ID: 1183937727

View in Genome Browser
Species Human (GRCh38)
Location 22:41273171-41273193
Sequence TTGCCTGCTCACAGCAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183937727 Original CRISPR TTGCCTGCTCACAGCAACCA GGG (reversed) Intronic
900634581 1:3656453-3656475 GTACCAGCTCACAGCCACCATGG - Intronic
902620713 1:17649267-17649289 CTGCCTGATCACAACACCCAGGG + Intronic
904262916 1:29300725-29300747 TTCTCTGCTCTCAGGAACCACGG - Intronic
904528369 1:31151878-31151900 TTGCAAGCTCACTGCAACCTGGG - Intergenic
905886146 1:41493260-41493282 TTGCCTGGTCACACCAATCCTGG + Intergenic
906796715 1:48702142-48702164 TTTCCTGCTCAATGCATCCAAGG - Intronic
908359653 1:63356560-63356582 TTTCCTGCTAAAAGGAACCAGGG + Intergenic
911428269 1:97749767-97749789 TTCCCTGCTCACCACAACTATGG + Intronic
912444691 1:109726250-109726272 TTGCCTGCCTGCAGAAACCATGG - Intronic
912467301 1:109882916-109882938 TTTCTTGCTCACTGCAGCCATGG + Intergenic
913355085 1:117912072-117912094 TTGACTGCTCTCTGCAACAAAGG + Exonic
915357695 1:155265817-155265839 CTGCCTGCCCCCAGTAACCAAGG + Intronic
915860076 1:159434750-159434772 TTGACTTCTCACAGCAACCCTGG - Intergenic
915979527 1:160411183-160411205 TCCCCTGCTCAAACCAACCATGG - Intronic
916483697 1:165237757-165237779 TTCCTTGGTCACAGAAACCAGGG + Intronic
916630987 1:166612152-166612174 CTGCCTGCTCATAGCACACAGGG + Intergenic
919123190 1:193366277-193366299 TTGTCTGCTTACAGAAAGCATGG + Intergenic
920240256 1:204541895-204541917 AGGCCTGCCCATAGCAACCATGG - Intronic
1063954248 10:11251480-11251502 TTGCATGATCACAGAAGCCAAGG + Intronic
1064493700 10:15885968-15885990 TTGACTGCATACAGCAAGCAAGG - Intergenic
1065777386 10:29133476-29133498 TTGCCAGCTCAGAGAAAGCAAGG - Intergenic
1066289163 10:33998357-33998379 ATGCCTGCTCACATCGATCAGGG - Intergenic
1067211185 10:44261373-44261395 TCGCCTGCTCACTGCAGCCTGGG - Intergenic
1068510983 10:57965550-57965572 TTGCCTTCTCAGAGTAACCAGGG + Intergenic
1070697741 10:78575231-78575253 TGGCCTGCTCAGAGCACCCCAGG + Intergenic
1074060180 10:109958254-109958276 TTACATGCTCACAGCCTCCAGGG - Intergenic
1075625191 10:123959077-123959099 TTGCCTGCTCCCTGAGACCAAGG + Intergenic
1077555887 11:3225854-3225876 GAGCCTGCTCTCAGCATCCAGGG - Intergenic
1077574996 11:3376198-3376220 CAGACTGCTCACAGCAACCATGG - Intronic
1078576997 11:12511074-12511096 TGACCTGCCCACAGCAACCTAGG + Intronic
1079109354 11:17595746-17595768 TTGCTTCCTCACAGCCAGCAAGG + Intronic
1083362427 11:62120165-62120187 ATCTCTGCTCACAGCAACCTTGG + Intergenic
1084312565 11:68325430-68325452 TTGGCTGCCCACAGCACCTAAGG + Intronic
1087544040 11:99561056-99561078 TTTTCTACTCAAAGCAACCAGGG + Intronic
1090277810 11:125432000-125432022 GTCTCTGCGCACAGCAACCATGG + Exonic
1091277028 11:134359570-134359592 TTGCCTGCTAGCAGCACCCCTGG + Intronic
1091804667 12:3347152-3347174 TTACCTGCACACAACAAACACGG - Intergenic
1093409665 12:18849363-18849385 TTGAATGATCACAGAAACCAAGG - Intergenic
1094669086 12:32551405-32551427 TTGAATCCTCACAGCAACCTAGG + Intronic
1096675914 12:53225803-53225825 TTGAGTGCTGACAGCAGCCAAGG - Intronic
1097056508 12:56253220-56253242 CAGACTGCTCACATCAACCATGG - Intronic
1100160765 12:91858327-91858349 TTGCCTGCTCACGCTAACAAAGG + Intergenic
1101999383 12:109547343-109547365 TTGTTTGATCTCAGCAACCAGGG - Intergenic
1103239482 12:119400883-119400905 GTGGCTTCTGACAGCAACCAGGG - Intronic
1104919541 12:132283409-132283431 TTTCCTGCTCACAGCAACAGTGG - Intronic
1106799940 13:33245941-33245963 TCTTCTGCTCACAGTAACCATGG - Intronic
1107720582 13:43244219-43244241 TTTGGTCCTCACAGCAACCATGG - Intronic
1111664943 13:91254969-91254991 TTGCCAGCTCACAGGAAGCCAGG + Intergenic
1114129313 14:19771643-19771665 TAGCATGCCCAAAGCAACCATGG + Intronic
1117222353 14:53618716-53618738 TTCCTTGCTAACATCAACCAGGG - Intergenic
1121466486 14:94118713-94118735 TTGTCTGCTCACAGCAGAAAAGG + Intergenic
1122138952 14:99650691-99650713 TTTCCTCCTCAAGGCAACCATGG - Intronic
1122836820 14:104434616-104434638 TGCCCTGATCCCAGCAACCAAGG + Intergenic
1123631267 15:22261395-22261417 TTGCCTGCTCCAAGCAATAAAGG - Intergenic
1125136598 15:36350938-36350960 CTGCCTGCCCACAACACCCATGG + Intergenic
1128039585 15:64559375-64559397 GTGCCTGATGGCAGCAACCAAGG + Intronic
1128250016 15:66157285-66157307 TTTCCTGATCACAGCTAGCAGGG + Intronic
1129087745 15:73114079-73114101 TTGCCTGTTCTAAGCAAGCATGG - Intronic
1129116242 15:73367036-73367058 ATGCCTGCTGTCAGCACCCAAGG + Intronic
1129952716 15:79606288-79606310 TTGCCTGCTGTCAGCAATAATGG - Intergenic
1130843411 15:87722958-87722980 TTTCCTGCACAGAGCCACCATGG - Intergenic
1131212205 15:90507574-90507596 TTACCCGCTAACAGTAACCAGGG - Intergenic
1132094079 15:98969268-98969290 TGGCCTGCACACAGCAAAGAGGG + Intronic
1132588921 16:717949-717971 CTGCGGGCTCACAGCAGCCATGG - Exonic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1136316564 16:29457919-29457941 GTGACTTCTCACAGCTACCAAGG - Exonic
1136431140 16:30197261-30197283 GTGACTTCTCACAGCTACCAAGG - Exonic
1139825514 16:69754313-69754335 GTTCATGCTCACAGCAACCTTGG + Intronic
1141254737 16:82390496-82390518 TTTCCAGCGCACAGCAACCATGG - Intergenic
1141736457 16:85857385-85857407 GTGCCTGCTGAGAGCAACCCTGG - Intergenic
1145766625 17:27462347-27462369 TTCCTTGGTCTCAGCAACCATGG - Intronic
1147125576 17:38365835-38365857 TTGCCAGCTTACAGTACCCAAGG + Intronic
1149410216 17:56397228-56397250 TAGCCTGCTCTCAGCATTCATGG - Intronic
1149563431 17:57625724-57625746 TTTGCTGCTTACAGCAGCCAGGG - Intronic
1151363949 17:73605151-73605173 TTGCCTGCCCACATCACCCCAGG - Intronic
1151756429 17:76077829-76077851 TTGCCTGCTTTCAGCTCCCAGGG + Intronic
1152528096 17:80901072-80901094 TTGCCTGTGGACAGCACCCAGGG - Intronic
1153999421 18:10471359-10471381 TTGACTCCTCACAACAACCTAGG - Intronic
1156271317 18:35535537-35535559 TTGCTTCTTCACAGCAAACAGGG + Intergenic
1157446077 18:47747833-47747855 CTGCCTGCTGACAGGAACAAAGG + Intergenic
1162490334 19:10987652-10987674 TTGCCTTCTCCCAGGACCCATGG + Exonic
1163645836 19:18488531-18488553 CTGCATGCTCCCAGCATCCACGG + Intronic
1164042917 19:21509599-21509621 CTGCCTGCTCACCCCAGCCATGG + Intronic
1164053270 19:21600995-21601017 TAGCCTGCTCACAATAGCCATGG - Intergenic
1164225934 19:23245978-23246000 TAGCCTGCTCACTCCAGCCATGG - Intronic
1164228578 19:23267853-23267875 TGGCCTGCTCACAATAGCCATGG - Intergenic
1164243547 19:23410834-23410856 TGGCCTGCTCACAATAGCCATGG - Intergenic
1164719824 19:30424036-30424058 TTGCATACTCACAGCAAGCAGGG - Intronic
1164777167 19:30861991-30862013 TAGCCAGGACACAGCAACCAGGG + Intergenic
1164822591 19:31261719-31261741 TTTCCTGCTTACAGAAACCGGGG + Intergenic
1164839314 19:31380629-31380651 CAGCCTCCTCTCAGCAACCACGG - Intergenic
1165020376 19:32919537-32919559 TTGCCTGCTACCAGCACCCAGGG + Intronic
1166061419 19:40328016-40328038 TTGCCTCCTCTTAGCAGCCAAGG - Intronic
1166574472 19:43824989-43825011 TTCCCTGTTCACCGCATCCACGG - Intronic
1167227408 19:48255964-48255986 TTGACTGCCCACAGCCATCATGG - Intronic
1168031072 19:53680277-53680299 TTCTCTGCTCACTGCAACCTCGG + Intergenic
1168716570 19:58531966-58531988 TTCCCTGCTAATAGGAACCAGGG - Intronic
927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG + Intergenic
927673448 2:25088447-25088469 TTGCTTGGCCACAGCGACCAAGG - Intronic
927880635 2:26687755-26687777 GCTCCTGCTCACAGCAGCCATGG - Intergenic
930243040 2:48955825-48955847 ATGCATGCTCAGTGCAACCAGGG - Intergenic
930418317 2:51118002-51118024 TTACCTGATCACAGAAAACAGGG + Intergenic
930826412 2:55700606-55700628 TTGCCTTCCCACAGCACCTAAGG + Intergenic
931625218 2:64251142-64251164 TTACCATCTCATAGCAACCAAGG - Intergenic
932340993 2:70962597-70962619 CTGCCTACTCCCAGGAACCATGG + Intronic
933205507 2:79502998-79503020 GTGCCTGCACACAGCAAGGATGG - Intronic
933812824 2:86043819-86043841 TTTCCTCCTCACTGCAACCCAGG - Intronic
934723015 2:96595075-96595097 TTGCCTTCACTCAGCAGCCACGG - Exonic
935087448 2:99861976-99861998 TTCCCTGCTCTCCTCAACCAGGG + Intronic
936084258 2:109455856-109455878 CTGCATGCTCCCACCAACCAGGG + Intronic
937597331 2:123687345-123687367 TTGCCTCCTGACTGCGACCACGG + Intergenic
937830181 2:126411407-126411429 TTCCCAGCTCTGAGCAACCATGG + Intergenic
937997625 2:127706885-127706907 CTGCCTGCTCCCAGCCACCAGGG + Intronic
942195678 2:173517055-173517077 TTGCCTCCGAACAGAAACCAAGG - Intergenic
943506299 2:188763384-188763406 TTTCCTTCTCCCAGCAACCATGG - Intronic
943729167 2:191283754-191283776 TTTGATGCTCACAGCAACCATGG - Intronic
948433325 2:237934576-237934598 TTTTCTGCTCAGAGCACCCATGG + Intergenic
1168971793 20:1936387-1936409 TTCCATCCTCACAGCAACCCTGG + Intronic
1169425283 20:5491984-5492006 TTCTCTCCTCACATCAACCAGGG + Intergenic
1173061835 20:39669920-39669942 CTGCCTGTTAGCAGCAACCATGG + Intergenic
1173557057 20:43973766-43973788 TTGCCACCACACAGCACCCACGG + Intronic
1175802106 20:61806739-61806761 ATGTCTGCTCACAGCAGCCGTGG - Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1179519175 21:41931198-41931220 GAGCCTGCTCACAGCAGCCGTGG + Intronic
1180730003 22:17974058-17974080 TTGGCAGCTCACATAAACCATGG - Intronic
1181961623 22:26625853-26625875 CTCTCTGCTCACAGCAACCCTGG + Intronic
1182902633 22:33911051-33911073 TTTCATTCTCACAGCAACCCTGG - Intronic
1183937727 22:41273171-41273193 TTGCCTGCTCACAGCAACCAGGG - Intronic
1184567200 22:45299156-45299178 CAGCCTGCTCACAGCCAACAGGG + Intergenic
1185062959 22:48616596-48616618 TTGCCTGCGCATGGAAACCAGGG + Intronic
949454609 3:4225354-4225376 TTGCTTGCTCAAAACAACCTGGG - Intronic
949838915 3:8299534-8299556 TTTCATCCTCACAGCAACCTAGG + Intergenic
949851619 3:8426384-8426406 TTGAATCCTCACAGCAGCCAGGG - Intergenic
950728731 3:14937424-14937446 TTCCCTGTTCACAGCCACCAAGG + Intergenic
953487230 3:43312452-43312474 TTGCCTGCTCTAAGTAAACAAGG + Intronic
953749568 3:45598907-45598929 TTGACTGGTCACAGCATCCTTGG + Intronic
954433386 3:50483264-50483286 TTGCATGCACACAGGAACCAAGG + Intronic
954684525 3:52363186-52363208 CTGCCTGCTCCCAGCCTCCAGGG + Intronic
954706714 3:52484873-52484895 CTGCCTGTTCCCATCAACCAAGG - Intronic
955739146 3:62071362-62071384 TTCCATGATCACAGCAACCAGGG + Intronic
956439827 3:69269352-69269374 TTACCTCCTCACAGGACCCATGG - Intronic
956970510 3:74517811-74517833 TTGCCTGGTGACAGCAACAGAGG - Intronic
958646644 3:96883058-96883080 TTCCCTGTTCACTGCATCCATGG + Intronic
960376055 3:116902949-116902971 TTGGATGCTCACAGCCCCCAGGG - Intronic
966498164 3:180604246-180604268 GTGCCTTCTCACAGTAACCATGG + Exonic
966647848 3:182267033-182267055 TGGCTTGGTCTCAGCAACCATGG - Intergenic
967046965 3:185746317-185746339 CTAACTGCTCACAGCGACCATGG + Intronic
968206300 3:196804209-196804231 TTGCATCCTCACAGAAACAAAGG + Intronic
969358245 4:6644155-6644177 ATGCCTGGTCCCAGCTACCAGGG - Intergenic
969435875 4:7189104-7189126 CTGCCAGCTCCCAGCCACCATGG + Intergenic
971837945 4:31793547-31793569 TTGCCTTCTTGCAGTAACCAAGG - Intergenic
973035643 4:45402937-45402959 TTGCTTTCTCACAGCAACTGGGG - Intergenic
973585331 4:52384652-52384674 TTGCCTGTTCACAGCCCCAAGGG + Intergenic
973632002 4:52828058-52828080 ATGTCTGCTCACTGCAACCTCGG - Intergenic
974546282 4:63311865-63311887 TTCTCTGCTCTCAGCAATCATGG - Intergenic
977736357 4:100421145-100421167 TTTCCTGATCACAGAAACAAAGG - Intronic
980996446 4:139784159-139784181 TTGACTGCTCTCATCAACAAAGG - Intronic
984032285 4:174618978-174619000 TTGCCTGCTATCAGCAGCGAAGG - Intergenic
985731041 5:1549083-1549105 CTGCCTGCTCAAGGCAACCGTGG - Intergenic
986906504 5:12500403-12500425 TTTCATCCTCACAGCAACCCTGG - Intergenic
993536066 5:89087844-89087866 CTCCCTGCTGTCAGCAACCAAGG - Intergenic
995623561 5:114054039-114054061 GTGCTTGCTTACAGAAACCAAGG - Intergenic
996574261 5:124964231-124964253 TTGTGTGCTAACTGCAACCAAGG - Intergenic
997680552 5:135747556-135747578 TTGTCTGCTAAAAGTAACCAAGG - Intergenic
1001156244 5:169274750-169274772 TTCCTTGCTCATAGCACCCAGGG + Intronic
1001170372 5:169413844-169413866 TTGCCTTCTCAATACAACCATGG - Intergenic
1005135714 6:22568425-22568447 GTGCTTGCTCACAGCTAGCAAGG + Intergenic
1006076296 6:31534757-31534779 TTGCCGGCTCACATCAACCGAGG + Intronic
1006407841 6:33855625-33855647 TAACCTGCGCACAGGAACCAAGG + Intergenic
1006707021 6:36028671-36028693 TTGTCTGCTCAGAGGACCCAGGG - Intronic
1009501896 6:64424398-64424420 TTGCATGCTCACAATAACCTGGG - Intronic
1011753862 6:90479450-90479472 TTGCCTGCTCACAGCAGTGACGG - Intergenic
1012889691 6:104884367-104884389 TTACCTGCTGGCAGCAACCCTGG + Intergenic
1013479932 6:110544499-110544521 GTGTCAGCTCTCAGCAACCAGGG - Intergenic
1014102468 6:117527116-117527138 TTGCATCCTCAAAGCAAACAAGG + Intronic
1014631082 6:123790470-123790492 ATTCCAGCTCACAGCAACAAAGG + Intergenic
1016291484 6:142533124-142533146 TAGCATGCACACAGCAACTAAGG + Intergenic
1016776859 6:147913969-147913991 TTCCTTGCTCAAAGGAACCAGGG + Intergenic
1019713021 7:2525960-2525982 TGACCTGCTCAGAGCAGCCAGGG + Intronic
1020133085 7:5570397-5570419 TTCGGTGCTCACAGCCACCATGG - Intergenic
1022017370 7:26362935-26362957 TTCTCTGCTCACAACCACCATGG - Intronic
1022183821 7:27947812-27947834 CTGGCTGCTCACAGCACCCTTGG + Intronic
1022631433 7:32088913-32088935 TTGCCTGCTGAGAGCAAGAAGGG - Intronic
1022993130 7:35727728-35727750 TTCCCTGAGCACAGGAACCAGGG + Intergenic
1023283183 7:38592352-38592374 TTCCCTCTTCACAGCTACCATGG + Intronic
1023300670 7:38767189-38767211 TTGTCTTCTGCCAGCAACCAGGG + Intronic
1023869972 7:44257904-44257926 CTGCACGCTCACAGCAGCCATGG + Intronic
1026128564 7:67601214-67601236 TCGCCTGCTCACAGGTAGCAAGG + Intergenic
1026547138 7:71333169-71333191 TTCCCTACTGAAAGCAACCATGG + Intronic
1026741941 7:72984336-72984358 ATCTCTGCTCACAGCAACCTCGG - Intergenic
1026801785 7:73404761-73404783 ATCTCTGCTCACAGCAACCTCGG - Intergenic
1027101794 7:75380741-75380763 ATCTCTGCTCACAGCAACCTCGG + Intergenic
1029678691 7:102092299-102092321 TGCCCTGTTCACAGCTACCACGG + Intronic
1031834822 7:126669658-126669680 TTGTGTGCTAACTGCAACCAAGG - Intronic
1032474880 7:132204869-132204891 TTGCCCTCATACAGCAACCACGG + Intronic
1034501372 7:151453016-151453038 TTGGCTAGTCCCAGCAACCAGGG + Intergenic
1036034447 8:5003932-5003954 TTTCCAGCACACAGCAACCCTGG - Intergenic
1036207321 8:6814918-6814940 TTTCTTGCTCACAGCAGCCGGGG - Intronic
1036627695 8:10485055-10485077 ATGCCTGCACACAGCTGCCATGG - Intergenic
1037926351 8:22846708-22846730 TTCCCTGCCCACATCTACCATGG + Intronic
1038712265 8:29958568-29958590 TTGCCTCATCAGAGCAAACATGG - Intergenic
1039676372 8:39672490-39672512 TTGGCTGCTCACAGAACACAGGG - Intronic
1040843887 8:51814903-51814925 TTCCCTGATCACCGCATCCATGG - Intergenic
1042869703 8:73387047-73387069 TTGCCTCCTCTGAGCAACCTTGG - Intergenic
1043389113 8:79774419-79774441 TTGAATTCTCACAGCAACCCAGG + Intergenic
1047421469 8:124711322-124711344 CTGCATGCTCACAGCAGCCCAGG + Intronic
1049299855 8:141863743-141863765 TTGCCTGCTCACTGCAAAGTGGG + Intergenic
1050100004 9:2108984-2109006 TTCCCTGCATACAGCAAACAGGG - Intronic
1051197312 9:14576943-14576965 GTGCCTGCTCACATCATTCATGG + Intergenic
1053030918 9:34777315-34777337 ATGCCAGCACACACCAACCAGGG - Intergenic
1056028418 9:82525348-82525370 TTGCCTGCTGACAGCTCACAGGG + Intergenic
1057172906 9:92974599-92974621 CTGCCTGCTCAAGGCAACCAGGG + Intronic
1060175954 9:121497896-121497918 ATGGCTGCTCAGAGCCACCATGG + Intergenic
1061234377 9:129334153-129334175 ATGCCTGCTGCCAGCACCCAGGG + Intergenic
1061313224 9:129777497-129777519 TTGGCTTCTCGCAGCAAACAGGG - Intergenic
1061958306 9:133975059-133975081 TTTCCTGCTGACGCCAACCAAGG + Intronic
1062379174 9:136278546-136278568 TTGCATCCTCACAGCTACCAGGG - Intergenic
1186685459 X:11920635-11920657 TTTGCTTCTCACAGCAACCCTGG + Intergenic
1186894595 X:13993188-13993210 GTGGTTGCTCACAGCATCCATGG + Intergenic
1193480566 X:82022643-82022665 TTGCCTGATCATTGAAACCAAGG - Intergenic
1194164254 X:90495413-90495435 TTGCTTCCTCAAAGCAACAATGG - Intergenic
1194885068 X:99304597-99304619 TTGCCTACTCACTGCAACAGAGG - Intergenic
1195784314 X:108502144-108502166 TTGCCTGCTACCAGCTACCCTGG - Intronic
1199640048 X:149851044-149851066 TTCCCTGATCACCGCATCCACGG - Intergenic
1199699449 X:150364890-150364912 TCGCCGGCTCACCGCAACCAGGG - Intronic