ID: 1183937889

View in Genome Browser
Species Human (GRCh38)
Location 22:41274306-41274328
Sequence CAGAGCTGTCACATGTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183937889_1183937892 15 Left 1183937889 22:41274306-41274328 CCACCTCACATGTGACAGCTCTG 0: 1
1: 0
2: 0
3: 15
4: 199
Right 1183937892 22:41274344-41274366 CTCCCTACTTTGTCTTTCACAGG 0: 1
1: 0
2: 0
3: 22
4: 202
1183937889_1183937891 -10 Left 1183937889 22:41274306-41274328 CCACCTCACATGTGACAGCTCTG 0: 1
1: 0
2: 0
3: 15
4: 199
Right 1183937891 22:41274319-41274341 GACAGCTCTGCATTATGAGAAGG 0: 1
1: 0
2: 0
3: 19
4: 526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183937889 Original CRISPR CAGAGCTGTCACATGTGAGG TGG (reversed) Intronic
900142102 1:1143021-1143043 CAGAGCTGCCACGTGAGAAGAGG - Intergenic
900754616 1:4424973-4424995 CACAGCTGTCACAAGCTAGGAGG + Intergenic
907901904 1:58748714-58748736 CAGAGTTGTCAAATCTGAAGGGG - Intergenic
908786173 1:67736637-67736659 CAGAGGTGTGCCCTGTGAGGGGG - Intronic
912059094 1:105641965-105641987 CAGAGCAGTCACAGTGGAGGTGG + Intergenic
912478857 1:109962187-109962209 CAGAACTGTCAGGTGTGTGGTGG - Intergenic
913569102 1:120102584-120102606 CAGAGCAGTCAGTTGTGTGGGGG + Intergenic
914289911 1:146263575-146263597 CAGAGCAGTCAGTTGTGTGGGGG + Intergenic
914550954 1:148714358-148714380 CAGAGCAGTCAGTTGTGTGGGGG + Intergenic
914804457 1:150982356-150982378 CAGAGGTGCCAGAGGTGAGGTGG - Exonic
922004834 1:221519706-221519728 CAGAGCTATCACAAGTGATTTGG - Intergenic
922587532 1:226746185-226746207 CAGAGTCTCCACATGTGAGGAGG - Intergenic
923621378 1:235582198-235582220 CGGAGTTGTCAGAGGTGAGGAGG - Intronic
924142687 1:241042143-241042165 GAACGCTGTCACATGTGTGGGGG + Intronic
924633260 1:245762253-245762275 CACAGCTGTCACCTGTCATGGGG + Intronic
1062859488 10:799328-799350 CAGTGTTGTTACATGTGAGATGG - Intergenic
1064927524 10:20585501-20585523 CAGAGCTGTCCTAGTTGAGGAGG + Intergenic
1067407155 10:46033603-46033625 CAGAGCTGGCACTGGGGAGGGGG - Intronic
1067536494 10:47114401-47114423 CAGAGCTGTCACATGGTTGAAGG + Intergenic
1067563116 10:47317703-47317725 CAGAGCTGTCCCAGGGGTGGGGG + Intergenic
1068752580 10:60612230-60612252 CAGAGCTCTCACATCTGAAATGG + Intronic
1070591740 10:77806676-77806698 TGGAGCTGTCCCATGGGAGGGGG - Intronic
1070740383 10:78899325-78899347 CAGAAGTGTGACATATGAGGAGG + Intergenic
1071739946 10:88346800-88346822 CAGATGTGTCACATGTGTGATGG + Intronic
1072924936 10:99608905-99608927 AAGGGCTGTCAGATGGGAGGAGG + Intergenic
1073052555 10:100677486-100677508 CAGAGGTGACACATGTGTGAGGG - Intergenic
1076787971 10:132760493-132760515 CAGAGCTTTCACAGCTGTGGGGG - Intronic
1077174943 11:1184813-1184835 AGGAGCTGTCACAGGTGTGGAGG - Intronic
1077175510 11:1188131-1188153 AGGAGCTGTCACAGGTGTGGAGG - Intronic
1077175901 11:1190324-1190346 AGGAGCTGTCACAGGTGTGGAGG - Intronic
1079145883 11:17851485-17851507 CAGAGCAGCCTCATGTGCGGGGG - Intronic
1079349453 11:19680171-19680193 CAGAGCTATCTTTTGTGAGGAGG - Intronic
1081426682 11:42933335-42933357 CAGAGATGACACATCTGAGATGG + Intergenic
1082940556 11:58700954-58700976 TGGAGCTGTCACTTGTGATGTGG + Intronic
1084782001 11:71416072-71416094 CAGTGCTGTCACATCTGTAGGGG + Intergenic
1086171010 11:83836485-83836507 CAGAGCTTCCAAATGTGAAGAGG - Intronic
1087500556 11:98947164-98947186 CAGAGCTGAGAAATGTGATGTGG + Intergenic
1087677819 11:101182639-101182661 CACAGATGTCACATGTGGTGTGG - Intergenic
1089084647 11:115806777-115806799 CAGACCTTACACATGTGGGGTGG + Intergenic
1090176964 11:124658749-124658771 CAGAGAAGTCACATGGAAGGAGG + Intronic
1091314479 11:134603162-134603184 CAGAGCTGATACATTTGAGTAGG + Intergenic
1094347876 12:29490844-29490866 TAGAGCTGTGACAGATGAGGAGG - Intronic
1096592643 12:52671449-52671471 AACAGCTGTCATAGGTGAGGAGG - Intergenic
1098312172 12:69159030-69159052 CTGAGCTGGCCCAGGTGAGGTGG - Intergenic
1098840127 12:75467851-75467873 GAGTGCTGTTACATGTGAGACGG - Intergenic
1103357362 12:120331632-120331654 CAGGGCTGCCCCATGGGAGGTGG + Intergenic
1103400577 12:120640674-120640696 CTGCGCTGTCACATGGGCGGCGG + Exonic
1103724468 12:122990869-122990891 CAGAGCTTTAGCAGGTGAGGAGG + Intronic
1104075664 12:125387498-125387520 CAGACCTGTGACATGTGAAGTGG - Intronic
1106671072 13:31906047-31906069 CAGAGCTGCCAAATTTGAGCAGG - Intergenic
1107593152 13:41930182-41930204 CCGTGCTAACACATGTGAGGTGG - Intronic
1110945044 13:81403376-81403398 CCTACCTGTCACATGTAAGGAGG - Intergenic
1113260106 13:108552306-108552328 CAGAGCTGTCAACTTGGAGGTGG + Intergenic
1113789974 13:113023102-113023124 CTGAGCTGTCCCAGGTGAAGGGG + Intronic
1114419145 14:22565743-22565765 GAGATCTGTAACTTGTGAGGTGG + Intronic
1115574414 14:34696553-34696575 CAGAGATGTCACATATAATGGGG - Intergenic
1116754067 14:48923911-48923933 TAGTGCTGGTACATGTGAGGAGG + Intergenic
1118281345 14:64431540-64431562 CATGGATGTCACCTGTGAGGTGG - Exonic
1118861275 14:69665597-69665619 CATAGCTGTCTCTTATGAGGTGG + Intronic
1119612434 14:76074896-76074918 GAGAGCTGTCACAGCTTAGGGGG + Intronic
1122325491 14:100878950-100878972 CAGAGCTCTCACCTGTGGAGGGG + Intergenic
1122597801 14:102905195-102905217 CAGGCCTGCCACAGGTGAGGAGG - Exonic
1123068050 14:105628045-105628067 CAGAGCAGCCACAGGGGAGGAGG - Intergenic
1123068074 14:105628124-105628146 CAGAGCAGCCACAGGTGAGCAGG - Intergenic
1123071979 14:105646458-105646480 CAGAGCAGCCACAGGTGAGCAGG - Intergenic
1123072025 14:105646666-105646688 CAGAGCAGCCACAGGTGAGCAGG - Intergenic
1123091936 14:105745801-105745823 CAGAGCAGCCACAGGTGAGCAGG - Intergenic
1123097393 14:105773005-105773027 CAGAGCAGCCACAGGTGAGCAGG - Intergenic
1123097693 14:105774201-105774223 CAGAGCAGCCACAGGTGAGGAGG - Intergenic
1126348628 15:47721598-47721620 CAGTGTTGTCAGGTGTGAGGAGG - Intronic
1126685502 15:51245873-51245895 CAGCTCTGTCACATATGAGCTGG - Intronic
1126732501 15:51698667-51698689 CAGAGCTGTGAGATGGGATGAGG - Intronic
1128087934 15:64898564-64898586 CAGAGCTGTGACCTGCAAGGAGG + Intronic
1128763626 15:70236887-70236909 CAGGCCTCACACATGTGAGGAGG - Intergenic
1129788923 15:78327800-78327822 CAGAGCTGGGACTTGTGAGTGGG - Intergenic
1129979042 15:79849446-79849468 CTGAGCTGTCACCTTTGAGGAGG - Intronic
1132211624 15:100027996-100028018 CAGAGAAGTCACATGACAGGAGG + Intronic
1133068826 16:3231851-3231873 CAGTTCTGTCACCTGTAAGGTGG + Intronic
1133835685 16:9365479-9365501 CAGCACTGTCACATGGAAGGTGG - Intergenic
1137385227 16:48035720-48035742 TAGAGGTGTCTCATGTGAGAAGG - Intergenic
1137675762 16:50303160-50303182 CAGAGTTGTCACAATGGAGGAGG + Intronic
1138309439 16:56010929-56010951 CTCAGCTGACACAGGTGAGGAGG - Intergenic
1139448203 16:67011594-67011616 CAGAGCTGCCACATCTCTGGTGG - Intergenic
1140456663 16:75109720-75109742 CAGATATTTCACATGTGAAGCGG + Exonic
1148249805 17:46066689-46066711 CAGAGCTGTCACCTGGAATGTGG + Exonic
1148344712 17:46895425-46895447 CACAGCTCTCACCCGTGAGGTGG + Intergenic
1148909643 17:50934317-50934339 CAAATCTCTCACAGGTGAGGTGG - Intergenic
1149589353 17:57817107-57817129 CAGAGCTGGAACAGGTGAAGAGG - Intergenic
1152844410 17:82591055-82591077 CAGTGCTGACAGATGGGAGGTGG + Intronic
1155541276 18:26870928-26870950 CAGAGCTGGCATGTGAGAGGAGG - Intergenic
1155962218 18:32004195-32004217 CATATGTGTCAAATGTGAGGAGG - Intergenic
1156906355 18:42357138-42357160 GGGAGCTATTACATGTGAGGAGG + Intergenic
1157687798 18:49656835-49656857 CATGGCTGTCACTTGTGATGAGG + Intergenic
1158445022 18:57511988-57512010 CAGAGCTTTCCCATGAGAAGGGG - Intergenic
1165699069 19:37923388-37923410 CAGGGCAGTCACATGTGTGTAGG - Intronic
926053309 2:9758223-9758245 CAGAGCTGGTTCATGGGAGGGGG + Intergenic
927255119 2:21034501-21034523 CAGAGCTGTCCCAGACGAGGTGG - Intronic
927314956 2:21671056-21671078 AAGGGCTGTCACATGTAAGAGGG + Intergenic
930216936 2:48707302-48707324 CAGAGCTCTCCTGTGTGAGGTGG + Intronic
932838942 2:75063653-75063675 CAGAGCTGACACCAGTAAGGAGG - Intronic
932900101 2:75687672-75687694 AACAGCTGTCAAATGTAAGGTGG - Intronic
934551774 2:95267217-95267239 AAGAGCTGTTTCCTGTGAGGGGG + Intergenic
936041336 2:109152202-109152224 CAAAACTGTCACCTGTCAGGTGG + Intronic
937333457 2:121046077-121046099 CTGAGCACACACATGTGAGGTGG + Intergenic
938615522 2:132993749-132993771 CAGAGGTGTGACATTTAAGGTGG - Intronic
938985873 2:136575783-136575805 CTGAGGTGGCCCATGTGAGGGGG + Intergenic
940492845 2:154386954-154386976 CAGAGCTGTCACACAGGAAGAGG - Intronic
940909217 2:159195784-159195806 CAGAGCTTTCAGCTGTGATGGGG - Intronic
940985724 2:160050216-160050238 AACTGATGTCACATGTGAGGTGG + Intronic
941586074 2:167361320-167361342 TGGAGGTGTCACATGTGATGGGG + Intergenic
942141686 2:172983806-172983828 CAGAGCAGCCCCATGTGAGTAGG + Intronic
942422177 2:175819731-175819753 CAAAACTGTCGCAGGTGAGGTGG - Intergenic
944844684 2:203656956-203656978 CAGAGCTGTCTCATGTGTTTGGG - Intergenic
946148644 2:217749357-217749379 CAGATCTGACATATGTGCGGTGG + Intronic
946400318 2:219465134-219465156 CACAGCTGTGACGTGTGAAGAGG + Intronic
947140121 2:227012945-227012967 CAGAGCAGTCACATGTGGAGAGG + Intronic
947484379 2:230534645-230534667 AAGCGTTGTCACATCTGAGGTGG + Intronic
948685998 2:239670098-239670120 CAAAGCTGCCACAGGTGAGGAGG + Intergenic
948691802 2:239711014-239711036 CAGAGCAGTCACAATGGAGGAGG - Intergenic
948927241 2:241107190-241107212 CTGACCTGTCACCTGTGAGAGGG - Intronic
1168730054 20:69260-69282 CAGAGATGACACATGTTTGGAGG + Intergenic
1169196684 20:3686903-3686925 CAGAGGAGTCACATGTTAGTGGG - Intergenic
1170950475 20:20931500-20931522 CAGATCTGTGACGGGTGAGGAGG - Intergenic
1172191193 20:33062901-33062923 GAGGGCTGTCACATGTCAAGTGG - Intronic
1172623416 20:36334145-36334167 CAGGGCTCTCACATGAGAGGTGG + Intronic
1173152649 20:40581057-40581079 CTGAGGGGTCACATTTGAGGGGG - Intergenic
1174522880 20:51145331-51145353 CAGAGCAGTAAAATATGAGGAGG - Intergenic
1174724714 20:52849442-52849464 GAGAACTGTCACATGAGAAGAGG + Intergenic
1177358968 21:20045013-20045035 CTTTGCTGTCACATGTGTGGGGG + Intergenic
1178285534 21:31322530-31322552 CAGGGCTGTCACAGGCGAGCAGG - Intronic
1179493551 21:41757023-41757045 CAGGGTTATCACAAGTGAGGAGG + Intronic
1179813141 21:43884926-43884948 CCGATCTATCCCATGTGAGGTGG - Intronic
1180984613 22:19897054-19897076 CAGAGCCTTCAGATGTGGGGAGG - Intronic
1181502421 22:23324401-23324423 CAGAGAAATCACATCTGAGGAGG - Intergenic
1181623726 22:24108059-24108081 CAGGGCTGTCACTTGTGTGCAGG + Intronic
1183937889 22:41274306-41274328 CAGAGCTGTCACATGTGAGGTGG - Intronic
1184461243 22:44639451-44639473 CAGAGATGCCACATGGAAGGAGG + Intergenic
950263558 3:11559295-11559317 CACAGCTGTGACAGGTGAGGAGG + Intronic
952613163 3:35235787-35235809 CAGAGATTTAACATGTGAGAAGG - Intergenic
954194646 3:48989503-48989525 CAAAGCTGGCACGTGTGAAGAGG - Intergenic
955718322 3:61854694-61854716 AAGAGCAGTCTCATGTGAGTGGG + Intronic
957913893 3:86661114-86661136 CAGAGATCTCACAGATGAGGTGG - Intergenic
959442850 3:106399931-106399953 CAGAGCTGAAGCCTGTGAGGCGG + Intergenic
960952872 3:123011094-123011116 CTCAGCTGTTACATGAGAGGAGG - Intronic
962273880 3:133997895-133997917 CAGTATTCTCACATGTGAGGTGG + Intronic
964134581 3:153330232-153330254 CAGATCTGTGGCCTGTGAGGGGG - Intergenic
964413556 3:156424280-156424302 CAGAGCTGGCATGTGTGAAGGGG + Intronic
964545010 3:157824638-157824660 TAAATCTGGCACATGTGAGGTGG - Intergenic
967819292 3:193826258-193826280 CAGAGCTGTCCCAGGTGGAGTGG - Intergenic
968533217 4:1106775-1106797 CTAAGCTGCCACATGTGTGGAGG + Intronic
969704720 4:8785480-8785502 CACTGCTGTCACCTGTGGGGAGG + Intergenic
972783430 4:42305816-42305838 CAGAGGTGTCACATGAAAGAAGG + Intergenic
976613214 4:87050810-87050832 CAGAGTTGCCACATCAGAGGTGG + Intronic
982468519 4:155759528-155759550 CGGAGCGGTGACAGGTGAGGAGG + Intronic
983557527 4:169071688-169071710 CAGAGCTTTCACATGGAAGATGG - Intergenic
984171579 4:176366387-176366409 GAGTGTTGTCACATGTGAGGTGG + Intergenic
985196873 4:187440599-187440621 AAGAGCTCTCAGATGTAAGGGGG + Intergenic
985758403 5:1732705-1732727 CAGGGCAGTCACATGAGGGGCGG + Intergenic
986767671 5:10942228-10942250 AAGAGCTGCCACCTGTAAGGTGG - Intergenic
986776569 5:11020029-11020051 TAGAGCTGTCACATCAGGGGTGG + Intronic
988331986 5:29853438-29853460 CAGAGCTGTGAGATGTGTGATGG + Intergenic
990588307 5:57234686-57234708 AAGAGCTTTCACGTGTGAGATGG + Intronic
993595550 5:89850307-89850329 CAGAGCAGTCACATGACAGATGG + Intergenic
997219396 5:132147839-132147861 TAGAGCTTGCAGATGTGAGGAGG - Intergenic
997304813 5:132829613-132829635 CAGAGAGGTCAGATGTGAGGTGG - Intronic
998351887 5:141507488-141507510 CAGAGCTGTCCCAGGTCTGGTGG + Intronic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
1000139041 5:158383401-158383423 AAAAGGTGTCACATGTAAGGTGG + Intergenic
1002025825 5:176395680-176395702 CAAACCTGAAACATGTGAGGGGG + Intronic
1002133138 5:177093348-177093370 TCAGGCTGTCACATGTGAGGTGG - Intronic
1002709242 5:181184268-181184290 CCGAGCGGTCACGTGTGCGGCGG + Intergenic
1003121369 6:3321608-3321630 CAGGGCTGACCCATGTGAGAAGG - Intronic
1004505980 6:16246948-16246970 CCGTGATGTCACAGGTGAGGCGG + Exonic
1006283815 6:33078077-33078099 CAGAGCTGTCATGTGGGATGAGG + Intronic
1007071991 6:39044779-39044801 CAGATCTTTCACTTGAGAGGAGG - Intergenic
1008313685 6:50011686-50011708 CAGAGATGTTATTTGTGAGGAGG - Intronic
1008699865 6:54086107-54086129 CAGAGGTGGTAAATGTGAGGAGG - Intronic
1009445680 6:63739462-63739484 TAAAGCTGTCACTGGTGAGGTGG + Intronic
1018987014 6:168645597-168645619 CCGGGCTGTCACATGTGGGTTGG - Intronic
1027239080 7:76315538-76315560 CAGAACTGGCACATTTTAGGAGG + Intergenic
1030152485 7:106421041-106421063 CAGAGATGTTCCATGTGAGCTGG - Intergenic
1030685631 7:112484496-112484518 CAGAACTGAGACATCTGAGGAGG + Intronic
1031900378 7:127402628-127402650 CACAGGAGTCACATCTGAGGTGG - Intronic
1034528269 7:151679619-151679641 CAGGGCTGTCACAGGTCATGAGG - Intronic
1034640315 7:152597028-152597050 CAAGACTGTCACATGTGAGAAGG + Intergenic
1035726539 8:1827861-1827883 CAGAGCTGTGACTGGTGCGGGGG + Intronic
1036236194 8:7041735-7041757 CAGAGGTCTCACAAGGGAGGGGG + Intergenic
1036591928 8:10176307-10176329 CAGAGCTGGCATCTCTGAGGAGG - Intronic
1037787575 8:21911892-21911914 CAGCGCAGTCACAGGTGAGGGGG - Exonic
1040535507 8:48305630-48305652 CAGAGCAGTCACATGAGAGCTGG - Intergenic
1041697013 8:60746336-60746358 CTGTGTTGCCACATGTGAGGAGG + Intronic
1044387047 8:91601542-91601564 CAGAGAGGGCACATGTTAGGGGG + Intergenic
1048044313 8:130758966-130758988 CTGAGCTGTCACATTAGAGGAGG - Intergenic
1048169454 8:132091742-132091764 CAGTGTTGGCACATGTGAGTGGG + Intronic
1049698587 8:143995910-143995932 TAGAGCTGTCAGCTGTGAAGAGG - Intronic
1056615720 9:88163971-88163993 CAGAGCTGCCTCAGGTGAGCAGG - Intergenic
1057225078 9:93288914-93288936 CAGAGCAGTCACAGGAGGGGAGG - Exonic
1059326581 9:113507473-113507495 CAGAGCTGTCACATACCAGGTGG - Exonic
1059618316 9:115975504-115975526 CACAGCTGTACCATGAGAGGTGG + Intergenic
1059945153 9:119402067-119402089 CAGAGCTGGCACACAGGAGGTGG + Intergenic
1186182552 X:6987051-6987073 CAGAGCAGTCACCTCTGATGTGG + Intergenic
1186189478 X:7054706-7054728 CAAAGCGGCCACATGAGAGGAGG - Intronic
1186678892 X:11851082-11851104 CAGAACTGGCACAGGTGGGGTGG + Intergenic
1187056033 X:15742213-15742235 CAGAGATGTCACAGTGGAGGTGG - Intronic
1188725777 X:33580302-33580324 TAGAGCTGTCACAGCTGAAGTGG - Intergenic
1189130432 X:38492520-38492542 CAGAGCTGACACATGAGATTTGG - Intronic
1190277973 X:48911509-48911531 CCGAGCAGTCGCATGGGAGGCGG - Intronic
1194864771 X:99052806-99052828 CAGAGTTCCCACATGTGAGAGGG + Intergenic
1195203031 X:102567633-102567655 GAGACCTGACACATGTTAGGGGG + Intergenic
1196196339 X:112841381-112841403 CAGAGCTGTGACCTGGGTGGGGG - Intergenic
1197453200 X:126643380-126643402 CAGTGTTGTCACATGTGACATGG + Intergenic
1197631811 X:128869560-128869582 AAGAGCTGTCACATGGAAGAGGG - Intergenic
1198064985 X:133087423-133087445 AAGAGCTGGCTCATATGAGGTGG + Intronic
1198262183 X:134974635-134974657 TAGAGCTGTGGCATGTGAGGAGG + Intergenic
1200072120 X:153534383-153534405 CGAAGCTGTCCCAGGTGAGGCGG - Intronic