ID: 1183955233

View in Genome Browser
Species Human (GRCh38)
Location 22:41376097-41376119
Sequence CTGGCCAAAGGCTCCTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183955230_1183955233 0 Left 1183955230 22:41376074-41376096 CCAAAGAGATCATTATAGGGTAT 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1183955233 22:41376097-41376119 CTGGCCAAAGGCTCCTGTGTTGG 0: 1
1: 0
2: 4
3: 23
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183955233 Original CRISPR CTGGCCAAAGGCTCCTGTGT TGG Intronic
900476071 1:2876963-2876985 CTGGCCACGGCCTCGTGTGTGGG + Intergenic
900605390 1:3521449-3521471 CTGGCCAAGGGCTGCCCTGTGGG - Intronic
901624017 1:10613351-10613373 CTGCGCAAAGGCTCCAGTTTGGG - Intronic
901655935 1:10769288-10769310 GTGGCCAGTGGCTGCTGTGTGGG - Intronic
901732593 1:11290988-11291010 CAGGTCAAAGGCTCAGGTGTTGG - Intronic
903719262 1:25392284-25392306 CTGGGCAAAGCCTGCTGGGTTGG - Intronic
904466056 1:30708122-30708144 CTTCCCAAAGGCTCCTGAGTGGG - Intergenic
907214730 1:52852474-52852496 CTGCCTCAAGGCTCCTGAGTAGG + Intronic
907289383 1:53403072-53403094 CTGGCCCAGGGCTCCTGGGCTGG - Intergenic
907917534 1:58884768-58884790 CTGGCCAATGCCTCCTGTAAAGG - Intergenic
914802803 1:150973469-150973491 CTGGCCAGAGGCCCCAGTGAGGG + Intronic
917509158 1:175655952-175655974 CTGTCCACAGGCTCAAGTGTAGG + Intronic
919168706 1:193927540-193927562 CTGGCCCATGGCTCCTGGGCTGG + Intergenic
920305134 1:205013892-205013914 CTGCAGACAGGCTCCTGTGTGGG - Intronic
923103663 1:230837653-230837675 GAGGACACAGGCTCCTGTGTGGG - Exonic
923223248 1:231915409-231915431 CTGGCCAAAGACCCATGAGTGGG - Intronic
924331681 1:242946277-242946299 CTGGGGAAAGGCTGCCGTGTGGG - Intergenic
1065101252 10:22335129-22335151 CTGGGCAAAGGCTCGCGTCTCGG + Intergenic
1065117793 10:22499078-22499100 CTGGCCACAAGATTCTGTGTAGG - Intergenic
1065186344 10:23173844-23173866 CAGGCCAAAGGCTCATCTGCCGG + Intergenic
1067571747 10:47376762-47376784 TTGGCCACAGGCTCCTCTGTAGG - Intronic
1069160214 10:65083844-65083866 CTGGCCTATGGCTCCTGGGCTGG + Intergenic
1070458701 10:76643530-76643552 CAGACCAAAGGCTCCTGGGAGGG + Intergenic
1075292629 10:121243272-121243294 CAGGCCACAGGCTCCTCTGTCGG + Intergenic
1076438993 10:130466516-130466538 CTGGGTCAAGGCTGCTGTGTGGG + Intergenic
1076505614 10:130970921-130970943 CAGCCCACAGGTTCCTGTGTAGG - Intergenic
1076529090 10:131132752-131132774 GGGGCCAAAGGATGCTGTGTGGG - Intronic
1079543333 11:21602708-21602730 CTGGCCCAAGGCTTTTGTCTTGG - Intergenic
1081569642 11:44281661-44281683 CTGTCCAAACGGTCCTGTGGGGG + Intronic
1081597434 11:44468666-44468688 CTGTCCATTGGCTTCTGTGTTGG - Intergenic
1081960569 11:47133549-47133571 CTGGCCTGAGGCTGCTGTGCTGG + Intronic
1083757043 11:64797283-64797305 CTGGACAGAGGCTCCTCTGCTGG + Exonic
1084497880 11:69515604-69515626 CTGCCCAAAGGCTTCTGGCTGGG + Intergenic
1084948709 11:72653000-72653022 ATCGGCAAAGGCTCCTGTGGTGG + Intronic
1085725959 11:78954905-78954927 CTTGCAAAAGGCTCATCTGTTGG - Intronic
1086818675 11:91406535-91406557 CTGGCCAATGGCTCCAGTGCTGG + Intergenic
1086850267 11:91799913-91799935 CTGGCCCATGGCTCCTGGGCTGG - Intergenic
1087566161 11:99861065-99861087 CTGGCCTCAGCCTCCTGAGTAGG + Intronic
1089114206 11:116081057-116081079 CTGGCCAATGGCTACAGTTTTGG - Intergenic
1090370400 11:126247044-126247066 CTTGCCTCAGCCTCCTGTGTAGG - Intronic
1091766148 12:3120997-3121019 CTGGCCACTGGCTCCTTTGCAGG + Intronic
1093778354 12:23104258-23104280 CTGGCCTCAGCCTCCTGAGTAGG - Intergenic
1095133531 12:38571362-38571384 CTGGTTAAATGCTCCTCTGTGGG - Intergenic
1096407118 12:51351993-51352015 CTGGCCAATGTCTCCTCTGTAGG + Exonic
1096576178 12:52554244-52554266 CTAGCCACTGGCTCCTGTGTTGG + Intergenic
1098374132 12:69795207-69795229 CCTGGCAAAGGCTCCTGCGTAGG - Exonic
1098751187 12:74294242-74294264 CTGGACAGGGGCTCCTGGGTGGG + Intergenic
1102207297 12:111099240-111099262 CTGGCCAAAGGCTCGGAGGTGGG + Intronic
1103476850 12:121224967-121224989 GTGGCCAGAGTCTCCTGTGTTGG - Intronic
1103567053 12:121821968-121821990 CCTGCCTAAGGCTCCTGAGTAGG - Intronic
1104052843 12:125208007-125208029 CTAGCTAATGGCTACTGTGTTGG + Intronic
1104926878 12:132318452-132318474 GTGGCCTGAGGCCCCTGTGTTGG - Intronic
1105439411 13:20402918-20402940 CTGGCCAGGCTCTCCTGTGTTGG + Intergenic
1106016373 13:25872999-25873021 CTGGCCAGTGGCTGCTGTGTTGG + Intronic
1107826107 13:44330371-44330393 CTGACCCAAGGCACCTGTTTGGG - Intergenic
1111091591 13:83453504-83453526 CTGGCCCATGGCTCCTGGGCTGG - Intergenic
1111347907 13:86986512-86986534 CTAACCGAAGGCTGCTGTGTGGG + Intergenic
1112454078 13:99542202-99542224 CTGTTCACAGCCTCCTGTGTGGG + Intronic
1113635261 13:111914954-111914976 CAGGCCAAGGTCTCCTGTCTGGG + Intergenic
1113780785 13:112975948-112975970 CTGGACAAAGGCTCCTGGGGTGG - Intronic
1119279648 14:73394518-73394540 CTGGCCTATGCCTCCTGAGTAGG + Intronic
1122236689 14:100334580-100334602 CCAGCCAAAGGCTCCACTGTGGG + Exonic
1123066472 14:105621853-105621875 ATGGCCCACGGCTCGTGTGTGGG + Intergenic
1123070613 14:105640906-105640928 ATGGCCCACGGCTCCTGTGTGGG + Intergenic
1123075207 14:105664567-105664589 ATGGCCCACGGCTCGTGTGTGGG + Intergenic
1123095640 14:105765855-105765877 ATGGCCCACGGCTCGTGTGTGGG + Intergenic
1123220533 14:106851404-106851426 CTCGGCAAAGACACCTGTGTGGG + Intergenic
1125465097 15:39943175-39943197 CTGGCCAAAGCCTTCTGTCTGGG - Intronic
1126015484 15:44346604-44346626 GTGGCTAAAGGCAACTGTGTTGG + Intronic
1127722483 15:61716574-61716596 ATGGACAAAGGCAGCTGTGTTGG - Intergenic
1127829998 15:62742346-62742368 TTATCCAAAGGCTCCTTTGTAGG - Intronic
1127966544 15:63926889-63926911 CTGGCCAAAAGCTTCCTTGTTGG + Intronic
1127991261 15:64119610-64119632 CTGGCCTCAGCCTCCTGAGTAGG - Intronic
1130342278 15:83009913-83009935 CTGGCCAATGTCTCCAGTTTTGG + Intronic
1131046272 15:89318493-89318515 CTGGCCATGTGCTCCTATGTGGG - Intronic
1131220740 15:90581996-90582018 CTGGCCAAAGGCACCCTTGGAGG - Intronic
1132219536 15:100094966-100094988 ACGGCCAGCGGCTCCTGTGTTGG - Intronic
1132630211 16:913634-913656 CAGGCCACAGGCTCCTGCCTTGG - Intronic
1132997102 16:2829108-2829130 CTGGCTCCAGGGTCCTGTGTTGG + Intergenic
1133086493 16:3368072-3368094 GTGGACAAAGCCTCCTGTGATGG + Intronic
1134263750 16:12674923-12674945 CTGGAGAAAGCCTCCTGGGTGGG - Intronic
1134808182 16:17143556-17143578 ATGACCAAAGGCACATGTGTAGG - Intronic
1134836780 16:17368015-17368037 CTGGTCAGAGGCTCTTGTGAAGG - Intronic
1137278070 16:46950513-46950535 CTTGCCTCAGCCTCCTGTGTTGG + Intergenic
1137601971 16:49762399-49762421 CTGGCCACAGGCTTCTGTGTGGG - Intronic
1138587180 16:57978145-57978167 CTGGCCAAAGTGTCCTGGGCAGG - Intronic
1138597164 16:58035206-58035228 CTCTCCCAAGGCTCCTGTGCTGG - Intronic
1139329826 16:66178627-66178649 CTGGCCAAGGGCATCTGTGAAGG + Intergenic
1139953254 16:70681871-70681893 CTGGCCCAAGGGCCCTGTGGAGG + Intronic
1141158169 16:81611176-81611198 ATGGCCAAAGGCTGCTGTGTTGG + Intronic
1142109326 16:88322856-88322878 CTGCCCAAAGTCTCCTGGGCTGG - Intergenic
1142367196 16:89656921-89656943 CTGGGCAAGGGGTCCTGGGTCGG + Intronic
1142715137 17:1743092-1743114 CTGGCCAAGGGCTCTTGTGTGGG + Intronic
1143490194 17:7281651-7281673 CTGGCCAATGGGTGCTGTGAAGG + Exonic
1143543082 17:7581043-7581065 TTGCCCAAAGACCCCTGTGTGGG - Exonic
1144387205 17:14759849-14759871 CAGGCCAATGGGTTCTGTGTGGG + Intergenic
1144629175 17:16861662-16861684 CTGGCCCATGGCTCCTTTCTCGG - Intergenic
1145823239 17:27856777-27856799 CTTTCCAAAGGCCCCTCTGTTGG - Intronic
1147648677 17:42049792-42049814 GTGGCCAGTGGCTGCTGTGTTGG - Intronic
1150737216 17:67751204-67751226 CTGGCCCAAGGCTCCAGGGCTGG - Intergenic
1151686590 17:75650778-75650800 GGGGCCACAGGCTTCTGTGTGGG + Intronic
1152325317 17:79632604-79632626 CCGGCCACACGCTCCTGTGGCGG + Intergenic
1152365742 17:79855410-79855432 CTGGACCAAGGCTCATGGGTTGG + Intergenic
1152441588 17:80313176-80313198 TTGGCCGAAGGCTTCTGGGTAGG + Intronic
1152573082 17:81128973-81128995 CGCACCAAAGGCTCCTTTGTTGG + Intronic
1154082282 18:11269744-11269766 CTGGCCATAGGCTTCTATGCCGG - Intergenic
1158908147 18:62034322-62034344 CTTGCCTCAGCCTCCTGTGTTGG + Intergenic
1159954013 18:74506875-74506897 CTGGTCAAAGCCTCCCGTGCAGG - Intronic
1160039803 18:75335199-75335221 CTGGGCAGGGGCTCCTGTGAGGG + Intergenic
1161073806 19:2275442-2275464 CTGGCCAGCGCCTCCTGTGTTGG - Exonic
1162804147 19:13128186-13128208 CGGGCCAAAGACTCCAGTGGGGG + Intronic
1162955653 19:14096567-14096589 CCAACCAAAAGCTCCTGTGTAGG + Intronic
1163228128 19:15979358-15979380 CTGGCCAAGGGCCTCTGTCTTGG + Intergenic
1165232119 19:34393803-34393825 CTGGCCAGAGGCGCGTGTGTTGG + Intronic
1165441657 19:35831684-35831706 CTCTCCAATGCCTCCTGTGTCGG - Exonic
1168281050 19:55305464-55305486 CTGGCAAAACGCTCCTGGTTCGG + Exonic
1168385195 19:55957190-55957212 GTGGCCAGTGGCTCCTGTATTGG - Intronic
925021661 2:574508-574530 CTGGCCAAATGTGCCTGTGATGG - Intergenic
925181120 2:1817549-1817571 CTGTCCAAACGCGGCTGTGTCGG + Intronic
927106763 2:19834319-19834341 CTGCCCAAAGTCCCCAGTGTTGG - Intergenic
929253227 2:39781311-39781333 CTGACCAAAGGCTCCTGGAGGGG - Intergenic
932618850 2:73254060-73254082 CTGGCCAGAGCCTCCTGAGTAGG + Intergenic
933089551 2:78104031-78104053 CTGGCCTGAGGCACCTGGGTTGG - Intergenic
933865343 2:86510869-86510891 CTGTCCATAGGCTGGTGTGTGGG - Intronic
933941960 2:87252436-87252458 CTGTCCAAAGGCTCATGCATGGG + Intergenic
934466860 2:94271241-94271263 CTGAGCAAACCCTCCTGTGTGGG - Intergenic
934695635 2:96398007-96398029 GTGGCCAAGGGGTGCTGTGTTGG + Intergenic
936071085 2:109371789-109371811 CTGGCCAGAGGCTATTGTGGAGG - Intronic
936338262 2:111609133-111609155 CTGTCCAAAGGCTCATGCATGGG - Intergenic
938107120 2:128540050-128540072 CTGGCCTAAGGCTCTTCTGTTGG + Intergenic
938729555 2:134135860-134135882 CTGGGCCATGGCTCCCGTGTAGG + Intronic
939390157 2:141557934-141557956 CTGGCCAAAAACAACTGTGTAGG - Intronic
941503086 2:166305852-166305874 CTTGCAAGAGGCTTCTGTGTAGG - Exonic
943433068 2:187828268-187828290 CTGGCCTCAGCCTCCTGAGTAGG + Intergenic
943771392 2:191721510-191721532 CTGGCTAAGGGCTGCTGTGGTGG + Intergenic
946355152 2:219179891-219179913 ATGGTCCTAGGCTCCTGTGTAGG + Intronic
948226978 2:236318921-236318943 CTGGCCAAGGGCTCCAGAGGTGG + Intergenic
1168893553 20:1309094-1309116 CTGGGCAGAGGCCCCTGGGTAGG - Exonic
1169512272 20:6277128-6277150 ATGGCCAAAGGATCATGTGATGG + Intergenic
1171104659 20:22421061-22421083 CTGGAGAAAGGCCCCTGTGGAGG - Intergenic
1171248127 20:23629623-23629645 AAGTCCAAAGGCTCCTTTGTGGG - Intronic
1172713222 20:36943312-36943334 ATGGCTAACGGCTACTGTGTTGG - Intronic
1173922770 20:46758504-46758526 CTGGCTGATGGCCCCTGTGTTGG - Intergenic
1176124206 20:63468231-63468253 CTTCCCACAGCCTCCTGTGTAGG - Intronic
1176377916 21:6095893-6095915 TTGGCCCAAGGGTCCTGAGTTGG + Intergenic
1179745558 21:43442355-43442377 TTGGCCCAAGGGTCCTGAGTTGG - Intergenic
1183406707 22:37633721-37633743 CTGGCCACAGGCCCCTTTGCAGG - Intergenic
1183619449 22:38964246-38964268 CTGGGCAAAGGGACCAGTGTAGG + Intronic
1183955233 22:41376097-41376119 CTGGCCAAAGGCTCCTGTGTTGG + Intronic
1184809881 22:46824228-46824250 GTGGCTCGAGGCTCCTGTGTTGG + Intronic
1185253776 22:49820365-49820387 CTAACCAATGGCTCCGGTGTAGG - Intronic
1185269512 22:49922686-49922708 CTGGACGAGGGCGCCTGTGTGGG + Exonic
950683571 3:14601766-14601788 CAGGCCCAGAGCTCCTGTGTGGG - Intergenic
951226792 3:20129768-20129790 GTGGCCAGTGGCTCCTGTATTGG + Intronic
956438735 3:69259901-69259923 TTGGCCACAGCCTCCTGAGTAGG + Intronic
957210441 3:77251355-77251377 GTGGCCAAAGGGTGCTGTTTTGG + Intronic
959849507 3:111071229-111071251 CATGCTAAAGGTTCCTGTGTAGG - Intronic
960524537 3:118694721-118694743 CTGCCAACAGGCTCCTGTGTGGG - Intergenic
960973883 3:123157398-123157420 CTGGCCACAGGCTGGTGTGTGGG + Intronic
961330093 3:126133346-126133368 CTGTCCCAAGGCTGCCGTGTGGG - Intronic
962763746 3:138542528-138542550 CTGGCCAGTGGCTCCTGGGCTGG + Intronic
963809450 3:149760528-149760550 CTGGCCTCAGCCTCCTGAGTAGG - Intergenic
964799611 3:160540761-160540783 CTGGCCAAAGGCTTATGTATAGG + Intronic
967109276 3:186279243-186279265 CTGGCCTAACTCTCATGTGTGGG + Intronic
967956749 3:194883301-194883323 CTTGCCAAAACCTCCTGTGCAGG + Intergenic
968461614 4:728754-728776 GTGGCCAGTGGCTCCTGTGTTGG - Intronic
968916877 4:3500479-3500501 CTGGCCAAGGGCTGCTGGGTGGG - Intronic
969036916 4:4261820-4261842 CTCGCCAAAGGTCCCTGCGTGGG - Intergenic
973541693 4:51941561-51941583 CTGGCCAAAGGCTCATGAGTGGG - Intergenic
978453802 4:108865878-108865900 CTGGCCTCAGCCTCCTGAGTAGG + Intronic
986238930 5:5939603-5939625 GTGGGCACAGGCTCCTCTGTAGG - Intergenic
986993001 5:13575642-13575664 CTGGACAATGAGTCCTGTGTGGG + Intergenic
987425431 5:17767481-17767503 ATGGCTTATGGCTCCTGTGTTGG - Intergenic
988468088 5:31510350-31510372 CTGGGCAAAGACACCTGAGTTGG - Intronic
991263245 5:64689201-64689223 ATGGTAAAAGGCTCCTTTGTTGG + Intergenic
994148311 5:96419949-96419971 CTGGCCCCAGGATCCAGTGTGGG - Intronic
994948175 5:106423307-106423329 CTGGCCAGTGGCTCCTGGGCTGG - Intergenic
997427035 5:133810299-133810321 CTGGACACAGGCTCCTGGGAAGG - Intergenic
998335061 5:141364445-141364467 CTGGACAAAGGCTCCTTCGTCGG + Exonic
998336150 5:141374198-141374220 CTGGAGAAAGGCTCCTTCGTAGG + Exonic
1000840716 5:166214173-166214195 CCGTCCAAAGACTCATGTGTTGG - Intergenic
1001462045 5:171924688-171924710 CTGGCCCACGGCTCCTGGGCTGG - Intronic
1003317316 6:5024408-5024430 CCGGCCAAAGGCCCCTTTGAAGG + Intergenic
1006398144 6:33800417-33800439 GTGGCCAAAGCCTCCTCTTTAGG - Intronic
1007568366 6:42870809-42870831 CTGGCCTCAGCCTCCTGAGTAGG - Intergenic
1008035641 6:46742302-46742324 CTGGACAAGGGCTCCTTGGTGGG + Intergenic
1009306911 6:62102612-62102634 CTGGCCCACGGCTCCTGGGCTGG + Intronic
1013457161 6:110340484-110340506 CTAGCCCAGGGCTCCTGTGATGG - Intronic
1013555626 6:111254273-111254295 CTGGGGGAAGGCTCCTGTGAGGG - Intergenic
1015813714 6:137186344-137186366 ATGGCCATAGGCACATGTGTAGG - Intergenic
1015956674 6:138606172-138606194 CAGGCCAGAGGAGCCTGTGTGGG - Intronic
1018025977 6:159806104-159806126 CTGTCCCAATGCTCCTGCGTTGG - Intronic
1019003571 6:168777541-168777563 CTGGCCAAAGGGTGCTGTCCTGG - Intergenic
1021699398 7:23302886-23302908 CCGGCCTAAGCCTCCTGAGTAGG + Intronic
1026742971 7:72990427-72990449 CTGTCAAAAGGCTTCTGTGCTGG + Intergenic
1027029086 7:74875131-74875153 CTGTCAAAAGGCTTCTGTGCAGG + Intergenic
1027100764 7:75374651-75374673 CTGTCAAAAGGCTTCTGTGCAGG - Intergenic
1029685572 7:102145389-102145411 TTGGCCAAAAGCCCCTTTGTGGG + Intronic
1030329796 7:108259056-108259078 CTGGCTAGTGGCTACTGTGTTGG + Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1033008523 7:137593574-137593596 GTGGCCAATGGCTGCTGCGTTGG - Intronic
1033295076 7:140125377-140125399 GTGGCTAATGGCTACTGTGTTGG - Intronic
1034696906 7:153061872-153061894 GTGGCCAGAGGCTACTGTGTGGG + Intergenic
1038679726 8:29655559-29655581 CTGGCATGAAGCTCCTGTGTGGG - Intergenic
1039290972 8:36094265-36094287 TGGGGCAAAGGCTTCTGTGTTGG - Intergenic
1040384125 8:46901882-46901904 CGGGCCAAAGGCACCTCTGCAGG - Intergenic
1042705753 8:71664425-71664447 CTGGGCAAAGGCTCCTTCTTTGG - Intergenic
1044729892 8:95221224-95221246 CTGGGCAAAGGCTCCTACTTAGG + Intergenic
1044860249 8:96515950-96515972 CTGGCCAAAGAACCCAGTGTTGG + Intronic
1047690305 8:127345434-127345456 GTGGCTAATGGCTACTGTGTTGG - Intergenic
1049313565 8:141946937-141946959 CTGGGCCAAGGCTCCTGGGCTGG + Intergenic
1049437768 8:142595593-142595615 CTGGCCAAGGGCGCCTGGGGTGG - Intergenic
1049843302 8:144787707-144787729 CTGGCCAAAGAAGCCTGTCTTGG + Intergenic
1051351338 9:16200716-16200738 CTAGGGAAAGGCTGCTGTGTGGG - Intergenic
1052638813 9:31137469-31137491 CTGAACAAAGTCTCTTGTGTAGG + Intergenic
1052821010 9:33137870-33137892 CTGGGCAAAGGCTACTGGGGGGG + Intronic
1053360771 9:37485409-37485431 CTGCCCAAAGGCTCCGGGGTTGG + Intergenic
1058118999 9:101117947-101117969 CTGTCCAAGGGCTGCTTTGTTGG + Intronic
1058141782 9:101364084-101364106 GTGGAGAATGGCTCCTGTGTAGG - Intronic
1061361951 9:130149197-130149219 CTAGCCAAACTCTCCCGTGTAGG + Intergenic
1062133689 9:134913600-134913622 CTGCCCAGCGTCTCCTGTGTGGG + Exonic
1062571924 9:137189681-137189703 GTAGCCAAGGGATCCTGTGTGGG - Intronic
1187835761 X:23430414-23430436 CTGGCAAAATGCTCAGGTGTGGG + Intergenic
1190686163 X:52875695-52875717 CTGGCCTGGGGCTCCTGTCTTGG + Intergenic
1191808918 X:65165439-65165461 CTGCCGAAAGGCCCCGGTGTGGG + Intergenic
1192064343 X:67864976-67864998 CTAGCCAAAGGCAGCTGTGAGGG - Intergenic
1193684967 X:84566889-84566911 GTGGACAAAGGCTCTTTTGTTGG - Intergenic
1195953268 X:110301288-110301310 TTTGCCAAAGGGCCCTGTGTTGG + Intronic
1196886835 X:120254022-120254044 CTCGGCAAAGTCTCCTTTGTGGG - Exonic
1199975356 X:152891961-152891983 GTGGCCAGTGGCTACTGTGTTGG - Intergenic
1200506961 Y:4024981-4025003 GTGGCCCAAGGGTCCTGTCTTGG - Intergenic
1201925194 Y:19277029-19277051 CTGGCCTAAGGCTCTTTTATTGG + Intergenic
1202601764 Y:26600724-26600746 CTTGCCCAAGTCTCCTGTGGTGG - Intergenic