ID: 1183931103

View in Genome Browser
Species Human (GRCh38)
Location 22:41236723-41236745
Sequence TCTCTTCTGCTGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 313}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183931103_1183931107 -3 Left 1183931103 22:41236723-41236745 CCATCTTCCCTCAGCAGAAGAGA 0: 1
1: 0
2: 0
3: 30
4: 313
Right 1183931107 22:41236743-41236765 AGAAGCTGGAGAGCCCAAGCTGG 0: 1
1: 1
2: 1
3: 25
4: 311
1183931103_1183931112 21 Left 1183931103 22:41236723-41236745 CCATCTTCCCTCAGCAGAAGAGA 0: 1
1: 0
2: 0
3: 30
4: 313
Right 1183931112 22:41236767-41236789 CCAGCCAGGAAGTGCAGCGCTGG 0: 1
1: 0
2: 2
3: 27
4: 301
1183931103_1183931113 22 Left 1183931103 22:41236723-41236745 CCATCTTCCCTCAGCAGAAGAGA 0: 1
1: 0
2: 0
3: 30
4: 313
Right 1183931113 22:41236768-41236790 CAGCCAGGAAGTGCAGCGCTGGG 0: 1
1: 0
2: 3
3: 42
4: 290
1183931103_1183931108 7 Left 1183931103 22:41236723-41236745 CCATCTTCCCTCAGCAGAAGAGA 0: 1
1: 0
2: 0
3: 30
4: 313
Right 1183931108 22:41236753-41236775 GAGCCCAAGCTGGTCCAGCCAGG 0: 1
1: 0
2: 1
3: 18
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183931103 Original CRISPR TCTCTTCTGCTGAGGGAAGA TGG (reversed) Intronic
900892350 1:5458565-5458587 TGTCTTCTGCGGAGGAAGGAAGG - Intergenic
901705784 1:11071955-11071977 TCCCTTCTGCTGAGGGATGGTGG - Intronic
903130754 1:21278155-21278177 TCTATTCTTCTGATGGCAGATGG - Intronic
904546586 1:31278786-31278808 TGTCTTCGGCAGAGGGATGATGG + Intronic
905324068 1:37138000-37138022 GCTCTTCTGCTGAAGAAGGAAGG - Intergenic
905380162 1:37556267-37556289 CCTCTTCTGGGGAGGGATGAAGG - Intergenic
905881235 1:41465370-41465392 TCTAGTCTGCTGATGGAAGTTGG - Intergenic
908006288 1:59732601-59732623 TACCTTCTGCTGAGAGAAAAGGG + Intronic
909238115 1:73178880-73178902 TCTCATCTGCTGAAGGAATGTGG + Intergenic
909460713 1:75909901-75909923 TCTCTTCCTCTGAGATAAGATGG - Intronic
912593482 1:110850958-110850980 TCTCTTCTGCTGAGGAGATAAGG + Intergenic
912697753 1:111854429-111854451 TCTCCTCTGCTGTGGCTAGAGGG + Intronic
913574371 1:120155804-120155826 CCTTTTCTGCTCAGGGATGATGG - Exonic
914295641 1:146320611-146320633 CCTTTTCTGCTCAGGGATGATGG - Intergenic
914326365 1:146620877-146620899 CCTCTTCTGCCAAGAGAAGACGG - Intergenic
914375694 1:147071891-147071913 ACTCTTCATCTGAGGGAAGCAGG + Intergenic
914556681 1:148771392-148771414 CCTTTTCTGCTCAGGGATGATGG - Intergenic
914616153 1:149358838-149358860 CCTTTTCTGCTCAGGGATGATGG + Intergenic
915172995 1:153991129-153991151 CCTCTTCTGGAGAGGGATGAAGG - Exonic
917317595 1:173741695-173741717 CCTCTTCTGGAGAGGGATGAAGG - Intronic
917678517 1:177342414-177342436 TTTCTTTTTCTGAAGGAAGACGG - Intergenic
917830500 1:178879419-178879441 TTTCTTCTCCTGAGACAAGATGG - Intronic
919370318 1:196716368-196716390 TCTATCCTGCTGAGGCTAGATGG + Intronic
919961287 1:202472075-202472097 CCTCTTCTGGAGAGGGATGAAGG + Intronic
920079336 1:203360952-203360974 TCCCTCCTGTTGAGGCAAGATGG - Intergenic
922413986 1:225403744-225403766 TCTTCTTTGCTGGGGGAAGAAGG - Intronic
924043484 1:240006299-240006321 TTTCTTCTGCTGAATGCAGATGG + Intergenic
924224795 1:241912636-241912658 TCCCTTCTGGTGAGGGATGTTGG + Intergenic
924812804 1:247417963-247417985 TCTGTTTTTGTGAGGGAAGAGGG - Intronic
1064797649 10:19031401-19031423 TCACTTCTGCTGGAGGACGAAGG + Intergenic
1065177181 10:23089703-23089725 TATCTTCTTCATAGGGAAGAGGG + Intergenic
1065295547 10:24270956-24270978 TTTATTCTGCTGAGGGGAAATGG + Intronic
1066337030 10:34488528-34488550 TCTCTTTTACTGGGGGAAGTGGG + Intronic
1067074418 10:43166386-43166408 TTGCGTCTCCTGAGGGAAGATGG + Intronic
1069490798 10:68858806-68858828 TCTCTCCTACTGATGGAAGAGGG - Intronic
1070352934 10:75610962-75610984 ACTATTCTGCTGAGGGGAGGTGG + Intronic
1070592096 10:77808629-77808651 TCTGTTCTGATGAGAGAGGATGG - Intronic
1071335089 10:84593953-84593975 GGGCTTCTGCTGATGGAAGAGGG + Intergenic
1072308543 10:94131851-94131873 GCTCTTCTGCAGAGAGATGAAGG - Intronic
1072418403 10:95268821-95268843 TCTCCTCTGGTGACGGAGGAAGG - Exonic
1072715354 10:97748453-97748475 GCTCTTCCCCTGAGGTAAGAGGG - Intronic
1073069095 10:100782090-100782112 TCTCTTCTGATGCGTGAAGCTGG + Intronic
1073175670 10:101555476-101555498 TCTCTCCTGCTGATGGAAATGGG + Exonic
1073448361 10:103594378-103594400 TCTCTGCTGAGGAGGAAAGAAGG + Exonic
1073695815 10:105866066-105866088 TGTATTCTGCAGAGGGCAGATGG - Intergenic
1073784744 10:106876887-106876909 TCTCTTCTGATAACTGAAGAGGG + Intronic
1074261047 10:111853557-111853579 GCACTTCTGGTCAGGGAAGAAGG - Intergenic
1074270449 10:111948548-111948570 ATACTTATGCTGAGGGAAGAAGG + Intergenic
1075712244 10:124536875-124536897 CCTCTGCTGCTGAGAGATGAAGG + Intronic
1075885660 10:125896799-125896821 TCTCTCCTGGAGAGGGGAGAAGG + Intronic
1076070062 10:127482173-127482195 TCGCTTCAGCTGAGTGCAGATGG + Intergenic
1076315913 10:129541388-129541410 GCTCTGCAGCTGCGGGAAGATGG - Intronic
1076465949 10:130681752-130681774 TCTCTGCTCCTGGGGGAACAGGG - Intergenic
1078760582 11:14248206-14248228 TCCTTTCTGCTGAGTGATGAGGG + Intronic
1079310013 11:19356791-19356813 TCATTTCTGCTGATTGAAGAAGG - Intronic
1079364609 11:19798447-19798469 TCTCCTCTGCTGTGGGAAAATGG + Intronic
1079395689 11:20061201-20061223 TGCCTTCTTCTGTGGGAAGAAGG - Intronic
1080294872 11:30715111-30715133 TCACTTCTGCTAAGTTAAGAGGG - Intergenic
1082140862 11:48607476-48607498 TCTATTTTGATGATGGAAGAGGG + Intergenic
1084280385 11:68086533-68086555 TCTCTAATACTGAGGGAAGTAGG + Intronic
1085339138 11:75719975-75719997 TCTCGGCTGGGGAGGGAAGAAGG - Exonic
1085466332 11:76726100-76726122 TCCCTTCTGCTGTAGGAAGATGG + Intergenic
1086183071 11:83979201-83979223 TCTCTAAAGCTGAGGGAAGTAGG + Intronic
1086419997 11:86629402-86629424 TCTCTTTTGCTGAAGAAAGGAGG + Intronic
1086931609 11:92699710-92699732 TATCATCTGCAGAGGGAAGTAGG + Intronic
1088186790 11:107179265-107179287 TCTGTTATGGTGAGGGAGGAAGG - Intergenic
1089671670 11:120061484-120061506 TCTCTTGAGCTGGGGGAAGGAGG + Intergenic
1090727074 11:129537889-129537911 TGTCTTCTGGAGAGGGATGAAGG - Intergenic
1091780547 12:3211875-3211897 CCTCTTCTGGAGAGGGATGAAGG + Intronic
1092960849 12:13595634-13595656 CCTCTGATGCTGAGGCAAGAAGG - Intronic
1093283235 12:17222908-17222930 TCTCTTCTCATGAGAGAAGGAGG + Intergenic
1094406928 12:30126135-30126157 TCTCTTCAGATGGGGGAATATGG + Intergenic
1094648189 12:32347970-32347992 TCTCTCTTACTGTGGGAAGAAGG - Intronic
1094821041 12:34225087-34225109 TTTCTTGTGCTGAAGAAAGAAGG + Intergenic
1095485383 12:42679082-42679104 CCTCTTCTGGGGAGGGATGAAGG + Intergenic
1100467715 12:94862005-94862027 TCCCTTCTGCTGAAGGCAGGAGG + Intergenic
1100545061 12:95593720-95593742 TCTCTGCTTCTGAGGCAAGCTGG + Intergenic
1100886023 12:99071037-99071059 TCTCTTCTGTTCAGGGAATCAGG - Intronic
1101104273 12:101424461-101424483 TCTCTCCTGAAGAGGGATGAAGG - Intergenic
1101777478 12:107807399-107807421 GCTCTTCTTCAGAGGGATGATGG + Intergenic
1102753287 12:115315052-115315074 TCTATTGGGCTGAGAGAAGAGGG - Intergenic
1103151982 12:118648720-118648742 TCTCTTCAGCTGAAGCAAGAAGG + Intergenic
1103261072 12:119589516-119589538 TATGCTCTGCTCAGGGAAGATGG - Intergenic
1103364514 12:120371408-120371430 TCTCTTCTGGAGAAGGATGAAGG - Intergenic
1103807632 12:123585383-123585405 TCTCTTCTGCCAAGGAGAGATGG + Intronic
1104523187 12:129494666-129494688 TCTCTTTTTTTGAGGGGAGATGG - Intronic
1106204896 13:27583639-27583661 TTTCTACTGCTGAGGGATCAGGG + Intronic
1106328254 13:28715417-28715439 CCTCTTGGACTGAGGGAAGACGG - Intronic
1106765059 13:32905414-32905436 TGTCTTCTTCTGAGAGAAGAAGG + Intergenic
1109554681 13:63956289-63956311 TCACTTTTTCTGAGGGAAGTAGG + Intergenic
1111337760 13:86845718-86845740 TATGTTATGCTGAGGGAACATGG + Intergenic
1111919943 13:94399821-94399843 TCTCTTCTGAAGAGGAAAGGAGG - Intronic
1111957667 13:94776119-94776141 TAGATGCTGCTGAGGGAAGAAGG + Intergenic
1111980785 13:95013211-95013233 TCTCCTCTCATGATGGAAGAAGG + Intergenic
1113159063 13:107358650-107358672 ACTCTTCTGATGATGGCAGAAGG - Intronic
1113818003 13:113188726-113188748 TCTCTACTCCTGAGGGGTGAGGG - Intronic
1114715300 14:24818045-24818067 CCACTTCTGCTGAGGAAACAAGG - Intronic
1115067306 14:29279569-29279591 TATCTTCTACTTAGGGAACATGG - Intergenic
1118970283 14:70630840-70630862 TCTCTTGTTCTGGGGGAAGCTGG + Intergenic
1119158147 14:72430457-72430479 TCTCTTCTGCAGACAGAGGAGGG + Intronic
1120031730 14:79649336-79649358 GCTCTTCTCCTGATGGAAGAGGG + Intronic
1120189077 14:81423628-81423650 TCTGTTTTGTTGGGGGAAGAGGG - Intronic
1121156934 14:91694498-91694520 TCTCTTATGCTTAGTGAATAGGG - Intronic
1121546586 14:94767906-94767928 TCCCCTCTGCCGAGGGCAGAAGG - Intergenic
1121854277 14:97252279-97252301 TCTCTTCTGCTCATGGAACTTGG + Intergenic
1122255170 14:100471136-100471158 TCTCTGCTGCTGAGGGTGGTTGG + Intronic
1123904828 15:24911083-24911105 CCTCTTCTGGAGAGGGATGAAGG + Intronic
1125325903 15:38535594-38535616 GTGCTTCTGCTGTGGGAAGAGGG - Intronic
1125735069 15:41919138-41919160 TCTCCTCTCCAGAGGCAAGATGG - Intronic
1126230825 15:46321921-46321943 TCTCATCAGCTGAGAGGAGAAGG + Intergenic
1126411840 15:48380329-48380351 TCTCTGCTGCCGTGTGAAGAAGG - Intergenic
1126885523 15:53145212-53145234 TCTGGTCTGCTTAGGGAACAGGG + Intergenic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128977567 15:72164733-72164755 TTTCTTCAGCTGAGTCAAGAGGG - Intronic
1129329204 15:74818225-74818247 TCTCTTCTGCCAAGGGAGCAGGG + Intronic
1129807332 15:78474343-78474365 TCTTTTCTAATTAGGGAAGAAGG - Intronic
1130821669 15:87502584-87502606 TCTTTTCTGGTGAAGTAAGAGGG - Intergenic
1131222621 15:90597812-90597834 TCTCATTTGCTGAGGGAAACAGG + Intronic
1131641475 15:94298639-94298661 CCTCTCCTGCTGAGCGGAGACGG + Exonic
1131645492 15:94337550-94337572 TCTCTTCTGCTGTAGGAGGGAGG + Intronic
1132461322 16:56560-56582 TCTCTCCTGCAGAGGTCAGATGG - Exonic
1133078188 16:3295690-3295712 TCTCTTCTGGTAAGAGAATAAGG + Intronic
1133581915 16:7152799-7152821 TCTCTTCTAGGGAGGGAAAATGG - Intronic
1135310977 16:21404354-21404376 TATCATCTGCTGAGGGTGGAAGG + Intronic
1135447911 16:22534546-22534568 TATCATCTGCTGAGGGTGGAAGG - Exonic
1135729511 16:24882533-24882555 TCCCTTCTCCTCAGGGAAGGAGG + Intronic
1138315773 16:56068793-56068815 TATCTTCTGTGGAGGGAAAAAGG + Intergenic
1140007200 16:71090072-71090094 CCTCTTCTGCCAAGAGAAGACGG + Intronic
1140736660 16:77904106-77904128 TCTCTTTTGATGGGGGAATATGG - Intronic
1141339771 16:83192326-83192348 TCACTTCTGCAGAGAGCAGAGGG + Intronic
1141703135 16:85651479-85651501 TGTCCTCGGCTGAGGGGAGAAGG + Intronic
1145258747 17:21342373-21342395 TCTCTTCTGATGTGGCCAGAGGG + Intergenic
1145319659 17:21757270-21757292 TTTCTTCCCCTTAGGGAAGAGGG - Intergenic
1147595624 17:41715415-41715437 TCTCGTCTGCAAAGGGGAGAAGG - Exonic
1147865448 17:43549002-43549024 TCTCTTAGCCTGAGGGAGGAAGG - Intronic
1149692669 17:58591045-58591067 TTTGTACTTCTGAGGGAAGAGGG + Intronic
1149995744 17:61405188-61405210 TCTCCTCAGCTGCGGGGAGAGGG - Exonic
1150265139 17:63827472-63827494 TCTCTGCTGAAGAGAGAAGATGG + Exonic
1151541543 17:74767356-74767378 TCCCTTCTGCCCAGGGAAGGGGG - Intronic
1151803960 17:76393993-76394015 TCAGCTCTGCTGAGGGAAGATGG - Intronic
1152331333 17:79675024-79675046 TGTCTGCTGCTCAGGGAAGCAGG - Intergenic
1152818739 17:82424794-82424816 TTTCTTCTGTTGATGGGAGAAGG + Intronic
1153837428 18:8976591-8976613 GCTCTGATGCTGTGGGAAGAGGG - Intergenic
1153975195 18:10263052-10263074 TCCTCACTGCTGAGGGAAGAGGG - Intergenic
1157287465 18:46386826-46386848 TCCTGTCTGCTGTGGGAAGAAGG - Intronic
1158035901 18:53029993-53030015 CCTCTTCTGCTCTGAGAAGACGG - Intronic
1158551479 18:58439749-58439771 TCTCTGATGATCAGGGAAGAGGG + Intergenic
1159222609 18:65484388-65484410 TCTCTTCTGTGGTGGGAAGCAGG + Intergenic
1162785436 19:13031902-13031924 CCTTTTCTGCCTAGGGAAGAAGG + Intronic
1163862196 19:19748340-19748362 TCCCTTCTGATGAGAGCAGAAGG - Intergenic
1164264217 19:23597361-23597383 TCTCTTCTGGAGAGGGATGAAGG - Intronic
1165450340 19:35878745-35878767 TTCCTTGTCCTGAGGGAAGAGGG + Intronic
1166252986 19:41584333-41584355 TGTCATCTGCTGAAAGAAGAAGG - Exonic
1166283192 19:41808796-41808818 TTTCTTCTGCAGAAAGAAGAAGG - Exonic
1168539461 19:57198293-57198315 TGTCTTCTGCTCAGGCCAGATGG + Intronic
926024066 2:9524504-9524526 TTTCGACTGCAGAGGGAAGAAGG + Intronic
927133231 2:20078562-20078584 TTAATTCTACTGAGGGAAGAAGG + Intergenic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
928427201 2:31189161-31189183 TCTCTGCTGCTGAGACAAAAGGG - Intronic
930725090 2:54674614-54674636 TCTGCTCTTCTGAGGAAAGAAGG + Intergenic
933152871 2:78935745-78935767 TCTCTTCTTCTGAAGTAATAGGG + Intergenic
933980900 2:87549920-87549942 GCTCTTCTACTGAGAGAACAAGG + Intergenic
934844492 2:97653923-97653945 TCTCCCTTGGTGAGGGAAGATGG - Intergenic
936312930 2:111400865-111400887 GCTCTTCTACTGAGAGAACAAGG - Intergenic
937081882 2:119146162-119146184 TCTCCTCTACTGAGGGGAGATGG + Intergenic
937402608 2:121597943-121597965 TCTCACCTGATGAGGGAAGAAGG + Intronic
937476582 2:122220496-122220518 TATCATCTGCTGAAGGAGGAGGG - Intergenic
938097843 2:128475105-128475127 TCCCCTCTGCTGGGAGAAGATGG - Intergenic
938587533 2:132706339-132706361 TCAGTTCTGCTGATGGAAGGAGG + Intronic
939726297 2:145725513-145725535 TCTCTTCTGGTGAGGCAGGGTGG + Intergenic
942681439 2:178480918-178480940 GCTCGTGTGATGAGGGAAGAGGG + Intronic
942695755 2:178642736-178642758 TCTTCTCCACTGAGGGAAGAAGG + Intronic
943094340 2:183410544-183410566 TCTCTTCTTCTGAGGACTGAGGG + Intergenic
943801659 2:192067320-192067342 TGTCTTCTCCTGGAGGAAGAGGG + Intronic
944561270 2:200940902-200940924 TTTCTTTTGCAGGGGGAAGAGGG - Intronic
945178469 2:207067213-207067235 GCTCAGCTGCTGAGGGGAGAAGG - Intergenic
945372563 2:209037467-209037489 TTTCTTCTGAAGAGGAAAGAGGG + Intergenic
945843378 2:214914661-214914683 TCAGCTCTGATGAGGGAAGAAGG + Intergenic
945891227 2:215433453-215433475 TCTCTTCAGCTGAGGGGAAAAGG + Exonic
946240767 2:218354113-218354135 TGTCCTCTGCTGTGGCAAGAAGG + Intergenic
946372285 2:219288119-219288141 TCACTCCTGCTCAGGGCAGATGG + Intergenic
947694380 2:232171605-232171627 TCCCTCCAGCTAAGGGAAGAAGG - Intronic
947787212 2:232834016-232834038 TCTCTGGAGCTGAGGGAGGAAGG + Intronic
948182063 2:235989860-235989882 TCTCTTCTCCTGTGGGCAAAAGG - Intronic
1169695005 20:8377396-8377418 GCTTTTCTTCTGATGGAAGAGGG + Intronic
1170278318 20:14617978-14618000 TCTCTTCTTTTGCGGAAAGAAGG + Intronic
1171221524 20:23402331-23402353 TCTCTTTCGCTGAAGGGAGAGGG + Intronic
1172557050 20:35851538-35851560 TTTCTTCTATTGGGGGAAGAGGG + Intronic
1173756288 20:45519303-45519325 TCTCTTTTGTAGAAGGAAGAAGG + Intergenic
1175296820 20:57914202-57914224 TCACCTCTGCAGAGGGATGATGG - Intergenic
1175686298 20:61031101-61031123 GCCCTGCTGCTGAGGGGAGAGGG - Intergenic
1175687310 20:61040952-61040974 TATCTTCTGCAGAGGGGAGGGGG - Intergenic
1176851778 21:13923786-13923808 TCCCTACGGCTGAGGGAGGAAGG + Intergenic
1179061180 21:37981220-37981242 TCTCTTGTGCTGTGGGAAGTAGG + Intronic
1179813002 21:43884293-43884315 TCTCTCCTGCTGAGGGCATTTGG + Intronic
1179954233 21:44729375-44729397 TCTCTTCAGGAGAGGGATGACGG - Intergenic
1181628940 22:24140372-24140394 TCCCCTCTGCTCAGGGAGGACGG - Intronic
1182756409 22:32683219-32683241 TTTCTTCTGCGGAGGGGAGCGGG + Intronic
1182876062 22:33691897-33691919 TCTTTTCTCCTAAGTGAAGAGGG + Intronic
1183931103 22:41236723-41236745 TCTCTTCTGCTGAGGGAAGATGG - Intronic
1184337476 22:43862277-43862299 GCCCTTCTGCCGCGGGAAGATGG - Exonic
1184352779 22:43955506-43955528 CGTCTGCTGCTGAGGGCAGAAGG - Exonic
949492143 3:4599499-4599521 TTTCTTCTTTTGAGGGGAGAAGG + Intronic
950490121 3:13299542-13299564 TCCCTACTGCTGAGGGATGTTGG + Intergenic
951136563 3:19109766-19109788 TCTTTTCTGCTTAGTGAAAAAGG - Intergenic
951638665 3:24809275-24809297 TCTCTGCTGCTGAGGCTAGTAGG + Intergenic
951753024 3:26057976-26057998 TTTCTTCTGCCAAAGGAAGAAGG - Intergenic
952519360 3:34140508-34140530 TCTTTCCTGCTGTGTGAAGAAGG + Intergenic
953199068 3:40761565-40761587 CCTCTTCTGGAGAGGGATGAAGG - Intergenic
953855378 3:46495740-46495762 TCTCAACTAGTGAGGGAAGAAGG - Intergenic
954272439 3:49520345-49520367 TGTCCTCTGCTCAGGGAAGCAGG - Intronic
954370852 3:50168924-50168946 TCTCTTCAGCTCAGGGATTAGGG + Intronic
954942859 3:54391072-54391094 TCTTTTCTGTTTTGGGAAGACGG - Intronic
956118600 3:65943195-65943217 TTTCTTTTGCTGGGAGAAGATGG + Intronic
956672104 3:71700750-71700772 TCTCCCCTGCTAAAGGAAGAGGG + Intronic
957733078 3:84168017-84168039 TCACTTCTGCTGGAGGGAGAAGG + Intergenic
959417212 3:106090005-106090027 TCTCATAGCCTGAGGGAAGAAGG - Intergenic
960208268 3:114929426-114929448 AGTATTCTGCTGTGGGAAGAAGG + Intronic
960636669 3:119791468-119791490 TGTCTTCTTCTGATGGAGGAAGG + Intronic
960735363 3:120773323-120773345 TCTCTTGTACTGAGGCAGGATGG - Intronic
961042902 3:123689786-123689808 TGTCTTCTGCTGAGTTCAGAAGG + Intronic
961308329 3:125975468-125975490 CCCCTTCTTCTGAGGGAAGGAGG - Intronic
961369009 3:126418441-126418463 TCTTTTCTGCTGGAAGAAGAGGG - Exonic
962986680 3:140542730-140542752 TGTATTTTGCTGAGAGAAGATGG + Intronic
963141922 3:141953354-141953376 TCTTTTGTGCTGAGGGCAGAAGG - Intronic
963541675 3:146598773-146598795 TCCTTTCTGCAGATGGAAGATGG + Intronic
965184308 3:165443875-165443897 TCTTTCCTGCTGAGGTCAGATGG + Intergenic
965771463 3:172186156-172186178 TTTGTTCTACTGATGGAAGAAGG - Intronic
966304737 3:178518613-178518635 TCACTTTTGCAGAGTGAAGATGG - Intronic
967693847 3:192508027-192508049 TCTCTTTTTTTGAGGGGAGAGGG - Intronic
968494925 4:910281-910303 TCTGTACTGCTGAGGGCTGAGGG - Intronic
969037566 4:4267062-4267084 TCTCTTTGGCTGAAGGTAGATGG + Intergenic
969514172 4:7637353-7637375 TCTCCTCTGCTGAAGGTAGTGGG + Intronic
970133547 4:12897035-12897057 TCTCTTCCCCAGAGGGAAGAGGG + Intergenic
971384678 4:26132327-26132349 TGTCTGATGCTGGGGGAAGAGGG - Intergenic
972218396 4:36923307-36923329 TCTCTTTAGCTGAGGAAGGAGGG - Intergenic
973384388 4:49495486-49495508 TCCCTACGGCTGAGGGAGGAAGG + Intergenic
973616074 4:52679210-52679232 CCTCGTCAGATGAGGGAAGACGG + Intergenic
974372247 4:61032595-61032617 TCTGCAGTGCTGAGGGAAGAAGG - Intergenic
975900834 4:79150102-79150124 TCTCTTCTAGTAAGGGGAGATGG - Intergenic
976115531 4:81722284-81722306 TCTCTTGTACTAAGGGCAGAAGG - Intronic
976767955 4:88618116-88618138 TCCCTTCAGATGAGGGAAGAAGG + Intronic
978109064 4:104940183-104940205 TCTCATTTGCTGTGGGAAGGTGG - Intergenic
978500606 4:109405532-109405554 TCGCTGCTTCGGAGGGAAGAGGG + Intergenic
979441051 4:120749849-120749871 GGTCTGCTGCTGCGGGAAGAGGG + Intronic
979936029 4:126697388-126697410 TTTCTTTTCCTGGGGGAAGAAGG - Intergenic
981241959 4:142488323-142488345 TCTCTTTTGATGAGGGATAATGG + Intronic
981555391 4:145988001-145988023 ACTCTTCTGGGGAGGGAGGAAGG - Intergenic
982305689 4:153928365-153928387 GCTCTTCTGCTGGGGGGAGAGGG + Intergenic
982932559 4:161428019-161428041 TGGCTGCTGCTGAGGGATGAGGG - Intronic
984426589 4:179595819-179595841 TCTCTTCTGCAGAGGCCAGGCGG + Intergenic
985578722 5:685601-685623 TCTCTTCTTCTGAGGGCGGAGGG - Intronic
986678526 5:10211846-10211868 TCTCTTCTGCCCTGTGAAGAAGG + Intergenic
987076749 5:14389936-14389958 TGCCTTCTGCTGAGGGGTGAGGG - Intronic
989346287 5:40433465-40433487 TCTCTTCCCCTAAAGGAAGAAGG + Intergenic
991079042 5:62575575-62575597 TCTATTCTGCTGGGGGAGGTGGG - Intronic
996930330 5:128878815-128878837 ACTCTTCATCTGAGGGATGAAGG - Intronic
997099647 5:130955156-130955178 TATCTCCTGATGAGGGAAGAGGG - Intergenic
997195565 5:131977022-131977044 CCTCTGCTCCTGAAGGAAGACGG - Intronic
997419120 5:133751971-133751993 TCTCTGCTGCTAATGGAAGCTGG + Intergenic
997639371 5:135438575-135438597 TGTCTTGGGCTGGGGGAAGAGGG + Intergenic
997897609 5:137733956-137733978 TTTCCTCTGCTGAAGGCAGATGG - Intronic
998639836 5:143997021-143997043 CCTCCTTTGCTCAGGGAAGATGG - Intergenic
1001631688 5:173180034-173180056 GGTCTTCTGCTGAGAGCAGAGGG + Intergenic
1002215079 5:177625606-177625628 TCTTCTTTGCTGAGGGCAGAAGG - Intergenic
1002619144 5:180474691-180474713 TTGCTGCTGCTGAGGGCAGATGG - Intergenic
1002782000 6:374122-374144 CTCCTTCTGCTGAGGGATGAGGG + Intergenic
1003017406 6:2479032-2479054 TGGCTTCTGCTGAGGGAAGTAGG + Intergenic
1007473733 6:42106174-42106196 TCTCTGCTGCTGAGGAGAGCCGG + Exonic
1007479394 6:42140272-42140294 GCACCTCTGGTGAGGGAAGAGGG - Intronic
1008501355 6:52186218-52186240 TCTCTCCTTCTGAAGGAAAATGG - Intergenic
1008904086 6:56657237-56657259 TGTCTCCTGCTGAGGGCATAAGG - Intronic
1010241321 6:73618363-73618385 CCTCTTCTGGAGAGGGATGAAGG - Intronic
1011088925 6:83572937-83572959 TCTATTTTGCTGTGGGAAGGAGG - Intronic
1011089075 6:83574798-83574820 TCTGTTTTGCTGCGGGAAGTGGG - Intronic
1012814443 6:104004324-104004346 TCTTTTCTTCTTTGGGAAGAGGG + Intergenic
1015742820 6:136475782-136475804 TCTCTTCTCCATTGGGAAGATGG - Intronic
1016581046 6:145629615-145629637 TCTGTTCTGCTGAGGGTATGAGG + Intronic
1016795089 6:148109298-148109320 TCTCTTCTGATAAGTGAAAATGG + Intergenic
1017187106 6:151612734-151612756 TCTTTTCTTCTTAGGAAAGAAGG + Intronic
1017383923 6:153861248-153861270 GGTCTGCTGCTGAGGGAAGTGGG - Intergenic
1018669182 6:166165947-166165969 TCTCTGCTGTTGAGGGAAGTGGG + Intronic
1019102856 6:169646221-169646243 CCTCTTCTGTTAAGGGAGGATGG - Intronic
1019196414 6:170285774-170285796 TCACTGGTGCTGCGGGAAGATGG - Intronic
1019389709 7:779202-779224 TCGCGTCTGCAGCGGGAAGATGG + Intronic
1019778115 7:2924360-2924382 TGTCATCTGCAGAGGGACGAGGG + Exonic
1022456695 7:30564245-30564267 CCTCTTCTGCAGAGAGAAGGTGG - Intergenic
1022633594 7:32109786-32109808 TCTTTTCTTTAGAGGGAAGAGGG + Intronic
1024118656 7:46215937-46215959 TCTCTGCTGCTGGGTGAAGCAGG - Intergenic
1026432853 7:70365202-70365224 TCTCTTCTGAAGAGTAAAGAGGG - Intronic
1028561509 7:92180743-92180765 TACCTTATGCTGAGTGAAGAAGG - Intergenic
1028692563 7:93670035-93670057 TCTCTTCTGGAGAGGGATGAAGG + Intronic
1028730598 7:94143708-94143730 AATCTTCTGCTGAAGGAAAATGG - Intergenic
1028867407 7:95729789-95729811 TTTCTTCTGCTGAGGGACCTTGG - Intergenic
1029507205 7:100969574-100969596 TCCCTCCTGATGAGAGAAGATGG + Intergenic
1030228456 7:107179308-107179330 TCTTTTCTGCTGAGGAAAAATGG - Intronic
1030314799 7:108103657-108103679 TCTCTGCTGCTGTGGAAAGAGGG - Intronic
1030648639 7:112092798-112092820 TTTCATCTTCTTAGGGAAGAAGG - Intronic
1031492902 7:122411119-122411141 TCTGATCTGCTGATGGTAGATGG - Intronic
1031532368 7:122890286-122890308 TCTCTTATGCTAAGGAAAGATGG + Intergenic
1032077171 7:128841435-128841457 TCACCTGTGCGGAGGGAAGAAGG - Exonic
1032667622 7:134052447-134052469 CCTCTTCTTCTGAGTCAAGAGGG + Intronic
1033190647 7:139275655-139275677 TCTTTTCTGTTGATAGAAGATGG - Intronic
1033788889 7:144767878-144767900 TATCTCCTGCTGAGAAAAGAGGG + Intronic
1034753998 7:153597297-153597319 TCTCTTCTGGTGACGGAACGTGG - Intergenic
1036803596 8:11811461-11811483 TCACTTCTGCTGAGGGGATAGGG - Intronic
1037542080 8:19881641-19881663 TCTCTTGTATTGTGGGAAGAGGG - Intergenic
1037579554 8:20236475-20236497 TCTGGGCTGGTGAGGGAAGAGGG - Intergenic
1038516223 8:28189835-28189857 TCTCTGCAGCTGCGGGATGAGGG - Exonic
1038605963 8:29004754-29004776 TTTCTTCTGCAGTGGGAAGTAGG + Intronic
1038795685 8:30707312-30707334 TCTCTTCTGCAGAGAGAGGGTGG - Intronic
1041347880 8:56920429-56920451 TCACTTATGCTGAGAGAAGACGG + Intergenic
1042823058 8:72952763-72952785 TTTCTAGGGCTGAGGGAAGAGGG - Intergenic
1043308102 8:78822545-78822567 TTTCTGCTGCTGTGTGAAGAAGG + Intergenic
1045382752 8:101643605-101643627 TCTCATCTGCTGCGGCCAGAGGG + Intronic
1045644147 8:104283853-104283875 TCTCTTCTGCATAGAGAAGGGGG - Intergenic
1048643629 8:136392596-136392618 TCTCATCTGTTAAGTGAAGAAGG + Intergenic
1048791934 8:138112355-138112377 TGCCTTATGCTGAGGGAGGAGGG - Intergenic
1048821533 8:138384870-138384892 CCTCTGCTGCTGAGTGAAGAAGG - Intronic
1049025197 8:139983667-139983689 TTTCTTCTGCTGGGTGAAGCTGG + Intronic
1053071492 9:35104706-35104728 TTCCCTCAGCTGAGGGAAGAGGG - Exonic
1053512695 9:38702289-38702311 TCTTCTCTGCTTATGGAAGAAGG + Intergenic
1054928806 9:70615367-70615389 TTTGTTCTGCAGAGGGAAGGGGG - Intronic
1055145667 9:72931693-72931715 CCTCTTGTGCAGAGGGAACAGGG + Intronic
1056251672 9:84754788-84754810 TCTCTTTTGCTGGAGGCAGATGG + Intronic
1056459509 9:86795884-86795906 TCTCATCTGGTGAAGAAAGATGG + Intergenic
1056665245 9:88576568-88576590 TCTGCTCTCCTGAGGGGAGAAGG + Intronic
1058704482 9:107627390-107627412 ATTCTTCTGCTGAAGGAAGCTGG - Intergenic
1058777859 9:108302913-108302935 TCACTTCTGCTGAAGGAGGCAGG + Intergenic
1058786078 9:108389249-108389271 TCTTTTCTGCTTATGGAGGATGG - Intergenic
1059357093 9:113708359-113708381 TCCCATATGCTGAGGGAAAAAGG - Intergenic
1059501452 9:114757323-114757345 TCTCAGCTGCTTAGGGCAGAGGG - Intergenic
1062243729 9:135552842-135552864 CCTCTTCTGCTGATGGACGCAGG + Intergenic
1189372921 X:40444293-40444315 TCTCCTTTTCTGAGGGAACAGGG - Intergenic
1189404863 X:40712290-40712312 TTTCTTCTGCCAACGGAAGATGG - Exonic
1191076893 X:56463775-56463797 CTTATTCTGCTGAGGGAATAGGG + Intergenic
1192203145 X:69079699-69079721 CCTCTTCAGTTGAGGGAAGGGGG + Intergenic
1192505851 X:71682439-71682461 TGTCTTCTGCTGCTGTAAGATGG + Intergenic
1193878252 X:86890050-86890072 TCTCTTCTGAAGAGGTAATAGGG + Intergenic
1194666282 X:96681081-96681103 TCTCTGATGCTGAAGAAAGAAGG - Intergenic
1196579874 X:117366412-117366434 TCTCTTCTCTTGGGGGAAGAAGG - Intergenic
1198761270 X:140035088-140035110 TCTGTTATGCTGACAGAAGAGGG + Intergenic
1198862661 X:141087819-141087841 CCACTGCTGCTGAGGGATGAGGG - Intergenic
1198900033 X:141499567-141499589 CCACTGCTGCTGAGGGATGAGGG + Intergenic