ID: 1183936956

View in Genome Browser
Species Human (GRCh38)
Location 22:41268052-41268074
Sequence AAGAGGGCCTTGCGCGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183936952_1183936956 -9 Left 1183936952 22:41268038-41268060 CCTGGGAATTGCCAAAGAGGGCC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1183936956 22:41268052-41268074 AAGAGGGCCTTGCGCGTGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 92
1183936946_1183936956 18 Left 1183936946 22:41268011-41268033 CCAGAAAGAATAAAGCATGAGAA 0: 1
1: 1
2: 2
3: 43
4: 531
Right 1183936956 22:41268052-41268074 AAGAGGGCCTTGCGCGTGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 92
1183936951_1183936956 -8 Left 1183936951 22:41268037-41268059 CCCTGGGAATTGCCAAAGAGGGC 0: 1
1: 0
2: 1
3: 8
4: 149
Right 1183936956 22:41268052-41268074 AAGAGGGCCTTGCGCGTGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183936956 Original CRISPR AAGAGGGCCTTGCGCGTGGA GGG Intronic
902847342 1:19122233-19122255 AACAGCGCCTTGCGTGGGGATGG - Intronic
906107662 1:43304626-43304648 AAGAGGCCAGTGCGCATGGAAGG + Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
914964678 1:152244516-152244538 AATAGGGCCTTGCTCATGGTTGG + Intergenic
915091790 1:153431439-153431461 AAGAGGGCCTGGCTGGAGGAGGG - Intergenic
915759342 1:158295235-158295257 AAGAAGGCATTGAGAGTGGATGG + Intergenic
920677210 1:208046444-208046466 AAGAGGGCCTGGGGCATGGGGGG + Intronic
921100633 1:211925483-211925505 AAGGGGGCCTTGCACTTTGAGGG + Intergenic
921919788 1:220654977-220654999 AAAAGGGCCTTGCGTGTAGTAGG - Intronic
924185894 1:241490068-241490090 CAGAGGGCCTGGAGTGTGGAGGG - Intergenic
1063313341 10:4977769-4977791 CAGAAGGCCCTGCGTGTGGATGG + Exonic
1063314612 10:4989947-4989969 CAGAAGGCCCTGCGTGTGGATGG - Exonic
1064011601 10:11740944-11740966 AAGAGGGACATGCAGGTGGACGG - Intergenic
1065278026 10:24105910-24105932 AAGAGGGCCTTGATCGAGGCAGG + Intronic
1070771156 10:79083010-79083032 AAGAGTGCCTGGCACATGGAAGG - Intronic
1074308297 10:112299215-112299237 AAGAGGTCATTGAGTGTGGAAGG - Intronic
1077217818 11:1402370-1402392 AAGGTGGCCTTGGGGGTGGATGG + Intronic
1080384399 11:31802642-31802664 GAGAGGGCGTTGAGAGTGGAGGG + Intronic
1081389067 11:42507590-42507612 AAGAGGGTCTAGTGTGTGGAGGG + Intergenic
1083571202 11:63763142-63763164 ACGTGGGCCCTGCGCGGGGAGGG + Exonic
1085458855 11:76681093-76681115 AAGAGGGACTTGTGCAGGGAAGG + Intergenic
1093710967 12:22329630-22329652 AAAAGGGCATTGGGAGTGGAGGG - Intronic
1093885535 12:24455769-24455791 AGGAGGGCCTTGGTCCTGGAGGG - Intergenic
1094221812 12:28002005-28002027 AAGAGGGCATTCCACATGGAGGG - Intergenic
1094317846 12:29151491-29151513 CACAGGGCCTTGCACTTGGAAGG + Intronic
1094624291 12:32107584-32107606 GAGTGGGCCTTGCGGGTGGGGGG - Intronic
1105886601 13:24648082-24648104 AAGTGGGCCTTCTGGGTGGAAGG - Intergenic
1106382299 13:29252103-29252125 AAGAGGCCCTGGCGTCTGGAAGG - Intronic
1117620356 14:57579790-57579812 TATAGGGCCTTGTGCTTGGAAGG + Intronic
1118317919 14:64737035-64737057 AAGAGGGCCTCGCCCCTGGCTGG + Intronic
1125929827 15:43592735-43592757 ATGAGGGGCTTCAGCGTGGAGGG - Intergenic
1125942994 15:43692567-43692589 ATGAGGGGCTTCAGCGTGGAGGG - Intergenic
1128552566 15:68607979-68608001 AACAGGGCCTTGGGAGTGAATGG + Intronic
1132055940 15:98650034-98650056 GAGAGGCTCTTGCGCATGGAAGG - Intronic
1138565359 16:57828803-57828825 GTGAGGGGCTTGTGCGTGGAGGG - Intronic
1148440194 17:47708267-47708289 AGGAGGGCCCTGCGGGTGGGAGG + Intronic
1148861021 17:50604410-50604432 AAAAGGGCCTAGAGCCTGGAGGG - Intronic
1149387143 17:56153457-56153479 AAGAGGACCTGGGGGGTGGAGGG - Exonic
1152567282 17:81105991-81106013 TAGAGGGACTTGTGCATGGATGG + Intronic
1154299918 18:13184084-13184106 AACAGCGCCTAGCTCGTGGAGGG + Intergenic
1155308875 18:24504791-24504813 AAGAGGGCGTTTCCAGTGGAGGG + Intergenic
1161760454 19:6167359-6167381 CAGAGGGCCTGGCCCATGGAAGG + Intronic
1161956932 19:7501327-7501349 AAGAGCGCCTGGTGCGTGGTGGG - Exonic
1165679285 19:37760147-37760169 AAGAGGGCCTAGCACGAAGAGGG + Intronic
1167696085 19:51016256-51016278 AAGAGGGCCTTGTGGGAGAAGGG + Intronic
1168135551 19:54349053-54349075 AAGAGGGCGCTGAGGGTGGATGG + Intergenic
925135096 2:1521492-1521514 AAGAGGGCCCTGGGGGAGGAGGG - Intronic
925912619 2:8583434-8583456 CAGAGGGCCTGGGGCGTGGGCGG + Intergenic
926348194 2:11968693-11968715 AAGAGAGTCTGGCACGTGGAAGG + Intergenic
926694465 2:15761448-15761470 AAGAGGGCATGGCAGGTGGACGG + Intergenic
926726212 2:16000206-16000228 AAGAGGGCCTGGCACGTGCCTGG + Intergenic
944220599 2:197300546-197300568 AAGAGGGCCTTTCATGTGCAAGG + Intronic
948946752 2:241224357-241224379 AAGAGGGCCTTGTGAGCTGACGG - Exonic
1172252481 20:33489844-33489866 AAGTGGGCCGTGCGCGTGACGGG + Intergenic
1173185538 20:40837149-40837171 AAGAGGGTCTTCCCCATGGAAGG - Intergenic
1176004217 20:62850918-62850940 AGCAGGGCCTTGCGGGTGGAAGG - Intronic
1177171766 21:17662884-17662906 CAGAGGGCCTGGCGCGTGGTAGG - Intergenic
1179288909 21:40001289-40001311 AAGTGGACCTTGTGCCTGGAAGG + Intergenic
1181439702 22:22929393-22929415 CAGTGGGCATTGCGAGTGGATGG - Intergenic
1181807360 22:25383271-25383293 AAGAGGGACGTGTGCGTGGGGGG - Intronic
1183936956 22:41268052-41268074 AAGAGGGCCTTGCGCGTGGAGGG + Intronic
1184072120 22:42152837-42152859 AAGAGGGGCTTGTGAGTGGGCGG - Intergenic
961393634 3:126571171-126571193 AAGAGCCCCCTGCTCGTGGAGGG - Intergenic
961737762 3:129012917-129012939 CAAAGGGCCTGGCGCATGGATGG + Intronic
964429782 3:156593223-156593245 AAGAGTACCTAGTGCGTGGAAGG - Intergenic
968435813 4:588440-588462 AAGATGGCCGCACGCGTGGAGGG - Intergenic
968435829 4:588523-588545 AAGATGGCCGCACGCGTGGAGGG - Intergenic
969271910 4:6108653-6108675 TAGAGGGCTTTGAGCATGGAGGG - Intronic
969476532 4:7425361-7425383 TAAAGGGCCTTGCCTGTGGAAGG + Intronic
969485675 4:7471240-7471262 AAGATGGCATTGCGCGAGGCAGG - Intronic
974025766 4:56732046-56732068 CAGAGGGCCTTGGGCGTGGCAGG + Intergenic
980969534 4:139556040-139556062 CAGAGGGCCTGGAGCGCGGAAGG - Intronic
983185961 4:164700760-164700782 AAGAGGGCCTTCAGAGTGCATGG - Intergenic
984553044 4:181183207-181183229 AAGAGTGGCTTGCGCATAGAAGG - Intergenic
997456789 5:134023622-134023644 AAGAGGGCCTGGCCCATGGTAGG - Intergenic
1002434075 5:179220654-179220676 CAGAGGGCATAGAGCGTGGAGGG - Intronic
1008010955 6:46467198-46467220 AACAGGACCTTGCACTTGGAAGG + Intronic
1023240993 7:38147057-38147079 ACGAGGGCCTAGCTCCTGGATGG + Intergenic
1023869305 7:44254329-44254351 AACCTGGCCTTGGGCGTGGAGGG + Intronic
1038496539 8:28007281-28007303 AAGAAGGCCTGGTGCCTGGAAGG - Intergenic
1048968767 8:139632395-139632417 ACCAGGGCCTCCCGCGTGGAAGG + Intronic
1049702142 8:144020177-144020199 AAGAGGGTCCTGAGCGGGGAGGG - Intronic
1050463600 9:5897680-5897702 AAGAGGGCCCTGGACTTGGAGGG - Intronic
1051343315 9:16130511-16130533 CAGAGGGCCTGCCGCGTGGCAGG + Intergenic
1054934001 9:70667463-70667485 AAGAGGGCCATGCAAGGGGAAGG - Intronic
1057607440 9:96510006-96510028 CAGAGGGCTTTGCTCCTGGAAGG + Intronic
1059526065 9:114992100-114992122 AAGCGGGTCTTGGCCGTGGAGGG + Intergenic
1060104789 9:120866828-120866850 AAGTGGGCCTTGGGCGTGGTGGG - Intronic
1061794584 9:133078433-133078455 AAGAGGGCCTTGCCTGGGGGAGG + Intronic
1062623514 9:137433143-137433165 AAGTGGGCCCTGTGGGTGGAGGG - Intronic
1187551476 X:20310234-20310256 AAGAGGGGCTTGTTGGTGGAGGG + Intergenic
1192919317 X:75689883-75689905 AAGAAGGCATTGAGAGTGGATGG + Intergenic
1195925944 X:110024737-110024759 AAGAGGGCCTTGGGAGATGATGG + Intronic
1198485488 X:137083343-137083365 AATAGGGCCTTGCACATAGAAGG - Intergenic
1198945806 X:142012095-142012117 AGGAGGGCATTGAGAGTGGATGG - Intergenic
1199138927 X:144287390-144287412 AAGAGAGCCTACCGCGTTGAAGG - Intergenic
1199850391 X:151721741-151721763 AAGAGGGCCTAGGGCCTTGAGGG - Intronic