896 CCAGACTCCAATCCAAATTCTGG + Exonic
1007955691 6:45915913-45915935 TCAGGCTCTAAACCAGAGTCTGG - Intronic
1008374531 6:50777055-50777077 TCAGTCTCTAGGACGAAGTCTGG - Intergenic
1008673076 6:53793692-53793714 TCAGTGGCCAAGGCAAAGTTTGG - Intergenic
1008702106 6:54113665-54113687 TCAGTCTTAATGCCAAAGCCTGG + Intronic
1009694339 6:67080914-67080936 TCACTTTCTAAGGCAAAGTCTGG - Intergenic
1012472840 6:99590329-99590351 CCAGGCTCCATGCCAGAGTCAGG - Intergenic
1012535579 6:100292615-100292637 TCTTTCTCCATGTCAAAGTCAGG + Intergenic
1012550001 6:100457362-100457384 TCAGTCACCAAGTCGTAGTCAGG - Intronic
1012607929 6:101181418-101181440 CCAGACTCCAAGCCCAACTCAGG - Intergenic
1013317514 6:108956693-108956715 CCTGTCTCCAAGAAAAAGTCCGG + Intronic
1019591992 7:1840153-1840175 TCGGGCTCCAGGCCAAAGTTGGG - Intronic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1021716006 7:23462914-23462936 TCAGCCTTCAAGCAAAATTCTGG + Intronic
1023163238 7:37318457-37318479 TCAGTCTCTAAGTCTAAATCTGG - Intronic
1024249510 7:47495655-47495677 GCAGTCTCCCAGCCAGAGCCAGG + Intronic
1024550678 7:50560320-50560342 TCAGTTTCCAAGCGAAATTCAGG - Intronic
1025888486 7:65622000-65622022 TCAGTCTCCAGGAGAAAGACAGG + Intergenic
1026071762 7:67128061-67128083 TCAGGCCCCAAACCACAGTCAGG - Intronic
1026108544 7:67439978-67440000 TCTGTCTCCAAGCCATGCTCTGG + Intergenic
1026513720 7:71049212-71049234 TCAGGGTTCAAGGCAAAGTCTGG - Intergenic
1027992183 7:85376708-85376730 TCAATCTCCTCGCCAAAGGCTGG + Intergenic
1031853957 7:126899962-126899984 TCAGTCTCCAGGAGAAAGACAGG - Intronic
1034591668 7:152145485-152145507 TCAGTTTCAAAGCCAAACTTAGG + Intronic
1036137230 8:6173539-6173561 TCAGACACCAAGCCAAATTGAGG + Intergenic
1036368691 8:8144097-8144119 TAAGTCCCCAAGCCTAAGTCAGG + Intergenic
1036882198 8:12521545-12521567 TAAGTCCCCAAGCCTAAGTCAGG - Intergenic
1039763470 8:40602976-40602998 TCTTTGTCCAAGCCAATGTCTGG + Intronic
1040009906 8:42652851-42652873 CCAGTCTCCATGCCACAGCCTGG - Intergenic
1040111853 8:43570214-43570236 GCAGTCCCCAAGCCAAAACCTGG - Intergenic
1040420951 8:47240142-47240164 TCAGCATCCAAGTCAATGTCAGG + Intergenic
1045031688 8:98143104-98143126 TCAGTCTTCAAGTCACATTCTGG + Intronic
1046724888 8:117663558-117663580 GCATTCACCAAGCCACAGTCTGG + Intergenic
1046830953 8:118745352-118745374 TCAGTGTTCCAGCCAAGGTCTGG + Intergenic
1047138662 8:122109800-122109822 TCAGTCTCCAAGCTGGATTCAGG - Intergenic
1048431526 8:134375794-134375816 TAAATCTCCAAGTCAGAGTCTGG + Intergenic
1049953953 9:674182-674204 TCTGTTTCCAAGAGAAAGTCAGG + Intronic
1050372746 9:4938681-4938703 TGAGTCTCCAAGTCAGAGTCTGG - Intergenic
1052044469 9:23778279-23778301 TCAACCTCCAGGCCAAAGTTCGG + Intronic
1052823561 9:33158945-33158967 TGAGTCTTCACACCAAAGTCAGG - Intronic
1056072626 9:83004912-83004934 TCAGTCACTAAGCCAAATTATGG - Intronic
1057587761 9:96345000-96345022 TCAATCACCAAGGCAAGGTCAGG - Intronic
1059371898 9:113847786-113847808 TCAATCCCCAAACCAAAGTTTGG - Intergenic
1059599547 9:115761703-115761725 TCAGGCTCCAAGCCCAAGGGAGG - Intergenic
1060548628 9:124475071-124475093 TGAGGCTCCAAGGCCAAGTCAGG - Intronic
1060597133 9:124855408-124855430 TCAATCCCCAAGTCAAAGTAGGG - Intronic
1061521455 9:131120669-131120691 AAAGTCTCCAAGCCAAGTTCAGG + Exonic
1061542043 9:131282823-131282845 ACAGTCTCCCAGCCCAGGTCCGG + Intergenic
1186431727 X:9510807-9510829 ACAGTCTCAAATCCAAAGGCAGG - Intronic
1186955085 X:14673017-14673039 TCAGTCCACAAGCCAGAGTCTGG + Intronic
1187237711 X:17483983-17484005 TGAGTCTCCCAGCCAATGTTAGG + Intronic
1187432896 X:19240904-19240926 TCAGTCTACAATCCAAAGGCAGG + Intergenic
1188029581 X:25249369-25249391 GTATTCTCAAAGCCAAAGTCAGG - Intergenic
1188142203 X:26565510-26565532 TCAGGCTCTAAGTCAAATTCAGG + Intergenic
1190952412 X:55159920-55159942 TAAGTCTCTAAGCAAATGTCTGG - Intronic
1197667038 X:129235263-129235285 TCAGGCTGCAAGCAAAAGTTGGG - Intergenic
1199859862 X:151791708-151791730 CCAATCTCCAAGGCAAAGTCAGG - Intergenic
1200003946 X:153075391-153075413 TCAGGCTGGAAGCCAAGGTCAGG + Intergenic
1200812701 Y:7501954-7501976 TCAGTCTCCACCCCAAGCTCTGG + Intergenic