ID: 1183932650

View in Genome Browser
Species Human (GRCh38)
Location 22:41245194-41245216
Sequence GCCCTCTAAGAAACCTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183932641_1183932650 26 Left 1183932641 22:41245145-41245167 CCTCTGCCACCTGGTCACCTACG No data
Right 1183932650 22:41245194-41245216 GCCCTCTAAGAAACCTTGGAGGG No data
1183932646_1183932650 0 Left 1183932646 22:41245171-41245193 CCGACTGCCAATGAGAAAATATT No data
Right 1183932650 22:41245194-41245216 GCCCTCTAAGAAACCTTGGAGGG No data
1183932645_1183932650 9 Left 1183932645 22:41245162-41245184 CCTACGTGGCCGACTGCCAATGA No data
Right 1183932650 22:41245194-41245216 GCCCTCTAAGAAACCTTGGAGGG No data
1183932647_1183932650 -7 Left 1183932647 22:41245178-41245200 CCAATGAGAAAATATTGCCCTCT No data
Right 1183932650 22:41245194-41245216 GCCCTCTAAGAAACCTTGGAGGG No data
1183932643_1183932650 20 Left 1183932643 22:41245151-41245173 CCACCTGGTCACCTACGTGGCCG No data
Right 1183932650 22:41245194-41245216 GCCCTCTAAGAAACCTTGGAGGG No data
1183932644_1183932650 17 Left 1183932644 22:41245154-41245176 CCTGGTCACCTACGTGGCCGACT No data
Right 1183932650 22:41245194-41245216 GCCCTCTAAGAAACCTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183932650 Original CRISPR GCCCTCTAAGAAACCTTGGA GGG Intergenic
No off target data available for this crispr