ID: 1183935747

View in Genome Browser
Species Human (GRCh38)
Location 22:41261191-41261213
Sequence GCCTGAAGCCCCATAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183935736_1183935747 27 Left 1183935736 22:41261141-41261163 CCACTTCTGAGCCTGGCAGATGA 0: 1
1: 0
2: 2
3: 17
4: 222
Right 1183935747 22:41261191-41261213 GCCTGAAGCCCCATAGGGGCTGG 0: 1
1: 0
2: 1
3: 22
4: 206
1183935738_1183935747 16 Left 1183935738 22:41261152-41261174 CCTGGCAGATGACACTCCTTGGT 0: 1
1: 0
2: 2
3: 9
4: 125
Right 1183935747 22:41261191-41261213 GCCTGAAGCCCCATAGGGGCTGG 0: 1
1: 0
2: 1
3: 22
4: 206
1183935740_1183935747 0 Left 1183935740 22:41261168-41261190 CCTTGGTCAGAGTGGCCTGCCTG No data
Right 1183935747 22:41261191-41261213 GCCTGAAGCCCCATAGGGGCTGG 0: 1
1: 0
2: 1
3: 22
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183935747 Original CRISPR GCCTGAAGCCCCATAGGGGC TGG Intronic
900242864 1:1625227-1625249 GGCTGAAGTCCCAGAGGGGAGGG + Intronic
900605793 1:3523034-3523056 GCCTGGATCCCCATGGTGGCCGG + Intronic
902368429 1:15991594-15991616 GACTGAAGCCCCAGTGGGCCCGG + Intergenic
902476551 1:16691569-16691591 GCCTGATTCCCCACAGGGGCAGG + Intergenic
902691456 1:18112337-18112359 GCCTTAAACACCATAGAGGCAGG - Intronic
903341452 1:22657228-22657250 TCCTGAAGCTACCTAGGGGCTGG + Intronic
905995788 1:42380223-42380245 GCCTGAAGCCCCACGGGGGTGGG - Intergenic
906125501 1:43424763-43424785 CTCTGAAGCCCCATAAAGGCCGG - Exonic
907322934 1:53617005-53617027 GCATGAAGCCCCATGGGGTGGGG - Intronic
912492646 1:110070547-110070569 CCCCGAGGCCACATAGGGGCCGG + Exonic
913255135 1:116945944-116945966 GCCTAAAGCTCCACAGGGCCTGG - Intronic
913955127 1:143283133-143283155 GCATGAACCACCATATGGGCTGG - Intergenic
913982310 1:143532307-143532329 GCATGAACCACCATATGGGCTGG + Intergenic
915080202 1:153346655-153346677 GTCTGAAGGCCCATGGGGGATGG + Intronic
915273801 1:154774423-154774445 GACTGAGGCCCCAGAGGGGAAGG - Intronic
916715579 1:167444208-167444230 GACTTAAGCCCCATGAGGGCAGG - Intronic
918098030 1:181350389-181350411 GCTTAAAGCCCCAGAGGAGCAGG - Intergenic
918750365 1:188262553-188262575 GCCCAAAGCTCCATTGGGGCGGG - Intergenic
923554791 1:234992066-234992088 CCCTGAACCTCCATAGGGGCTGG - Intergenic
1063825698 10:9895563-9895585 GCCTCAATCCCCACAGGGACTGG - Intergenic
1065599471 10:27354166-27354188 GACAGAAGCCCCATAGGGATAGG + Intergenic
1066951615 10:42124044-42124066 GCATGAACCACCATATGGGCTGG - Intergenic
1068310122 10:55264866-55264888 GTCTGAGGCCCCATATGTGCAGG + Intronic
1071095367 10:81968195-81968217 GCCTCAAGCCTCCTAGGGCCTGG + Intronic
1073330864 10:102669165-102669187 GGCTGCATCCCCATAGGAGCTGG + Intergenic
1075085950 10:119414466-119414488 CCCTGGAGGCCCATGGGGGCTGG - Intronic
1075520052 10:123137726-123137748 GTCTGAGGCCCCAGAGGGGTGGG + Exonic
1078095246 11:8292535-8292557 GCCAAAACCCCCATTGGGGCAGG - Intergenic
1081145816 11:39561862-39561884 GCCCAAAGCCCCATTGGGGTGGG + Intergenic
1083330022 11:61893121-61893143 GCCTGCAGCCCCCTTGGGCCAGG - Intergenic
1083759886 11:64810096-64810118 GCCTTCAGCCCCATGGCGGCGGG + Exonic
1084155231 11:67309565-67309587 GCTTGAAGCCACAGTGGGGCAGG - Intronic
1086342183 11:85857769-85857791 GCCTGAAACCCCACAGGGCCTGG - Intronic
1087455735 11:98383853-98383875 GCCTGAGGCCCCACATGTGCAGG + Intergenic
1087874921 11:103343485-103343507 GCCCAAAGCCCCATCGGGGGTGG + Intronic
1088813011 11:113404188-113404210 CTCTGAAGCCCCATAGGGCAGGG - Intergenic
1089300921 11:117498129-117498151 GACTGAAGCTCCTTGGGGGCTGG - Intronic
1090234047 11:125133334-125133356 GGCTGCAGCGCCATAGGAGCAGG - Intergenic
1091800384 12:3321229-3321251 GCCTCAGGCCCCCTAAGGGCTGG + Intergenic
1093534748 12:20210036-20210058 GTCTGAGGCCCCATATGCGCAGG + Intergenic
1100050952 12:90447207-90447229 GCCCAAAGCCCCACTGGGGCAGG - Intergenic
1100530494 12:95457201-95457223 GCCTGAAGCCCCATCAGTGGGGG - Intergenic
1101059282 12:100954293-100954315 GCCTGAAGCACCACAGCAGCAGG + Intronic
1101217003 12:102595102-102595124 GTCTGAGGCCCCATATGTGCAGG - Intergenic
1101704687 12:107211016-107211038 GCCCAAAGCCCCATTGGGGCGGG + Intergenic
1102236237 12:111296282-111296304 GCCTGAGCCCCTTTAGGGGCAGG + Intronic
1102563418 12:113778954-113778976 GCCGGAGCCCCCATGGGGGCAGG - Intergenic
1108691457 13:52862857-52862879 GCTTGAAGAGCCAGAGGGGCAGG + Intergenic
1108701451 13:52947768-52947790 GCCTGCAGCCCCATCGCTGCCGG - Intergenic
1108890558 13:55252929-55252951 CCCAGAAGCCCCAAAGGTGCAGG - Intergenic
1112934027 13:104777103-104777125 TACTGAAGCCCCAGAAGGGCTGG - Intergenic
1113804266 13:113104227-113104249 ACCTGGAGCCCCAAAGGGGAAGG + Intergenic
1118011577 14:61615504-61615526 GCCAGAAGCATCTTAGGGGCTGG - Intronic
1120198602 14:81514165-81514187 GCCCAAAGCCCCATCGGGGCGGG + Intronic
1122541359 14:102499459-102499481 GCCTGCAGCCTCAGAGGGGCAGG + Exonic
1122642109 14:103166023-103166045 GTCTGATGCCCCATATGTGCAGG + Intergenic
1122875945 14:104664925-104664947 GCCTGATGCCCCTGAGGAGCTGG + Intergenic
1123395556 15:19931226-19931248 GCATGAACCACCATATGGGCTGG + Intergenic
1124560754 15:30771250-30771272 CCCTGGAGCCCCATCAGGGCAGG - Intronic
1124566246 15:30816794-30816816 GCTTGAAGAACCATGGGGGCGGG + Intergenic
1129379591 15:75156696-75156718 GTCTGTAGCCCCATGAGGGCAGG + Intergenic
1130128926 15:81119784-81119806 GCATGAACCACCATGGGGGCTGG - Intronic
1131096010 15:89654851-89654873 GTCGGGAGCCCAATAGGGGCTGG - Intronic
1132146732 15:99433663-99433685 CCCTGGAGCCACATTGGGGCAGG + Intergenic
1132218144 15:100083150-100083172 GCCTGAAGCACCTCAGGGCCTGG + Intronic
1132458011 16:35017-35039 GGCTGAAGCCCCATAGGTCTGGG + Intergenic
1133285477 16:4688705-4688727 ATCTGGAGCCCCAGAGGGGCTGG - Intronic
1134046962 16:11108144-11108166 GTCTGAAGCACCATGAGGGCAGG + Intronic
1136698000 16:32103407-32103429 GCATGAACCACCATATGGGCTGG + Intergenic
1136769596 16:32824460-32824482 GCATGAACCACCATATGGGCTGG - Intergenic
1136798497 16:33046693-33046715 GCATGAACCACCATATGGGCTGG + Intergenic
1136935813 16:34463394-34463416 GCATGAACCACCATATGGGCTGG - Intergenic
1136948743 16:34689133-34689155 GCATGAACCACCATATGGGCTGG + Intergenic
1136964005 16:34885176-34885198 GCATGAACCACCATATGGGCTGG + Intergenic
1136968139 16:34939763-34939785 GCATGAACCACCATATGGGCTGG + Intergenic
1137093151 16:36219640-36219662 GCATGAACCACCATATGGGCTGG + Intergenic
1137219996 16:46439594-46439616 GCATGAACCACCATATGGGCTGG - Intergenic
1137545786 16:49402302-49402324 CCCTGGACTCCCATAGGGGCAGG - Intergenic
1137665566 16:50247005-50247027 GGCTGAAGCCCCCTCGGGCCTGG + Intronic
1139505378 16:67395813-67395835 GCCTATAGACCCATGGGGGCTGG - Intronic
1140034909 16:71364526-71364548 GCCAGAGGCCCCAGATGGGCCGG - Intronic
1141649608 16:85385942-85385964 GGCTCAAGCCCCATTGGGGAGGG + Intergenic
1142141848 16:88476084-88476106 GCCTCAGACCCCACAGGGGCAGG + Intronic
1203072013 16_KI270728v1_random:1086565-1086587 GCATGAACCACCATATGGGCTGG - Intergenic
1143010867 17:3865564-3865586 ATTTGAAGCCCCAGAGGGGCTGG + Exonic
1143735415 17:8908964-8908986 GCCTGGACCTCCAGAGGGGCTGG - Intronic
1143837961 17:9707876-9707898 GACTGAAGTCCCATGAGGGCAGG - Intronic
1145692177 17:26753644-26753666 GCATGAACCACCATATGGGCTGG + Intergenic
1146650170 17:34601707-34601729 CTCTGAAGCCCCAGAGGGGCTGG - Intronic
1148784315 17:50138008-50138030 GGCAGAAGCCCCATAGGTACTGG + Intronic
1148895610 17:50837476-50837498 GCCTGTTGCCCCAGAGGGGGTGG - Intronic
1151578471 17:74964385-74964407 GCCTCCCGCCCCACAGGGGCAGG - Intronic
1203183703 17_KI270729v1_random:91191-91213 GCATGAACCACCATATGGGCTGG + Intergenic
1155786922 18:29913611-29913633 GTCTGAGGCCCCATATGTGCAGG + Intergenic
1157803037 18:50636327-50636349 GACTGAAGCCCCAAGAGGGCAGG + Intronic
1159617938 18:70603190-70603212 GCCAGCAGCCCCACAGGGTCGGG + Intergenic
1160510886 18:79452686-79452708 GCCTGAACCCCCTTGAGGGCTGG - Intronic
1160622945 18:80183380-80183402 GCCTGAAACCCATTAGGGCCAGG - Intronic
1162057859 19:8075483-8075505 GCCTGAAGCCACACAGTGGTGGG - Intronic
1162480384 19:10923931-10923953 GCAGGAAGCCCCACAGGGCCAGG + Exonic
1162792506 19:13070297-13070319 GCCTGCGGCCCTATCGGGGCAGG + Intronic
1163326417 19:16606252-16606274 GCCTGAAGACACAATGGGGCCGG + Intronic
1163581261 19:18140293-18140315 GCCTGAACCCCCAGAGGTGGAGG + Intronic
1164120633 19:22262019-22262041 GCCTGGAGCCCCAGAGGCCCAGG - Intergenic
1164137400 19:22427468-22427490 GCCTGGAGCCCCAGAGGTCCGGG + Intronic
1164150656 19:22547703-22547725 GACTGACGCCCCAAAGGGGCTGG - Intergenic
1167246737 19:48377530-48377552 GCCTCAAGCCCCAAAGTAGCTGG + Intergenic
1167491453 19:49795065-49795087 GCTTGAAGCCACTCAGGGGCAGG - Intronic
1202710572 1_KI270714v1_random:17410-17432 GCCTGATTCCCCACAGGGGCAGG + Intergenic
925705974 2:6684977-6684999 GTCTGACGCCCCATATGTGCAGG - Intergenic
928760034 2:34571012-34571034 CCCTGGAGCCCCATCAGGGCAGG + Intergenic
928819643 2:35344083-35344105 GTCTGAGGCCCCATATGTGCAGG + Intergenic
928966031 2:36976590-36976612 AACTGAAGCCCCAAAGGGTCAGG + Intronic
931702302 2:64918914-64918936 GCCTGAAACCCCATGTGGACAGG + Intergenic
933141168 2:78794061-78794083 GTCTGAGGCCCCATATGTGCAGG - Intergenic
936766143 2:115850922-115850944 GCATGAAGTCACATATGGGCAGG + Intergenic
937332901 2:121043239-121043261 GCCTGCAGCCCCAGAGGGGCCGG + Intergenic
941686751 2:168455940-168455962 CCCTGAAACCCCAGCGGGGCAGG + Intronic
941918455 2:170827462-170827484 GCCAGGAGCCCCACAGGGGATGG + Intronic
944063556 2:195595365-195595387 CCCTGAAGCCCCATCAGCGCAGG - Intronic
946066989 2:216996448-216996470 GCCTGAGGCCCACCAGGGGCAGG - Intergenic
948824186 2:240566517-240566539 GCCTGACGCCCCCTGGCGGCGGG - Intronic
1173844206 20:46177853-46177875 AGCTGAGGCCCCATGGGGGCTGG + Intronic
1176018834 20:62952583-62952605 CCCTGCTGCCCCATAGGAGCGGG - Intergenic
1176310446 21:5146277-5146299 GGCTGAAGCCCCCTGCGGGCTGG - Exonic
1176585671 21:8582469-8582491 GCATGAATCACCATATGGGCTGG + Intergenic
1179451140 21:41469171-41469193 GGCTGAAGCCCCAGGGTGGCGGG - Intronic
1179487841 21:41722333-41722355 GCCTTAAACCCCATAGGAGAAGG - Intergenic
1179846609 21:44115758-44115780 GGCTGAAGCCCCCTGCGGGCTGG + Exonic
1179917745 21:44488736-44488758 GCCTGAGGCCCCGTATGTGCAGG + Intergenic
1180268480 22:10559368-10559390 GCATGAATCACCATATGGGCTGG + Intergenic
1181478178 22:23181173-23181195 GCCGGAAGCCCCATCGCTGCCGG - Exonic
1182740502 22:32563963-32563985 GCTTGAAACCCAACAGGGGCCGG - Intronic
1183085915 22:35486981-35487003 TGGGGAAGCCCCATAGGGGCAGG - Intergenic
1183935747 22:41261191-41261213 GCCTGAAGCCCCATAGGGGCTGG + Intronic
1184287731 22:43481425-43481447 GTCTGAGGCTTCATAGGGGCAGG + Intronic
1184527834 22:45035990-45036012 GTGTGAAGTCCCATGGGGGCTGG - Intergenic
1185402956 22:50627911-50627933 TCCTGAAGCTCCAGAGGGCCGGG + Exonic
1203323116 22_KI270737v1_random:88275-88297 GCATGAACCACCATATGGGCTGG - Intergenic
952003279 3:28810456-28810478 GTCTGAGGCCCCATATGTGCAGG - Intergenic
954878995 3:53821360-53821382 CCCTGAAGCCCCACTGGGTCGGG - Intronic
955403862 3:58613026-58613048 GACTGAAGCCCCATTGGAGGAGG - Intronic
956843192 3:73158514-73158536 GCCCAAAGCCCCATCGGGGCAGG - Intergenic
960062518 3:113339062-113339084 GTCTGAAGCCCCATATGTGCAGG - Intronic
961261448 3:125605430-125605452 GCCCAAAGCCCCATCGGGGAGGG + Intergenic
961343399 3:126245486-126245508 GTCTGAGGCCCCATATGTGCAGG - Intergenic
963409406 3:144908665-144908687 GCCCAAAGCCCCATTGGGGTGGG - Intergenic
965320751 3:167249260-167249282 GCCTGAGGCCCCATAAGTGTAGG + Intronic
966440261 3:179937132-179937154 GCCTGAAGCTCCTTAAGGGTAGG - Intronic
968382346 4:107603-107625 GCCTGGAGCCCCATGGAGCCCGG - Intergenic
968453068 4:684162-684184 TCCTGCAGACCCACAGGGGCGGG + Intronic
969533134 4:7740476-7740498 GCCTGGTGTCCCATAGGGGCAGG - Exonic
972133502 4:35863956-35863978 GCCTGAAGCCCCTTCGGAGTGGG - Intergenic
972710387 4:41589358-41589380 GGCTGAAGCCGCATCGGGGGTGG + Intronic
976073723 4:81272833-81272855 GACTGAAGCCCTGCAGGGGCTGG - Intergenic
979919669 4:126480649-126480671 GTCTGAGGCCCCATATGTGCAGG + Intergenic
980495785 4:133586637-133586659 GTCTAAAGCCCCATATGTGCAGG + Intergenic
984081564 4:175254406-175254428 GTCTGAAGCCCCATATGTGCAGG + Intergenic
988923095 5:35962639-35962661 GCCTGAGGCCCCACATGTGCAGG - Intronic
991227776 5:64292762-64292784 GAATGAAGCCCCATGGGGGAGGG - Intronic
994231953 5:97317091-97317113 GCCCAAAGCCCCATCGGGGTGGG - Intergenic
996871660 5:128199412-128199434 TCCTGTAGCCCCATCAGGGCAGG + Intergenic
999148788 5:149413090-149413112 GCCTGAGGCCCCAGAGGAGTGGG - Intergenic
1000242260 5:159419387-159419409 CCCTAACCCCCCATAGGGGCAGG - Intergenic
1002523344 5:179803239-179803261 GCCTTTAGCCCCAGAGAGGCAGG - Intronic
1002575043 5:180169789-180169811 GCTTGGAGCCCCATGGGGTCGGG - Intronic
1004406541 6:15338498-15338520 GGCTGAGGCCCCATATGTGCAGG + Intronic
1005809469 6:29505148-29505170 GCCTGTAGCCACATATGGCCTGG + Intergenic
1005976775 6:30806174-30806196 GAATGAAGACCCACAGGGGCCGG + Intergenic
1009626693 6:66144931-66144953 GTCTGAGGCCCCATATGTGCAGG - Intergenic
1009725407 6:67531135-67531157 GCCTGAAGTCCCATATGTGCAGG - Intergenic
1011375253 6:86680208-86680230 GCCCAAAGCCCCATTGGGGTGGG - Intergenic
1014277128 6:119399729-119399751 GCCTGAGGCCCCATATGTGCAGG - Intergenic
1017717831 6:157224548-157224570 CCCAGAAGCCCCAAAGGCGCAGG - Intergenic
1019042664 6:169119602-169119624 GTCTGAGGCCCCATACGTGCAGG + Intergenic
1019838315 7:3413296-3413318 GCCTGAAGCTAAAGAGGGGCAGG + Intronic
1020003558 7:4769320-4769342 GCCTGAAGCGGGATGGGGGCGGG - Exonic
1023656094 7:42422402-42422424 GCCTGAAGCAGCATAGGCCCAGG + Intergenic
1025141556 7:56471164-56471186 TCCTGTAGCCCCATCAGGGCTGG - Intergenic
1025321446 7:58098266-58098288 GCATGAACCACCATATGGGCTGG + Intergenic
1025474588 7:60903524-60903546 GCATGAACCACCATATGGGCTGG + Intergenic
1025480744 7:60979578-60979600 GCATGAACCACCATATGGGCTGG + Intergenic
1025488300 7:61079445-61079467 GCATGAACCACCATATGGGCTGG - Intergenic
1025512415 7:61586350-61586372 GCATGAACCACCATATGGGCTGG - Intergenic
1025551352 7:62253950-62253972 GCATGAACCACCATATGGGCTGG - Intergenic
1025707648 7:63882290-63882312 TCCTGTAGCCCCATCAGGGCTGG - Intergenic
1026890074 7:73976789-73976811 GCCTGAGGCCACGGAGGGGCTGG + Intergenic
1027869617 7:83690765-83690787 CCCTGGAGCCCCATCTGGGCAGG - Intergenic
1029712046 7:102304971-102304993 GCCTGAGGCCCCCTTGGGGCTGG - Intronic
1032917888 7:136511868-136511890 GTCTGAGGCCCCATATGTGCAGG - Intergenic
1033636842 7:143219531-143219553 GCCTGCAGCCCCAGAGGCTCAGG - Intergenic
1035456489 7:159012847-159012869 GCCTGGAGCCCCAGCGGGGCCGG - Intergenic
1038697906 8:29822316-29822338 GCCTGCAGCCCCAAAGCAGCTGG - Intergenic
1039659834 8:39449731-39449753 GTGTGAGGCCCCATATGGGCAGG + Intergenic
1039886400 8:41656537-41656559 GCTGGAGGCCCCATGGGGGCAGG - Intronic
1039893034 8:41697250-41697272 GCAGGAAGCCCCACAAGGGCAGG - Intronic
1040797062 8:51298415-51298437 GCCCAAAGCCCCATTGGGGAGGG - Intergenic
1041935096 8:63324726-63324748 GTCTGAGGCCCCATATGTGCAGG + Intergenic
1041935375 8:63326574-63326596 TCCTGAAGCCCCAGTGGGCCTGG - Intergenic
1045188965 8:99864848-99864870 GCCTGGAGCCCCACAGGGGTAGG - Intronic
1047561745 8:125993531-125993553 GCCTGAAGCCAAATAGATGCTGG + Intergenic
1048923527 8:139251414-139251436 CCCTGGAGCCCCACAGGGTCAGG - Intergenic
1049006647 8:139859886-139859908 GTCTGTGGCCCCAGAGGGGCTGG - Intronic
1049945576 9:592007-592029 GCCTGTAACACCATAGGGGCAGG + Intronic
1051780449 9:20683894-20683916 GCCAAAAGCTGCATAGGGGCAGG + Intronic
1053139004 9:35670557-35670579 GCCTTCAGCTCCATAAGGGCAGG - Intronic
1053698617 9:40663903-40663925 GCATGAACCACCATATGGGCCGG - Intergenic
1054309906 9:63463304-63463326 GCATGAACCACCATATGGGCCGG - Intergenic
1054408695 9:64787456-64787478 GCATGAACCACCATATGGGCCGG - Intergenic
1054441852 9:65271270-65271292 GCATGAACCACCATATGGGCCGG - Intergenic
1054488431 9:65750227-65750249 GCATGAACCACCATATGGGCCGG + Intergenic
1058828414 9:108794897-108794919 GCCTGAGGTCCCATATGCGCAGG + Intergenic
1058871023 9:109201804-109201826 GCCTGAGGCCCCATATGACCCGG - Intronic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059022980 9:110596737-110596759 CCCTGAAAGGCCATAGGGGCAGG - Intergenic
1059293738 9:113250972-113250994 GCCAGAAGCCCCAAAGATGCTGG + Intronic
1059345416 9:113624948-113624970 GCCTGTGGCCCCAGAGGGGGTGG - Intergenic
1202780983 9_KI270717v1_random:37110-37132 GCATGAACCACCATATGGGCCGG - Intergenic
1203615573 Un_KI270749v1:59991-60013 GCATGAATCACCATATGGGCTGG + Intergenic
1189268321 X:39733215-39733237 GTCTGAAGCCCCATGGAGGCTGG + Intergenic
1189950647 X:46226722-46226744 CCCTGAAGCCCCATTAGGGCAGG + Intergenic
1190316586 X:49155925-49155947 GCCTATAGGCCCATGGGGGCGGG - Intergenic
1190318168 X:49164274-49164296 GCCTATAGTCCCATGGGGGCGGG + Intronic
1196725395 X:118890602-118890624 GCCTGAAGCCAAATAGCTGCTGG + Intergenic
1197513161 X:127396112-127396134 GCCCAAAGCCCCACTGGGGCGGG + Intergenic
1199693971 X:150330434-150330456 GACTGAAGGTACATAGGGGCAGG + Intergenic
1200699228 Y:6387917-6387939 GACTGATGCCCCATAGTGGGTGG - Intergenic
1201034883 Y:9776781-9776803 GACTGATGCCCCATAGTGGGTGG + Intergenic
1201649134 Y:16265812-16265834 GCCAAAAGCCCCGTTGGGGCGGG - Intergenic
1201653675 Y:16319488-16319510 GCCAAAAGCCCCGTTGGGGCGGG + Intergenic