ID: 1183956263

View in Genome Browser
Species Human (GRCh38)
Location 22:41382213-41382235
Sequence GGGGTGGTCCGCGCGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183956247_1183956263 8 Left 1183956247 22:41382182-41382204 CCCGCGCGAGGCGCGCCTCGGTG 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1183956263 22:41382213-41382235 GGGGTGGTCCGCGCGGGCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 211
1183956257_1183956263 -7 Left 1183956257 22:41382197-41382219 CCTCGGTGAGGGCGGGGGGGTGG 0: 1
1: 0
2: 4
3: 47
4: 510
Right 1183956263 22:41382213-41382235 GGGGTGGTCCGCGCGGGCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 211
1183956244_1183956263 10 Left 1183956244 22:41382180-41382202 CCCCCGCGCGAGGCGCGCCTCGG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1183956263 22:41382213-41382235 GGGGTGGTCCGCGCGGGCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 211
1183956248_1183956263 7 Left 1183956248 22:41382183-41382205 CCGCGCGAGGCGCGCCTCGGTGA 0: 1
1: 0
2: 0
3: 2
4: 25
Right 1183956263 22:41382213-41382235 GGGGTGGTCCGCGCGGGCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 211
1183956246_1183956263 9 Left 1183956246 22:41382181-41382203 CCCCGCGCGAGGCGCGCCTCGGT 0: 1
1: 0
2: 0
3: 6
4: 30
Right 1183956263 22:41382213-41382235 GGGGTGGTCCGCGCGGGCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 211
1183956243_1183956263 11 Left 1183956243 22:41382179-41382201 CCCCCCGCGCGAGGCGCGCCTCG 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1183956263 22:41382213-41382235 GGGGTGGTCCGCGCGGGCTGGGG 0: 1
1: 0
2: 1
3: 13
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183956263 Original CRISPR GGGGTGGTCCGCGCGGGCTG GGG Intronic
900117202 1:1033820-1033842 GGGGTGCTCGGCTGGGGCTGGGG - Intronic
900192317 1:1356650-1356672 GGGGTGGGCAGCTGGGGCTGGGG + Intronic
900221463 1:1511625-1511647 CGGGAGGGCCGTGCGGGCTGCGG + Intergenic
900678140 1:3901142-3901164 GGGGTGGCCCGCCCGGGAAGTGG + Intergenic
901212623 1:7535056-7535078 GGGGTGGGGCGGGCGGCCTGTGG - Intronic
901480192 1:9519809-9519831 GGAGTGGTTAGCGAGGGCTGGGG + Intergenic
902804892 1:18854900-18854922 GTGGTGGTCGGCGCTGGGTGTGG + Exonic
904812515 1:33172550-33172572 GGGGTGGGCCGGGCAGGATGAGG + Intronic
907051091 1:51330388-51330410 GGCGCGGGCGGCGCGGGCTGGGG - Intronic
907442620 1:54488466-54488488 GGGGTGGACGGCGCGGGGGGAGG - Intergenic
909475222 1:76074639-76074661 GGGCGGGGCCGCGCGGGCCGCGG + Intergenic
910288947 1:85581431-85581453 GGGCTGGTCCGGGACGGCTGCGG + Exonic
911116012 1:94247488-94247510 GGGGTCGCCCGCGCGGGCGCCGG - Intronic
913063383 1:115227934-115227956 GGGGTGGTCACCGAAGGCTGGGG - Intergenic
915205931 1:154270401-154270423 GGGGTGGGCCGCTGGGGGTGGGG - Exonic
915345213 1:155193674-155193696 GGGCTGGGCCGCGCAAGCTGAGG + Intergenic
917817636 1:178725967-178725989 GGCGGGGGCCGCTCGGGCTGCGG - Intronic
919451153 1:197775008-197775030 GAGGTTGGCCGGGCGGGCTGGGG - Intronic
920002060 1:202807435-202807457 GGGGCGGCCAGCGCTGGCTGGGG - Intronic
920705062 1:208244489-208244511 GAGGAAGTCCGCGCGGGCGGGGG - Intergenic
922250582 1:223845822-223845844 AGGGCCCTCCGCGCGGGCTGGGG + Exonic
922823231 1:228498682-228498704 GGGGTGGTTCGGGCGGGTGGTGG + Intergenic
923333951 1:232950783-232950805 GGGTGGGGGCGCGCGGGCTGCGG + Intronic
924527226 1:244863565-244863587 CGGGAGGCCCGCGCGGGGTGGGG - Intronic
1063462153 10:6221740-6221762 GGGGAGGTGAGCGCAGGCTGGGG + Exonic
1065099599 10:22320827-22320849 GGGGTGGGCTGCGCGGCGTGCGG + Intronic
1066697841 10:38094523-38094545 TGGGGGTTCCGCGCGGCCTGGGG + Intronic
1067066111 10:43105194-43105216 GTGCTTGTCCGCGCGTGCTGTGG + Intronic
1073424664 10:103449283-103449305 GGGTTGGTCCTCAGGGGCTGAGG - Intronic
1076881159 10:133239839-133239861 GAGGTGGGCCGGGCAGGCTGGGG + Intronic
1076885619 10:133261143-133261165 GGGGTGGGCGGCGGAGGCTGGGG + Intergenic
1077179663 11:1206733-1206755 GGGGTGGGCTCCGAGGGCTGAGG - Intergenic
1077342391 11:2031918-2031940 GGGGTGGGCCGGGCAGGCAGAGG - Intergenic
1077488558 11:2850180-2850202 GGGGTGGGCGGCCGGGGCTGGGG - Intergenic
1078417864 11:11180489-11180511 ATGGTTGTCCGCGGGGGCTGTGG - Intergenic
1079122640 11:17696320-17696342 GGTGTGGTCCGGGGGGTCTGGGG + Intergenic
1081812687 11:45922514-45922536 CGGGGGCTCCTCGCGGGCTGGGG + Intronic
1083265831 11:61546495-61546517 GAGGGGGACCGGGCGGGCTGGGG + Intronic
1088259268 11:107928832-107928854 AGGGGCGTCCGGGCGGGCTGAGG - Intronic
1089442838 11:118531042-118531064 GGGGTACTCGGCGCGGGCTGGGG + Exonic
1089456390 11:118628234-118628256 GGGGTGGTCCGGGTGGGCAGCGG - Exonic
1202825377 11_KI270721v1_random:87107-87129 GGGGTGGGCCGGGCAGGCAGAGG - Intergenic
1091823252 12:3491736-3491758 GCGGTGGTCCGGGTGGGCGGCGG - Intronic
1094844809 12:34356775-34356797 GGGCTGGCCCTCGTGGGCTGAGG + Intergenic
1094851920 12:34386128-34386150 GGGCTGGCCCCCGTGGGCTGAGG + Intergenic
1096465812 12:51847427-51847449 TGTGTTGTCCGCACGGGCTGTGG - Intergenic
1105459078 13:20567057-20567079 GGGGTGGTGCGGGAGGCCTGGGG - Intronic
1105587175 13:21756224-21756246 GGGCTGGCCTGCGGGGGCTGTGG + Intergenic
1110033582 13:70650877-70650899 GTGGTGGTTCCCGGGGGCTGGGG - Intergenic
1115880115 14:37906486-37906508 GGGGTGGGTCGCGGGGGGTGGGG + Intronic
1117315590 14:54567854-54567876 GGGGCGGGCGGGGCGGGCTGGGG + Exonic
1118270527 14:64338670-64338692 GGGGTGGACGGGGCGGTCTGCGG - Intergenic
1119260968 14:73237852-73237874 GGGAAGGTCCGAGCGGGCGGAGG - Intronic
1121358716 14:93235632-93235654 CCGGTGGTCCGGGCGGGGTGGGG - Intergenic
1122143352 14:99675192-99675214 TGGGTGGGCCGCGCTGGCCGCGG - Exonic
1122329841 14:100904695-100904717 GGGGTGGTCGGGGCGGGGGGCGG + Intergenic
1122637929 14:103138905-103138927 CCGGTGTTCCGCGGGGGCTGCGG - Intergenic
1122985044 14:105208158-105208180 GGGGTGGGGCTCGGGGGCTGGGG - Intergenic
1123011546 14:105352240-105352262 GGGGTGGTAGGCACAGGCTGGGG - Intronic
1123464566 15:20505983-20506005 CGGGTGGTCCGCGCAGGCCCCGG + Intergenic
1123653548 15:22495058-22495080 CGGGTGGTCCGCGCAGGCCCCGG - Intergenic
1123743968 15:23303918-23303940 CGGGTGGTCCGCGCAGGCCCCGG - Intergenic
1124275295 15:28321950-28321972 CGGGTGGTCCGCGCAGGCCCCGG + Intronic
1124307409 15:28589651-28589673 CGGGTGGTCCGCGCAGGCCCCGG - Intergenic
1125182070 15:36888645-36888667 TGGGTGGGCGGCGGGGGCTGCGG + Intergenic
1125953869 15:43776332-43776354 GGGGTTGTCCCAGGGGGCTGTGG - Intronic
1126823671 15:52528931-52528953 GGGGAGGGCCGCGCGGGGCGGGG + Exonic
1129298963 15:74614827-74614849 GGGATGGTCCGCCCCGACTGCGG + Intronic
1129351309 15:74957297-74957319 GGCGTGGTCCTCGCGGGGCGCGG + Exonic
1130417430 15:83706759-83706781 GGGGTGGGGGGCGGGGGCTGAGG - Intronic
1132709796 16:1261386-1261408 GGGGTGGTCAGCTGGGGCTACGG - Intergenic
1133223069 16:4327600-4327622 GGGGCCGTCTGCTCGGGCTGCGG + Intronic
1133573290 16:7063297-7063319 GGGGTGGTCCCCTGGGGTTGGGG - Intronic
1134290933 16:12902465-12902487 GGGGTCGTCCTTGCGGGCGGGGG - Exonic
1135998089 16:27268572-27268594 GGGTCGGTCCCCGTGGGCTGTGG - Intronic
1136540004 16:30923810-30923832 TCGGGGGTGCGCGCGGGCTGGGG + Intronic
1136554019 16:30997385-30997407 GGCGTGGTCAGGGAGGGCTGGGG - Intronic
1136707753 16:32202875-32202897 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1136760156 16:32726536-32726558 GGGGGGGCCGGCGCGGGGTGAGG + Intergenic
1136807948 16:33143850-33143872 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1137704708 16:50526558-50526580 GGGGTGGTGAGAGAGGGCTGGGG + Intergenic
1141620107 16:85232768-85232790 GGGGTGGTCAGCGAGGCCTCCGG - Intergenic
1142029882 16:87833235-87833257 GGGGTGGGCCGAGTGGGATGTGG - Intronic
1142136320 16:88453481-88453503 GGGGCTGGGCGCGCGGGCTGGGG + Exonic
1203062310 16_KI270728v1_random:986858-986880 GGGGAGGCCGGCGCGGGGTGAGG + Intergenic
1143788346 17:9273503-9273525 GGCGTGGTCCTCGCTGGCAGTGG - Intronic
1144295381 17:13870298-13870320 GGGGAGGTCTGGGTGGGCTGAGG - Intergenic
1146372732 17:32275497-32275519 GGGGTGGGCAGCACGGGTTGGGG - Intronic
1147935073 17:44006476-44006498 GGGGCAGTCCGTGCCGGCTGTGG + Intronic
1148040533 17:44703258-44703280 GGGGTGGGCAGGGTGGGCTGGGG + Intergenic
1149850579 17:60031434-60031456 GGGGTGGTCCTCCTGGACTGCGG - Intergenic
1149859587 17:60115090-60115112 GGGGTGGTCCTCCTGGACTGCGG + Intergenic
1150927173 17:69545145-69545167 GGGGTGGTGGGGGCGGGGTGTGG - Intergenic
1151573371 17:74938388-74938410 TGGGTGGTCAGCGTGGGGTGAGG + Intronic
1151983709 17:77528822-77528844 AGGCTGCTGCGCGCGGGCTGGGG + Intergenic
1152092409 17:78254355-78254377 GGGGCGCTCCGGGCGGGGTGTGG - Intergenic
1152183626 17:78840660-78840682 GGGGGGTTCCGCGAGGCCTGGGG - Exonic
1152900445 17:82937995-82938017 GGGTTGGCCTGCGCGGGGTGGGG + Intronic
1155130947 18:22933770-22933792 TGGGTCTCCCGCGCGGGCTGAGG + Intronic
1155722894 18:29041296-29041318 GGGGTGGGGGGCGGGGGCTGGGG - Intergenic
1157602382 18:48902096-48902118 GGGCTGGTCGGGCCGGGCTGAGG - Intergenic
1157610123 18:48950674-48950696 GGCGCGGGCCGCGCGGGGTGGGG - Exonic
1160630872 18:80246301-80246323 TTGGTGGACCCCGCGGGCTGAGG - Intronic
1160866803 19:1259801-1259823 GGGGTGGAAGGCGCAGGCTGGGG - Intronic
1161019018 19:1999156-1999178 GGGCTGGACCGGGTGGGCTGAGG - Intronic
1161257031 19:3315226-3315248 GGGGAGGTCTCAGCGGGCTGGGG + Intergenic
1161493386 19:4574989-4575011 GGGGTGGCTCGAGGGGGCTGGGG + Intergenic
1161585084 19:5101642-5101664 GGGGAGGTCTGGGTGGGCTGTGG + Intronic
1161585104 19:5101708-5101730 GGGGAGATCCGGGTGGGCTGTGG + Intronic
1161716735 19:5880529-5880551 GGGGTGGTCGGTGGGGGGTGGGG - Intronic
1161977348 19:7613773-7613795 GGGGTGGTAGGAGCGTGCTGGGG - Intronic
1162962408 19:14136043-14136065 GGGGAGGTCGGGGCGGGCAGTGG + Intronic
1163262214 19:16198116-16198138 GGGTGGGTCCCCGCGGGCGGAGG - Intronic
1163263271 19:16204016-16204038 GGAGTGGTCAGCGGGGTCTGGGG + Intronic
1165462025 19:35949549-35949571 GGGGTGGTCCAGGCATGCTGTGG - Intergenic
1166055447 19:40285367-40285389 GGGGCGGTAAGCGGGGGCTGGGG - Exonic
1166350643 19:42196505-42196527 GGGTTGGCCTGTGCGGGCTGAGG - Intronic
1166366468 19:42280820-42280842 GGGTTGGTCGGCGCGGGCTGAGG - Intronic
1166546956 19:43639689-43639711 GGGGTCGGCCGGCCGGGCTGGGG - Intronic
1167483425 19:49746551-49746573 GGCCTGGTCCCCGCAGGCTGGGG - Exonic
1167644296 19:50697340-50697362 GGGGTGGTCAGGGCAGGGTGGGG - Intronic
925395163 2:3528428-3528450 GGTGGGATCCCCGCGGGCTGAGG - Intergenic
926247231 2:11130405-11130427 GGGTTGGTCCTCCCAGGCTGGGG + Intergenic
927484517 2:23479383-23479405 GAGGTGGACAGCGCAGGCTGGGG - Intronic
938042856 2:128090453-128090475 GGGGTGGGGGGCGCGGGCGGGGG + Intergenic
940316978 2:152336125-152336147 GGGATGGTCCGCAGGGGCTCAGG - Intronic
1169263637 20:4154858-4154880 GGGGTGGTGCAGGTGGGCTGGGG + Intronic
1169338118 20:4774041-4774063 GGGGTGGGCGGGGTGGGCTGGGG + Intergenic
1172771822 20:37386511-37386533 GGGGTGCTTCGCGGGGGGTGGGG + Intronic
1175466524 20:59193748-59193770 GGGGTGCTCTGCGGGGGCTGGGG - Exonic
1175700598 20:61134141-61134163 GTGCTGGTCCGGGAGGGCTGTGG - Intergenic
1175870918 20:62208986-62209008 GGGGTGGTCTGGACGGGCTGTGG + Intergenic
1175950603 20:62581314-62581336 GGGGGGGTGCGCGCAGGCTGGGG - Intergenic
1176025907 20:62985562-62985584 GGCGGGGCCCGGGCGGGCTGGGG + Intergenic
1176223129 20:63979397-63979419 GGGGCCGTGCGCGCGGGCTTCGG - Exonic
1176550604 21:8219248-8219270 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1176569534 21:8402289-8402311 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1176577446 21:8446518-8446540 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1177431729 21:20998416-20998438 GAGGAGGAGCGCGCGGGCTGCGG + Exonic
1178707319 21:34886769-34886791 GGGGAGATCCGCGAGGGCAGCGG - Intronic
1179725712 21:43340293-43340315 GGGGTGGGCTGCAGGGGCTGGGG + Intergenic
1180142575 21:45901212-45901234 GGGGTTGCCTGGGCGGGCTGGGG - Intronic
1183368643 22:37420080-37420102 GGGGTGGGCCGCGGGGGACGGGG + Intronic
1183546042 22:38455316-38455338 GGGGTGGGGGGCGCGGGCGGCGG - Intergenic
1183577388 22:38700715-38700737 GGGCTGGCCCGCGAGGGGTGGGG + Intronic
1183956263 22:41382213-41382235 GGGGTGGTCCGCGCGGGCTGGGG + Intronic
1184680859 22:46071527-46071549 CGGGCGGTCTCCGCGGGCTGCGG + Intronic
1184950038 22:47834487-47834509 GGGGTGGTCCCAGTGGGGTGGGG + Intergenic
1185241687 22:49750453-49750475 GGTTTGGTCCGCGAGGGCTACGG + Intergenic
1203255503 22_KI270733v1_random:135591-135613 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
950583610 3:13878684-13878706 GGGGTGGACCGCAGGGGCTGCGG - Intronic
950610659 3:14124773-14124795 GGGCGGGTCCGCGCGGGCTTCGG - Exonic
950924542 3:16727478-16727500 GGGGTGGGCTGGGCTGGCTGGGG + Intergenic
952981815 3:38742238-38742260 GGCGTGGTCGGGGCGGGGTGGGG - Intronic
953955434 3:47228197-47228219 GGGGTGGTGAGCTCGGTCTGAGG - Exonic
953972187 3:47356141-47356163 GGAGGGGTCCGGGCTGGCTGAGG - Intergenic
954697502 3:52435566-52435588 GGGGTGGTCAGGATGGGCTGGGG - Exonic
954868466 3:53749208-53749230 GGGCTGGGCCGTGTGGGCTGGGG + Intronic
955059062 3:55481428-55481450 GGGGTGGCCAGCGCGGGGGGTGG + Intronic
959085753 3:101849456-101849478 GGGGAGGTCGGCGAGCGCTGCGG + Intronic
960702476 3:120451305-120451327 GCGGCGGCCCGGGCGGGCTGCGG + Intergenic
962714712 3:138116004-138116026 GGGGTGGTGGGTGGGGGCTGCGG - Intergenic
968434149 4:576317-576339 GGGAGGGGCCCCGCGGGCTGGGG - Intergenic
968511385 4:997373-997395 GGGGGAGACCGCGCGGGGTGGGG - Intronic
968747981 4:2370782-2370804 GGGGTGGCCGGCGAGGGATGTGG - Intronic
968952304 4:3701457-3701479 GGGGTGGGCCGCGGGGGCTCAGG + Intergenic
969302418 4:6304929-6304951 GGGGTGGTCGGCGGGGCCCGGGG - Intergenic
974047244 4:56908251-56908273 GGGGAGGGCCGCCCGGGCGGCGG + Intronic
981617371 4:146655497-146655519 GGGGCAGACCGCGCGGGCTTGGG - Intergenic
982106955 4:152019640-152019662 GGGGTGGTAGGCACGGGCTTTGG + Intergenic
985641079 5:1063767-1063789 GGGGCGGCCCGGGAGGGCTGTGG - Intronic
985711307 5:1431412-1431434 GGGGTGGACTGTGCGGGTTGGGG + Intronic
989178726 5:38556243-38556265 GGGGCGGCCCGGGCGGGGTGGGG - Intronic
989506030 5:42228749-42228771 GGGGTGATCAGCCCGGGGTGGGG + Intergenic
992013811 5:72556714-72556736 AGGGTGGACTGCGCGAGCTGAGG + Intergenic
994710538 5:103259195-103259217 GGTGGGGCCCGCGCGGGGTGCGG + Intronic
997583719 5:135032969-135032991 CGGGTGGCCGGCGCGGGCAGTGG - Intronic
1001159391 5:169300477-169300499 TGGGTGGCCCGCGTGGGGTGGGG + Intronic
1001906515 5:175478332-175478354 GTGGGGCTCTGCGCGGGCTGGGG - Intronic
1002394346 5:178941484-178941506 GGGGTGGTCATCCTGGGCTGAGG + Intronic
1002600668 5:180352707-180352729 GGGGGCGACCGGGCGGGCTGCGG + Intronic
1006706379 6:36024623-36024645 CGGGCGTTCCGGGCGGGCTGAGG + Exonic
1007614302 6:43171431-43171453 GGGGCGCTGCGCGCGGCCTGGGG + Exonic
1017505173 6:155062091-155062113 GGGGTGGTGCGCGGGGGCGGTGG - Intronic
1019344363 7:522212-522234 AGGGGGGTCCGCGCGGGCGTGGG - Intergenic
1019554088 7:1619960-1619982 GGGGTGCTCCGCGTGAGATGCGG - Intergenic
1019883713 7:3885335-3885357 GGGGTGGGCTGCGTGGGCTGTGG + Intronic
1023017534 7:35982715-35982737 GAGGTGGCCAGCGCGGGCGGGGG - Intergenic
1023881799 7:44325144-44325166 GGGCAGGGCCGCGCGCGCTGAGG + Intronic
1023972310 7:45000294-45000316 GGGGCGGGCCGGGCGGGCCGCGG + Intronic
1030033299 7:105388452-105388474 GGGGAGGGGCGCGCGGGCCGCGG - Intronic
1032306234 7:130734199-130734221 GGCGGGCTCCGCGCGGGCGGCGG - Intergenic
1033477188 7:141702183-141702205 GGGGCGGGGCGGGCGGGCTGCGG + Intergenic
1034951131 7:155297784-155297806 TGGGCGGTGCGCGCGGGCGGTGG + Exonic
1037261964 8:17019634-17019656 GGGGTGGTGGGCGTGGGGTGGGG - Intergenic
1037388406 8:18366499-18366521 GGAGTGGTCAGCCAGGGCTGTGG - Intergenic
1038326718 8:26577610-26577632 GGGGTGGTCGTCGCGGCCGGGGG - Intronic
1046547328 8:115668515-115668537 GGGGAGGCCCGAGCGGGCCGCGG - Intronic
1047203168 8:122782714-122782736 GGGGGAGTCCGCGCGGGGCGGGG + Intronic
1049659917 8:143815377-143815399 CGGGTGGGCGGCGCGGGCTCCGG + Exonic
1049708094 8:144051883-144051905 GGGGAGGGCCGCGAGGGCTGGGG + Intronic
1049815349 8:144596582-144596604 GGGGTGCTGCGCGGGGGCAGAGG + Intronic
1050193577 9:3056280-3056302 GTGGTGGCCCGTGGGGGCTGAGG + Intergenic
1053009366 9:34624631-34624653 GGCGGGGGCGGCGCGGGCTGCGG - Intronic
1054820453 9:69516216-69516238 GCGGTGGGCCCCGCGGGCGGCGG - Exonic
1054835778 9:69673044-69673066 GGGGAGAGCCGCGCGGGCTTGGG + Intergenic
1057146820 9:92764375-92764397 GGGGTGGGCCGCCGGGGCGGAGG - Intronic
1057308742 9:93928101-93928123 GCAGTGGTCCGCGCAGGCTCTGG - Intergenic
1060849176 9:126860627-126860649 GGGGCGGGGGGCGCGGGCTGGGG + Intergenic
1061134308 9:128724359-128724381 GGGGAGGTGCGCGCGCGCTCCGG - Intergenic
1061403473 9:130381256-130381278 GGGCTGGCCGGCCCGGGCTGTGG - Intronic
1061450961 9:130666793-130666815 TGGGAGGTACGCGCGGGCTGGGG + Exonic
1062364420 9:136202164-136202186 GGGGTTGGCCGCGGGGGCTGGGG - Intronic
1062413048 9:136434396-136434418 AGGGTGGGCAGCACGGGCTGGGG - Intronic
1062440465 9:136567294-136567316 GGGAAGGTCTGCCCGGGCTGTGG + Intergenic
1062440521 9:136567416-136567438 GGGAGGGTCTGCCCGGGCTGTGG + Intergenic
1062482693 9:136759718-136759740 CAGGTGGTCCCCGAGGGCTGTGG + Exonic
1203471899 Un_GL000220v1:118726-118748 GGGGTTGGCCGCGCGGGCCCCGG + Intergenic
1185867633 X:3637463-3637485 GGGGTGGTCCAGGCGAGCTCAGG + Intronic
1186496396 X:10015385-10015407 GGAGTGGGCGGCGCGGGCAGCGG + Intergenic
1189465684 X:41276236-41276258 GGGGTGGCCCGCCCGGGAGGTGG + Intergenic
1192182021 X:68922098-68922120 GGGGTGTTCCTGGCTGGCTGAGG + Intergenic
1196645875 X:118116868-118116890 GGGGGGGAGCGCGCGGGCGGGGG + Intronic
1197774545 X:130110758-130110780 GGGGTGGAGCGCGCGGGGAGCGG + Intergenic
1198482318 X:137052430-137052452 GGGGTGGCCCGCGGGCGGTGCGG + Intergenic
1199531169 X:148849376-148849398 GGGGTGGTCAGCGGGGGGGGGGG - Intronic