ID: 1183932645

View in Genome Browser
Species Human (GRCh38)
Location 22:41245162-41245184
Sequence TCATTGGCAGTCGGCCACGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183932645_1183932649 8 Left 1183932645 22:41245162-41245184 CCTACGTGGCCGACTGCCAATGA No data
Right 1183932649 22:41245193-41245215 TGCCCTCTAAGAAACCTTGGAGG No data
1183932645_1183932648 5 Left 1183932645 22:41245162-41245184 CCTACGTGGCCGACTGCCAATGA No data
Right 1183932648 22:41245190-41245212 TATTGCCCTCTAAGAAACCTTGG No data
1183932645_1183932653 18 Left 1183932645 22:41245162-41245184 CCTACGTGGCCGACTGCCAATGA No data
Right 1183932653 22:41245203-41245225 GAAACCTTGGAGGGACTTCTTGG No data
1183932645_1183932650 9 Left 1183932645 22:41245162-41245184 CCTACGTGGCCGACTGCCAATGA No data
Right 1183932650 22:41245194-41245216 GCCCTCTAAGAAACCTTGGAGGG No data
1183932645_1183932654 21 Left 1183932645 22:41245162-41245184 CCTACGTGGCCGACTGCCAATGA No data
Right 1183932654 22:41245206-41245228 ACCTTGGAGGGACTTCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183932645 Original CRISPR TCATTGGCAGTCGGCCACGT AGG (reversed) Intergenic
No off target data available for this crispr