ID: 1183932641

View in Genome Browser
Species Human (GRCh38)
Location 22:41245145-41245167
Sequence CGTAGGTGACCAGGTGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183932641_1183932650 26 Left 1183932641 22:41245145-41245167 CCTCTGCCACCTGGTCACCTACG No data
Right 1183932650 22:41245194-41245216 GCCCTCTAAGAAACCTTGGAGGG No data
1183932641_1183932648 22 Left 1183932641 22:41245145-41245167 CCTCTGCCACCTGGTCACCTACG No data
Right 1183932648 22:41245190-41245212 TATTGCCCTCTAAGAAACCTTGG No data
1183932641_1183932649 25 Left 1183932641 22:41245145-41245167 CCTCTGCCACCTGGTCACCTACG No data
Right 1183932649 22:41245193-41245215 TGCCCTCTAAGAAACCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183932641 Original CRISPR CGTAGGTGACCAGGTGGCAG AGG (reversed) Intergenic
No off target data available for this crispr