ID: 1183932646

View in Genome Browser
Species Human (GRCh38)
Location 22:41245171-41245193
Sequence AATATTTTCTCATTGGCAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183932646_1183932656 22 Left 1183932646 22:41245171-41245193 CCGACTGCCAATGAGAAAATATT No data
Right 1183932656 22:41245216-41245238 GACTTCTTGGAGGCCGTTTGTGG No data
1183932646_1183932657 23 Left 1183932646 22:41245171-41245193 CCGACTGCCAATGAGAAAATATT No data
Right 1183932657 22:41245217-41245239 ACTTCTTGGAGGCCGTTTGTGGG No data
1183932646_1183932659 25 Left 1183932646 22:41245171-41245193 CCGACTGCCAATGAGAAAATATT No data
Right 1183932659 22:41245219-41245241 TTCTTGGAGGCCGTTTGTGGGGG No data
1183932646_1183932654 12 Left 1183932646 22:41245171-41245193 CCGACTGCCAATGAGAAAATATT No data
Right 1183932654 22:41245206-41245228 ACCTTGGAGGGACTTCTTGGAGG No data
1183932646_1183932649 -1 Left 1183932646 22:41245171-41245193 CCGACTGCCAATGAGAAAATATT No data
Right 1183932649 22:41245193-41245215 TGCCCTCTAAGAAACCTTGGAGG No data
1183932646_1183932653 9 Left 1183932646 22:41245171-41245193 CCGACTGCCAATGAGAAAATATT No data
Right 1183932653 22:41245203-41245225 GAAACCTTGGAGGGACTTCTTGG No data
1183932646_1183932650 0 Left 1183932646 22:41245171-41245193 CCGACTGCCAATGAGAAAATATT No data
Right 1183932650 22:41245194-41245216 GCCCTCTAAGAAACCTTGGAGGG No data
1183932646_1183932658 24 Left 1183932646 22:41245171-41245193 CCGACTGCCAATGAGAAAATATT No data
Right 1183932658 22:41245218-41245240 CTTCTTGGAGGCCGTTTGTGGGG No data
1183932646_1183932648 -4 Left 1183932646 22:41245171-41245193 CCGACTGCCAATGAGAAAATATT No data
Right 1183932648 22:41245190-41245212 TATTGCCCTCTAAGAAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183932646 Original CRISPR AATATTTTCTCATTGGCAGT CGG (reversed) Intergenic
No off target data available for this crispr