ID: 1183933910

View in Genome Browser
Species Human (GRCh38)
Location 22:41250947-41250969
Sequence CCTGGGGCCCACGAGCATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183933902_1183933910 23 Left 1183933902 22:41250901-41250923 CCATGAGAGCGCTGGGGCTGACG 0: 1
1: 0
2: 2
3: 12
4: 96
Right 1183933910 22:41250947-41250969 CCTGGGGCCCACGAGCATCAAGG 0: 1
1: 0
2: 2
3: 12
4: 135
1183933901_1183933910 24 Left 1183933901 22:41250900-41250922 CCCATGAGAGCGCTGGGGCTGAC 0: 1
1: 0
2: 1
3: 10
4: 92
Right 1183933910 22:41250947-41250969 CCTGGGGCCCACGAGCATCAAGG 0: 1
1: 0
2: 2
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183933910 Original CRISPR CCTGGGGCCCACGAGCATCA AGG Intronic
900338665 1:2177392-2177414 TATGGGGCCCACCAGCACCATGG + Intronic
902035326 1:13453852-13453874 CCTGTGGCCCACGGGCCACATGG + Intergenic
902301474 1:15505618-15505640 CCTGAGTCCCACCAGCAGCAAGG + Intronic
902720861 1:18303074-18303096 CCTGGGGCCCCCAACCACCAAGG + Intronic
903170978 1:21553453-21553475 CCTGTGTCCCAGGAACATCAGGG - Intronic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916786468 1:168090597-168090619 CCTGGGGCACAGCAGCAGCACGG - Exonic
918108797 1:181437744-181437766 CCTGGGGCACACCTACATCAGGG - Intronic
919474417 1:198017026-198017048 CCTGAGGACCAGGAGCACCAAGG + Intergenic
919601121 1:199623814-199623836 CCTGGGGGCCAAGAGAAACATGG - Intergenic
921196142 1:212759908-212759930 CCTGGGGCCACCCAGCAGCAAGG + Intronic
921318762 1:213917260-213917282 CATGGGGCTCAAGAACATCATGG - Intergenic
924194739 1:241594271-241594293 CCTGAGGCCCAAGAGCATATGGG + Exonic
1063031625 10:2240842-2240864 CCTGGGAACCTCGAGCATCAGGG - Intergenic
1065130562 10:22615900-22615922 CCTGGGGCCCCAGGGCATCCTGG + Intronic
1067081572 10:43215473-43215495 CCTGAGGCCCACCAGGATCATGG - Intronic
1070542580 10:77427139-77427161 CCTGGTGCACATCAGCATCATGG + Intronic
1078931325 11:15913967-15913989 CCTGGGGAGCACGAGCAGCAAGG - Intergenic
1080816981 11:35767899-35767921 CTTGGGGCCAAGGACCATCAGGG - Intronic
1081871968 11:46387100-46387122 CCAGAGGCCCACGAGCATGTGGG + Intergenic
1084971254 11:72773334-72773356 CCAGGGGCCCCAGGGCATCAAGG - Intronic
1084971462 11:72774499-72774521 CCAGGGGCCCCAGGGCATCAAGG + Intronic
1086349937 11:85935137-85935159 CATGGGGCACACGATCACCACGG - Intergenic
1096196844 12:49654081-49654103 GCAGGGTCCCAGGAGCATCAAGG + Intronic
1105302691 13:19150361-19150383 CCCAGGGCACAGGAGCATCAAGG + Intergenic
1106100832 13:26694345-26694367 CCTGGTGCCCAGGGGCATCTCGG - Intergenic
1107434239 13:40367672-40367694 CCTAGGGCATAGGAGCATCAGGG + Intergenic
1112466218 13:99647076-99647098 CCTCAGGCCCATGAGCACCATGG - Intronic
1118445145 14:65843793-65843815 CCTGGACCCCAGGAGCATCGTGG - Intergenic
1119882453 14:78111584-78111606 GCTGGGTCCCACTTGCATCAGGG + Intergenic
1121033811 14:90682605-90682627 TTTGGGGCCCACGAGCCTCAGGG + Intronic
1122397353 14:101442634-101442656 CCTGTGGCCCAGGCGCACCAAGG + Intergenic
1122767240 14:104081113-104081135 CCTGAGGCCCCCCAGCCTCAGGG + Intergenic
1122770116 14:104094050-104094072 CCTGGGGCCTGGGAGCATCTGGG + Intronic
1123105365 14:105838961-105838983 CCTGGGGCCCTGGAGCATGGTGG + Intergenic
1123689329 15:22823795-22823817 CCATGGGCCCACCAACATCATGG + Exonic
1124368840 15:29091866-29091888 CCTGAGTCCCTCCAGCATCACGG - Intronic
1124454433 15:29827408-29827430 CCTGGGGCCCTAGAGGATTAGGG - Intronic
1125757323 15:42072392-42072414 CCTGGGGCCAGAGGGCATCAGGG + Exonic
1129330385 15:74824118-74824140 CCTGGGGCCTGGGATCATCAAGG - Intronic
1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG + Intronic
1130467620 15:84200306-84200328 GCTGGGGCACAAGAGCACCAGGG - Intergenic
1130496645 15:84473236-84473258 GCTGGGGCACAAGAGCACCAGGG + Intergenic
1130564170 15:84980736-84980758 CCTGGGGCCCATGAGGACCCCGG - Intronic
1130589912 15:85204904-85204926 GCTGGGGCACAAGAGCACCAGGG - Intergenic
1132761551 16:1510927-1510949 CCTGGGGCCCAGGCCCCTCAGGG + Exonic
1132818194 16:1845820-1845842 CCTGGGGTCCAAGGGCATCATGG - Intronic
1133039034 16:3050151-3050173 CCTGGGGCCCACCCGCACCCTGG + Intronic
1134031417 16:10995411-10995433 CCAGGGGCCCAGGAGCATGTTGG + Intronic
1134043514 16:11085196-11085218 CCTGGGTTCCAGGAGGATCACGG + Intronic
1136393894 16:29982621-29982643 TCTGGGGCCCACGCCCACCACGG - Intronic
1137553657 16:49456718-49456740 CCTGGGGCCAAGAAGCCTCAAGG + Intergenic
1139552516 16:67682809-67682831 ACTGAGGCCCAGGAGCATTAAGG - Intronic
1139916221 16:70430088-70430110 CCGAGGGCCCAGGAGCATCAGGG - Intronic
1141505027 16:84471349-84471371 CCTGGGGCTCAGCAGCACCAGGG + Intergenic
1142033289 16:87848973-87848995 CCTGGGGGCCAAGGGCAGCAAGG + Intronic
1142619220 17:1154331-1154353 CCCGGGGCCCACGGGCAGCCCGG + Intronic
1144608370 17:16687577-16687599 CCTGCTGCCCACGAACATTACGG + Intergenic
1144790474 17:17855637-17855659 CCTGAGTCCCAGGAGCATAAGGG + Intronic
1145118321 17:20232404-20232426 CCTGGTGCCCACCAGACTCACGG - Exonic
1145196473 17:20898689-20898711 CCTGCTGCCCACGAACATTACGG - Intergenic
1146968610 17:37054213-37054235 CCTGGGGCCCAGGAGCAGCATGG - Intronic
1147165696 17:38592072-38592094 CCTGGGGCCCTCTGGCAGCAGGG - Intronic
1148790017 17:50167706-50167728 CCTGGAGCCCACGATCTTCTGGG - Exonic
1149607624 17:57936053-57936075 CCTGGAGCCAAGCAGCATCAGGG + Intronic
1150622890 17:66821801-66821823 CCTGGGGCCCTGGAGGATCCAGG - Intergenic
1151348928 17:73520163-73520185 CCTAGGGCCCACGGCCATCCTGG + Intronic
1151399048 17:73843683-73843705 CCTGTGGGCCACGGGCCTCAGGG + Intergenic
1160246229 18:77162443-77162465 CCTCAGGCCCACAGGCATCATGG - Intergenic
1160831962 19:1108401-1108423 CCTGCGGCCCTCGCGCACCAGGG - Exonic
1160860953 19:1237070-1237092 CCTGGGGCCGCCGAGCACCCCGG - Intronic
1161152588 19:2717441-2717463 CTTGTTGCCCACGAGCATCACGG + Exonic
1161288567 19:3480739-3480761 CCTGGGGACCATCAGCCTCAGGG + Intergenic
1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG + Exonic
1163375948 19:16930671-16930693 TCTGTGGCCCACGAGGATCTAGG - Intronic
1163468517 19:17483677-17483699 CCTGGGGCCCATGAGCCTCATGG + Intronic
1163520356 19:17788137-17788159 CCTGGGGCCCAGTGGCAACAGGG + Intronic
1164624554 19:29717516-29717538 CCTTGGGCCCATGAGGCTCATGG - Intergenic
1165825173 19:38701647-38701669 CGTGGGGCCCAGGAGGATCCTGG - Intronic
925731782 2:6924291-6924313 CCTCGGGCCCCCCAGCAACACGG - Intronic
927211698 2:20642703-20642725 CCCAGGGCCCACGTCCATCAGGG + Intronic
932593381 2:73080129-73080151 CCTGGGCCTCAGGAGCCTCAGGG + Intronic
934975088 2:98796461-98796483 CCTGGCACACACGTGCATCATGG + Intronic
935285723 2:101562243-101562265 CGTGAGGCCGACGAGCATGAGGG - Intergenic
939161251 2:138592440-138592462 CCTGAGAACCAGGAGCATCAGGG + Intergenic
948232057 2:236356004-236356026 ACTGGGGCACAAGAGCATCGAGG + Intronic
948861726 2:240755830-240755852 CCTGGGGCCCAGGAGGTGCAGGG + Intronic
949007459 2:241657911-241657933 CCTGGGACACACCAGCCTCAGGG + Intronic
1168750328 20:277430-277452 CCTGGGGCCCAGGTGCTTGAGGG - Intronic
1168970860 20:1929884-1929906 CAAGGGGCCCAGGAGCCTCAGGG - Intronic
1176264187 20:64200131-64200153 CATGTGGCGCACCAGCATCATGG + Intronic
1180875571 22:19173719-19173741 CCTTGGGGCCACGAGCATGGAGG - Intergenic
1180876557 22:19177739-19177761 CATGGGGCACACGACCACCACGG + Exonic
1181984854 22:26793106-26793128 CCTGGGCCCCACATCCATCATGG - Intergenic
1183933910 22:41250947-41250969 CCTGGGGCCCACGAGCATCAAGG + Intronic
1183972854 22:41491301-41491323 CCAGGGGCCCATGAGCAGAAGGG + Intronic
1184755144 22:46511669-46511691 CCTGGGGGCAGCGGGCATCACGG + Intronic
1185319099 22:50192337-50192359 CCGGGGGCCCAGGAGCCTGAGGG - Intronic
953904396 3:46861214-46861236 CCAGGGTCCACCGAGCATCAGGG - Intronic
960479512 3:118171427-118171449 GCGGTGGCCCACGAGCACCATGG - Intergenic
963129267 3:141843166-141843188 CCTGGGGCACAGGAGAATAAAGG - Intergenic
963351140 3:144152509-144152531 CCTGTGGCTCAGCAGCATCAGGG - Intergenic
966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG + Intergenic
969533612 4:7742345-7742367 CCCGGGGCCCACGGGCAACATGG + Exonic
969633268 4:8350865-8350887 CCTGGGCTCCACGAGCTTCCAGG + Intergenic
973757255 4:54087562-54087584 CCTGGGACACAGGAGCATCAGGG - Intronic
977976268 4:103270295-103270317 CCTGAGAACCAAGAGCATCAAGG + Intergenic
984939402 4:184918224-184918246 CCTGGAGGCCACGATCCTCAGGG - Intergenic
985693203 5:1325010-1325032 CCTGGGTCCCACAAGCCTGATGG + Intronic
988830971 5:34987016-34987038 CCTGGGGCACACCAGCATTTGGG + Intergenic
989339139 5:40354538-40354560 CCTGGGTGCCATGGGCATCATGG + Intergenic
989610798 5:43288919-43288941 CCTGGGGATCACTAGCAACATGG + Intergenic
997336711 5:133113815-133113837 CCAGGGAGCCAGGAGCATCATGG - Intergenic
997654967 5:135547801-135547823 CCTGACGCCCACCAGCAGCAGGG - Intergenic
997781841 5:136667315-136667337 CCTGGGGCCCAGTGGCATCGGGG + Intergenic
1003236132 6:4296570-4296592 CCTGGGGCCCACGAGCCTTGAGG + Intergenic
1003667863 6:8128358-8128380 GCTGGGACCCAAGAGCAGCATGG + Intergenic
1005723764 6:28628932-28628954 CCTGAGAACCAGGAGCATCAAGG + Intergenic
1013164191 6:107575043-107575065 CCTGGGGCGCACGAGCAGTGTGG + Intronic
1017613308 6:156214130-156214152 CTTGGGGCCCATGAAGATCAAGG + Intergenic
1022728216 7:32999432-32999454 CCTGAGGCCCATGGCCATCAAGG + Intronic
1023074359 7:36468199-36468221 CCAGGGGACCACTACCATCAAGG - Intergenic
1023371508 7:39516585-39516607 CCTGGCTCCCACGGGCATAAAGG + Intergenic
1025045436 7:55688588-55688610 CCTGAGGCCCATGGCCATCAAGG - Intergenic
1025197718 7:56945453-56945475 CCTGGGGCCAACCACCCTCATGG + Intergenic
1026900848 7:74036666-74036688 CCTGGGAGACCCGAGCATCAAGG + Intronic
1029705887 7:102275379-102275401 CTTGGGCCCAAGGAGCATCAGGG - Intronic
1029732379 7:102446878-102446900 CCTGGTGTCCACCATCATCATGG + Exonic
1030162637 7:106524725-106524747 CCCGGAGCTCACTAGCATCACGG + Intergenic
1030289714 7:107859869-107859891 CCTGCTGCCAACAAGCATCAAGG - Intergenic
1032060310 7:128718536-128718558 TCTAGGGCACACGAGAATCATGG + Intronic
1032906470 7:136373213-136373235 CCTGGGGCCCAGGAGAATGTTGG + Intergenic
1042407912 8:68426401-68426423 CCTTGGGCCCCCGAGCATTTGGG - Intronic
1049516488 8:143060679-143060701 CCTGGGGACCACTACCACCAAGG - Intergenic
1049859749 8:144890360-144890382 CCTGGGGACTCCGAGGATCACGG + Exonic
1055904418 9:81276178-81276200 CCTGATGTCCACAAGCATCAGGG - Intergenic
1056688522 9:88786277-88786299 CCTGAGACTCACCAGCATCAGGG - Intergenic
1057023180 9:91716627-91716649 CCTGGGGCTGACAAGCATGAGGG + Intronic
1057154489 9:92829233-92829255 CTTAGGGCCCACGAGTGTCAAGG - Intergenic
1058991002 9:110255700-110255722 CCTGGGGCCCTCGGGCCTCCTGG + Intronic
1059418776 9:114178323-114178345 CCCGAGGCCCACGTGCACCAGGG - Exonic
1060822948 9:126671971-126671993 GCTGGGGCTCGGGAGCATCAAGG - Intronic
1061916895 9:133760066-133760088 CCAGGGGGCCAGGAGCAGCAGGG + Intergenic
1062030015 9:134358037-134358059 CCTCGGGCCAGCGAGCAGCAGGG - Intronic
1062516491 9:136939552-136939574 CCTGCGGCCCACGTGGCTCAGGG + Intronic
1192172750 X:68867197-68867219 CCTGTGGGCCTCGAGCAGCATGG + Intergenic
1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG + Intronic
1192522764 X:71816120-71816142 CCTGTGGCCCACTAGCATTGTGG - Intergenic
1193724852 X:85026315-85026337 CCAGGGGCCCAGGAGAATAAAGG - Intronic
1196389969 X:115196558-115196580 CCAGGGGCACATGAGCACCAAGG + Intronic