ID: 1183932653

View in Genome Browser
Species Human (GRCh38)
Location 22:41245203-41245225
Sequence GAAACCTTGGAGGGACTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183932647_1183932653 2 Left 1183932647 22:41245178-41245200 CCAATGAGAAAATATTGCCCTCT No data
Right 1183932653 22:41245203-41245225 GAAACCTTGGAGGGACTTCTTGG No data
1183932644_1183932653 26 Left 1183932644 22:41245154-41245176 CCTGGTCACCTACGTGGCCGACT No data
Right 1183932653 22:41245203-41245225 GAAACCTTGGAGGGACTTCTTGG No data
1183932645_1183932653 18 Left 1183932645 22:41245162-41245184 CCTACGTGGCCGACTGCCAATGA No data
Right 1183932653 22:41245203-41245225 GAAACCTTGGAGGGACTTCTTGG No data
1183932643_1183932653 29 Left 1183932643 22:41245151-41245173 CCACCTGGTCACCTACGTGGCCG No data
Right 1183932653 22:41245203-41245225 GAAACCTTGGAGGGACTTCTTGG No data
1183932646_1183932653 9 Left 1183932646 22:41245171-41245193 CCGACTGCCAATGAGAAAATATT No data
Right 1183932653 22:41245203-41245225 GAAACCTTGGAGGGACTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183932653 Original CRISPR GAAACCTTGGAGGGACTTCT TGG Intergenic
No off target data available for this crispr