ID: 1183956419

View in Genome Browser
Species Human (GRCh38)
Location 22:41382763-41382785
Sequence GGGGCTTCTGCTGAGCGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 6, 2: 1, 3: 17, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183956405_1183956419 30 Left 1183956405 22:41382710-41382732 CCCTGGGTGTGAGTAGCGCCAGC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1183956419 22:41382763-41382785 GGGGCTTCTGCTGAGCGGGTGGG 0: 1
1: 6
2: 1
3: 17
4: 205
1183956406_1183956419 29 Left 1183956406 22:41382711-41382733 CCTGGGTGTGAGTAGCGCCAGCT 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1183956419 22:41382763-41382785 GGGGCTTCTGCTGAGCGGGTGGG 0: 1
1: 6
2: 1
3: 17
4: 205
1183956410_1183956419 12 Left 1183956410 22:41382728-41382750 CCAGCTACTAGGTCCAACGGGAG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1183956419 22:41382763-41382785 GGGGCTTCTGCTGAGCGGGTGGG 0: 1
1: 6
2: 1
3: 17
4: 205
1183956411_1183956419 -1 Left 1183956411 22:41382741-41382763 CCAACGGGAGCCTTTCTGTTGCG 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1183956419 22:41382763-41382785 GGGGCTTCTGCTGAGCGGGTGGG 0: 1
1: 6
2: 1
3: 17
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183956419 Original CRISPR GGGGCTTCTGCTGAGCGGGT GGG Intronic
900202876 1:1419225-1419247 GGGGCTTCTGCTGAGCCGAGGGG - Exonic
901630182 1:10644164-10644186 GGGGCCTCTGCTGGGCGGCCTGG + Intronic
902451392 1:16499019-16499041 GGGGCATCTGCGGAGCCCGTCGG + Intergenic
904326696 1:29731184-29731206 GGGGCTCCTGCAGAGTGTGTGGG + Intergenic
904371767 1:30052170-30052192 GGGGCTCCTGCAGAGTGTGTGGG - Intergenic
904634154 1:31866834-31866856 GGGATTTCTGCTGAATGGGTTGG - Intergenic
905930112 1:41780776-41780798 GGGGCTTCTGGTGAGCAAGGAGG + Intronic
912208789 1:107535999-107536021 TGGGCTTCTGCTCAGGAGGTGGG - Intergenic
914422297 1:147540732-147540754 GGGGTTTCTGTTGAGTGGTTAGG - Intergenic
919587931 1:199462785-199462807 GGGACCTCAGCTGAGGGGGTTGG - Intergenic
920133280 1:203749425-203749447 GCTGCTGCTGCTGACCGGGTAGG + Intergenic
921978372 1:221227640-221227662 GGGGCTTTCGCTGGGCAGGTTGG + Intergenic
1063067088 10:2621065-2621087 GGGGCCTCTGCAGAGCTGGCTGG + Intergenic
1065797226 10:29318825-29318847 GGTGCTGCTGCTGAGAGAGTGGG - Intergenic
1067142562 10:43669209-43669231 GGGGCTTCTCCTGAGGGGAATGG + Intergenic
1067834890 10:49632455-49632477 AGGGCTTCAGCTGAGAGGGTTGG - Intronic
1069705750 10:70458369-70458391 GGGGCCTCCGCTGAGCGCCTGGG - Intergenic
1072166813 10:92821531-92821553 GGGGCTTCTGCTCAGCTTGTTGG + Intergenic
1074570076 10:114616277-114616299 GGGACTGCTGCAGAGCAGGTGGG + Intronic
1076293516 10:129366092-129366114 GGGGCTTGTGCTGAATGGGTGGG + Intergenic
1077201630 11:1310190-1310212 GGGGCTCCTGCGGAGCGGCGCGG - Intergenic
1077338403 11:2015555-2015577 GGGGCTTCTGCTGAGGGAGATGG - Intergenic
1077393125 11:2308912-2308934 CAGGCTTGTGCTGACCGGGTGGG + Intronic
1077545624 11:3168395-3168417 GGGGTTTCCTCTGAGCCGGTGGG - Intergenic
1079016218 11:16870977-16870999 GGGGCTTGGGGTGAGTGGGTTGG - Intronic
1081136379 11:39444764-39444786 GGGTCTTTTGTTGAGAGGGTAGG + Intergenic
1081416644 11:42823296-42823318 ACAGCTTCTGCTGAGCAGGTAGG - Intergenic
1082166461 11:48955771-48955793 GGGGCATCTGCTGGGCGGAGGGG + Intergenic
1083187655 11:61026932-61026954 GGGTCCTCTGCGGAGGGGGTGGG - Intergenic
1083872701 11:65499067-65499089 GGGGCTTCTGCTGAGGGGGCAGG + Intergenic
1085388154 11:76168960-76168982 GAGGCTACTGCTGAGTGGGGTGG - Intergenic
1086927743 11:92658815-92658837 AGGGCTTATGCTGAGCTGATGGG - Intronic
1202821387 11_KI270721v1_random:70737-70759 GGGGCTTCTGCTGAGGGAGATGG - Intergenic
1091400346 12:177366-177388 GGGGCTTCAGCTGAGGTGGGAGG - Exonic
1094436813 12:30430072-30430094 GGTGCTTCAGCTGAGCAGATGGG - Intergenic
1094495712 12:30988098-30988120 GGGGCCCCTGCTGAGGGGATAGG - Intronic
1101425951 12:104588751-104588773 GAGGCTGCTGGTGAGCAGGTTGG - Intronic
1102001542 12:109560915-109560937 GGGGCCTCTGCACAGCGGGCAGG - Intronic
1102571428 12:113829338-113829360 GGTCCTTGTGCAGAGCGGGTGGG + Intronic
1103446706 12:120999601-120999623 GGGGCTGGCGCTGAGCCGGTGGG - Exonic
1103542204 12:121673897-121673919 GGGACTCCTGCTGCGGGGGTTGG + Intergenic
1107682413 13:42865453-42865475 GGGGTGTCTGCTGAGCGATTAGG + Intergenic
1109300406 13:60584972-60584994 GTGGTTTCTGCAGAGTGGGTAGG - Intergenic
1112574421 13:100622883-100622905 GGGACTTCTGCAGAGGGGGAAGG + Intronic
1113847599 13:113401560-113401582 GGGGTTTCTGCTTGGCGTGTGGG - Intergenic
1117725568 14:58669551-58669573 GGTGCCTTTGCTGAGGGGGTTGG - Intergenic
1118313107 14:64707148-64707170 AGGGCTTCTGCTGAGGAGGGAGG - Intronic
1121323619 14:93007170-93007192 GGGGCTGCTGCTGAGGTGGGTGG - Intronic
1122388556 14:101365073-101365095 GGGGCTGCTGCTGGCCGGGTGGG + Intergenic
1122721501 14:103724939-103724961 GGGCCTGCTGGGGAGCGGGTGGG + Intronic
1122987309 14:105218418-105218440 CCGGGTCCTGCTGAGCGGGTAGG + Intronic
1123057091 14:105575734-105575756 GGGGCTTCTGGGGTGGGGGTTGG - Intergenic
1123081155 14:105696157-105696179 GGGGCTTCTGGGGTGGGGGTTGG + Intergenic
1125508019 15:40278196-40278218 GCTGCTTCTGCTGAGCTGGGGGG - Intronic
1127865843 15:63032037-63032059 TGGGCACCTGCTGAGCTGGTCGG - Intergenic
1129126158 15:73443079-73443101 TTGGCTTCTGCTGAACGGGAGGG + Intergenic
1129457642 15:75684096-75684118 GTGGCTCCTGCTGACCGGGGAGG + Intronic
1130274213 15:82468226-82468248 GTGGCTTCTGCTGACTGGGGAGG - Intergenic
1130466558 15:84195600-84195622 GTGGCTTCTGCTGACTGGGGAGG - Intergenic
1130497706 15:84477936-84477958 GTGGCTTCTGCTGACTGGGGAGG + Intergenic
1130588855 15:85200193-85200215 GTGGCTTCTGCTGACTGGGGAGG - Intergenic
1132579824 16:679842-679864 GGGGCCTCTGCTGATGGGGCCGG + Intronic
1132579862 16:679934-679956 GGGGCCTCTGCTGATGGGGCCGG + Intronic
1132694234 16:1194882-1194904 GGGGCTCCGGCTGACCGGGTGGG + Intronic
1132870041 16:2111920-2111942 GGGGCTTCTGCCGAGCGGGTGGG - Intronic
1133046779 16:3092529-3092551 GGGGCCGCTGGTGAGAGGGTGGG - Exonic
1134062189 16:11205969-11205991 GGGGATGCTGCTGAGCTGCTTGG + Intergenic
1134509341 16:14833908-14833930 GGTGCTGCTGCTGAGCGGCGTGG + Exonic
1134522498 16:14925030-14925052 GGGGCTTCTGCCGAGCGGGTGGG + Intronic
1134697046 16:16232723-16232745 GGTGCTGCTGCTGAGCGGCGTGG + Exonic
1134710168 16:16323681-16323703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134717382 16:16363681-16363703 GGGGCTTCTGCCGAGCGGGTGGG + Intergenic
1134949435 16:18344964-18344986 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1134957370 16:18388478-18388500 GGGGCTTCTGCCGAGCGGGTGGG - Intergenic
1134974797 16:18561962-18561984 GGTGCTGCTGCTGAGCGGCGTGG - Exonic
1135494652 16:22940926-22940948 GGGGCATCTACTGAGAGGGGAGG - Intergenic
1136076353 16:27819993-27820015 TGGGCTTGTGGTGAGCGGGAGGG + Intronic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1139478951 16:67217757-67217779 AGGGCTTCAGCAGAGAGGGTTGG - Intronic
1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG + Intergenic
1141083766 16:81076984-81077006 GGGGCTTCCCCAGAGCGGGCGGG - Intronic
1144109972 17:12021365-12021387 GGGGCTGCGGCGGAGCGGGAGGG + Intronic
1144422314 17:15109818-15109840 GGGGATTAGGCTGAGCGGGAGGG - Intergenic
1144849191 17:18235520-18235542 AGGGCTGCTGCTGACGGGGTAGG + Exonic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147652209 17:42069125-42069147 GAGGCTGCTGCAGAGAGGGTAGG + Intergenic
1151322644 17:73361034-73361056 GGGCGTTCTGCGGAGGGGGTGGG + Intronic
1152119129 17:78407227-78407249 GGGGCTGCTGCTGAGCAGAGGGG + Intronic
1152226193 17:79094008-79094030 GGGGCTGCAGCAGTGCGGGTGGG + Intronic
1152448815 17:80363545-80363567 GGGGCCTCTGGTGGGCCGGTGGG + Intronic
1153043313 18:834019-834041 GGGAATTATGCTGAGGGGGTTGG + Intergenic
1153781101 18:8495741-8495763 GGGGCTCCTGCAGAGAGGGCAGG - Intergenic
1157281423 18:46348539-46348561 TGGGCTACTGCTGGGAGGGTGGG + Intronic
1157666469 18:49491942-49491964 GGGGTTTCTGTAGAGCGGGAGGG - Intronic
1158517115 18:58139822-58139844 GTGGCTACAGCTGAGCAGGTGGG + Intronic
1160715034 19:572695-572717 GGGGCTGGTGAGGAGCGGGTAGG + Exonic
1161283078 19:3456277-3456299 GGGGTGTCTGCTGAGAGGGAAGG - Intronic
1161344169 19:3759774-3759796 GGGGCCTCTGCTGAGCAGGAGGG - Exonic
1161494896 19:4581429-4581451 GGGGCGTCTGCGGAGGGGGTTGG - Intergenic
1161952795 19:7477134-7477156 GCGGCTTCTGCTTTGCGGGAAGG + Exonic
1162731571 19:12721797-12721819 GGGGTTACTGCTGACAGGGTCGG - Intronic
1162909047 19:13839815-13839837 GGAGCTTCTGCTGAGAGTCTGGG - Intergenic
1162930619 19:13955809-13955831 AGGGCTGGGGCTGAGCGGGTAGG - Intronic
1163182797 19:15615865-15615887 GGGGCTCAGGCTGAGGGGGTGGG + Intronic
1165056018 19:33176751-33176773 GGGGGTTCTCCGGAGTGGGTAGG + Intergenic
1165246254 19:34500134-34500156 CGGGCTGCAGCTGAGCGGGGAGG + Exonic
1166855796 19:45782154-45782176 GGGGCTCCTGCAGATGGGGTGGG - Intronic
925404177 2:3595262-3595284 TGGGCTCCTGCTGAGCGAGGAGG + Intronic
926853610 2:17228159-17228181 GTGGCTTCTGCTCAGCGTCTGGG + Intergenic
927513426 2:23658472-23658494 GGGGCCTGTGCTGAGCAGCTGGG - Intronic
927930328 2:27039708-27039730 GGGGCCTCTGGTGAGCTGGGAGG - Intronic
931962678 2:67499730-67499752 AGGTCTCCTGCTGAGGGGGTTGG - Intergenic
933812082 2:86039070-86039092 GTGGCCTCAGCAGAGCGGGTAGG + Intronic
934888065 2:98041792-98041814 GGGACTTCTGCCGAGAGAGTAGG + Intergenic
942444808 2:176070899-176070921 AGGGCTGCTGCTGGGAGGGTGGG - Intergenic
944570817 2:201042591-201042613 GGGGCGGCTGCTGGGCGGATGGG - Intronic
947702789 2:232249181-232249203 TGGGCTTCTCCTAAGCGGGTTGG + Intronic
948814365 2:240502372-240502394 GAGGCTTCTGCTGAGATGTTGGG - Intronic
949031752 2:241800379-241800401 GGGGCTTACGCTGAACGGCTTGG + Intronic
1170106949 20:12762037-12762059 GGGGCTGCTACAGAGAGGGTTGG - Intergenic
1170171630 20:13419818-13419840 GGAGCGTCTGTTGAGCAGGTTGG - Intronic
1173699881 20:45060146-45060168 GGAGCTTGTGCTGAGCTGGAAGG + Intronic
1176140447 20:63542575-63542597 GGGCCTTCTGCAGGGAGGGTGGG + Exonic
1176260535 20:64177472-64177494 GGGGCTTCTGCTCCGGGGTTTGG - Intronic
1176308717 21:5138213-5138235 GAGGCGTCTGTTGAGCGGGGTGG - Intronic
1177057096 21:16319468-16319490 ATGGCTTCTGCTGAGTTGGTAGG - Intergenic
1178704810 21:34864439-34864461 GGGGCTGCTGCCGAGAGGGCCGG + Intronic
1179848342 21:44123819-44123841 GAGGCGTCTGTTGAGCGGGGTGG + Intronic
1179888587 21:44324975-44324997 GGGGCTGCTGAGGAGCGGCTGGG + Intronic
1181037522 22:20177111-20177133 GTGGCTCCTGCTGAGCGCCTGGG + Intergenic
1181633118 22:24161771-24161793 GGGGCTTCTGCTGTGGCAGTTGG + Intronic
1182652876 22:31866221-31866243 GGTGCTGCTGCTGAGAGGTTTGG + Intronic
1183956419 22:41382763-41382785 GGGGCTTCTGCTGAGCGGGTGGG + Intronic
1184337429 22:43862112-43862134 GGGGCTTCTGCTGGGCCGGGTGG - Intronic
1184639374 22:45861145-45861167 GGGGCTCCTGCAGAGTGGGGTGG + Intergenic
1185211551 22:49573397-49573419 GGGCCTTCTGCTGAGAAGGGTGG + Intronic
1185375090 22:50478967-50478989 GTGGCAGCTGCTGAGGGGGTGGG - Intergenic
1185420291 22:50731087-50731109 GCGGCTTCTGCTGGAAGGGTCGG - Intergenic
950399661 3:12760280-12760302 GTGGCAGCTGCTGAGCGGGGAGG - Intronic
950630059 3:14276427-14276449 GGGACTTCTGCTGAGATGCTGGG - Intergenic
952178550 3:30893802-30893824 GGGGCATCTGCTCAACAGGTAGG - Intronic
952389620 3:32868939-32868961 GAGGCTTCTGCTGAGGGTTTGGG + Intronic
954419965 3:50413493-50413515 GAGGCCTCTGCTGGGAGGGTGGG + Intronic
955059908 3:55485412-55485434 GGGTCTTCCGTTGAGAGGGTCGG + Intronic
957355595 3:79081488-79081510 GGGGCTTCTGTTGAGGGAGAAGG + Intronic
960155207 3:114291766-114291788 GGGGCTGGTGTTGAGTGGGTGGG + Intronic
960955368 3:123027422-123027444 GGCGCTTCCCCTGCGCGGGTTGG - Intronic
961530379 3:127536803-127536825 GGGGTGTCTGCTGTGGGGGTGGG + Intergenic
961830635 3:129621363-129621385 GGGGTTGGTGCTGGGCGGGTGGG - Intergenic
962202467 3:133413073-133413095 GAGGCTTCTGGTGAGAGGGCTGG + Intronic
963338089 3:144000598-144000620 GGGGAATCTGTTGAGAGGGTAGG - Intronic
963923772 3:150930152-150930174 GGGGCTGTTACTGAGAGGGTGGG + Intronic
967699208 3:192571783-192571805 GGGGCTGCTGCTGAGGAAGTTGG - Intronic
967870728 3:194226799-194226821 GGGGCCTCTGCTGGGCGCTTAGG + Intergenic
967941613 3:194770755-194770777 TGGGTTTCTGCTGGGCGGGAGGG - Intergenic
968603184 4:1520083-1520105 GGGGCTTCTGCCTAGCGGAGGGG + Intergenic
968819903 4:2843084-2843106 GAGGCTCCTGCTGAGCAGGGAGG + Intergenic
968934804 4:3604437-3604459 GGAGCTGCTGCTCTGCGGGTGGG + Intergenic
970384625 4:15543719-15543741 GGGGCTTCTGCTGAGGCTGATGG + Intronic
975899736 4:79138130-79138152 GGGGCCTCTGGTGAGGGGGAAGG + Intergenic
981712733 4:147724975-147724997 AGGGCTGGTGCTGAGCAGGTAGG + Intergenic
984655014 4:182308227-182308249 GGGTCATCTGCTGAGGGGGTTGG - Intronic
992182046 5:74207092-74207114 GGCGCTTGTGCTCAGCTGGTAGG - Intergenic
995784931 5:115817399-115817421 GGGGCTTTTTCTGAGGGGATAGG + Intergenic
1000251830 5:159503186-159503208 GGGGATTCAGCTGAGCAGCTGGG - Intergenic
1001239597 5:170057921-170057943 GGAGCTTCTGTTGGGTGGGTGGG + Intronic
1001690726 5:173630812-173630834 GGGGCTTCCGGTGTGTGGGTGGG - Intergenic
1002447833 5:179300963-179300985 GGGGCTTGTGCTCAGTGTGTGGG - Intronic
1006520272 6:34567309-34567331 GGTGCTTCGGCTGGGCGGGGGGG - Intergenic
1006984005 6:38166050-38166072 GAGGGCTCTGCTGTGCGGGTGGG - Intergenic
1006984016 6:38166081-38166103 GAGGGCTCTGCTGTGCGGGTGGG - Intergenic
1006984027 6:38166112-38166134 GAGGGCTCTGCTGTGCGGGTGGG - Intergenic
1006984120 6:38166413-38166435 GAGGGCTCTGCTGTGCGGGTGGG - Intergenic
1006984131 6:38166444-38166466 GAGGGCTCTGCTGTGCGGGTGGG - Intergenic
1013208873 6:107969092-107969114 GGGGCTTGTGCTGGGGAGGTGGG + Intergenic
1017036984 6:150275659-150275681 GAGGCTGCTGCTGAGCTGCTCGG + Intergenic
1019120702 6:169801503-169801525 GGGGTTGCTGCGGAGCGGGCAGG + Intergenic
1019174536 6:170153560-170153582 GGGCCTTCTGCAGAGCTAGTGGG - Intergenic
1019558041 7:1642237-1642259 GGGGCTTCTGCGGAGAGGAAGGG - Intergenic
1019729359 7:2622015-2622037 GGGGCTGCAGCTGAGCAGGTGGG + Intergenic
1022655760 7:32318358-32318380 GGTGCTTGGGCTGAGCGGTTTGG - Intergenic
1023912213 7:44564227-44564249 GGGGCTTTTGCTGTGGGGTTAGG - Intergenic
1025275713 7:57580167-57580189 GGAGCTTCTGCTGATGGGCTGGG + Intergenic
1027059418 7:75073680-75073702 GGGGCGGCGGCTGAGCGGGCCGG - Exonic
1029735839 7:102465312-102465334 GGGGCTCCCGGCGAGCGGGTGGG - Intronic
1029809065 7:103028153-103028175 GGGGGTTATACTGAGTGGGTGGG - Intronic
1031973801 7:128081566-128081588 GGGGCCTCTGCCCAGTGGGTGGG + Intronic
1032002122 7:128272158-128272180 GGGAAATTTGCTGAGCGGGTGGG - Intergenic
1032125358 7:129189122-129189144 GGGGCTTTTGCTGAGTTGGCGGG + Exonic
1033667454 7:143455634-143455656 GGAGCTTCTGCTCATGGGGTTGG + Intergenic
1034457099 7:151176489-151176511 GGGGCTGCGGTTTAGCGGGTGGG + Intronic
1034499620 7:151440983-151441005 GGGGCTTCTGCTGGAGGGGAGGG + Intergenic
1034700154 7:153088488-153088510 GGGGCTTAGGCTGAGCAGGGAGG + Intergenic
1034967585 7:155400736-155400758 GGGGCTTCTGCAGAGGGAGTGGG - Intergenic
1035152504 7:156886279-156886301 GGGATTTATGCTGAACGGGTTGG + Intronic
1035742335 8:1937816-1937838 TGGGCTTGGGTTGAGCGGGTTGG + Intronic
1036552653 8:9828748-9828770 CAGGCTTCAGCAGAGCGGGTGGG - Intergenic
1037782483 8:21879902-21879924 GGTGCTTCTGCAGAAGGGGTGGG - Intergenic
1040414352 8:47183269-47183291 GAGGCAGCTGCTGAGTGGGTCGG + Intergenic
1044223651 8:89698823-89698845 GGGGCGGCTGCTGGGCGGATGGG - Intergenic
1047217467 8:122888041-122888063 GGGGCTCCTGCTGTGTGGCTTGG - Intronic
1047731356 8:127731488-127731510 GGAGCTGCTGCTGAGTGGGTTGG - Intergenic
1048092954 8:131261083-131261105 AGGCCTTCTGCTGAGGGAGTGGG - Intergenic
1048131581 8:131703648-131703670 CTGGCTTCTGCTGAGAGGGAAGG - Intergenic
1048574482 8:135680004-135680026 GGGGTGTCTGCTCAGCGGGTTGG + Intergenic
1049360276 8:142209502-142209524 GTGGCTGCTGCTGAGCGGAAGGG + Intergenic
1049479883 8:142816905-142816927 GGGGCGTCTGCAGAGCAGATGGG - Intergenic
1052837842 9:33264806-33264828 GGGGCCTCAGTTGAGTGGGTGGG - Intergenic
1053817559 9:41928604-41928626 GGGGCTACTTCTGAGAGGGGTGG - Intronic
1054455369 9:65427541-65427563 GGAGCTGCTGCTCTGCGGGTGGG - Intergenic
1056285378 9:85082355-85082377 GGTGCTTCTGCTAAGCAGTTTGG + Intergenic
1056693656 9:88828326-88828348 AGGGCATCTGCTGAGTGGGAAGG + Intergenic
1057287757 9:93774180-93774202 CTGGCTTCTGCTGAGATGGTTGG - Intergenic
1057873616 9:98736277-98736299 GGTGCTTCTGCTTGGCAGGTTGG - Exonic
1060478991 9:124006831-124006853 TGGGCGTCAGCTGAGCAGGTTGG - Intronic
1061177674 9:129007426-129007448 GGGGCTTCTGAAGAGGGGATCGG - Intronic
1062027539 9:134347470-134347492 CGGGCTTCTGCCGAGCAGGAGGG + Intronic
1062064965 9:134521814-134521836 GGGGCCTCTGCTGGAGGGGTGGG + Intergenic
1062303254 9:135887702-135887724 AGGGCATCTGCTGAGTGGGAGGG + Intronic
1062403013 9:136380632-136380654 GGGGCTGCGGTGGAGCGGGTGGG + Intronic
1062462117 9:136666366-136666388 GGGGCTGCTGCCGGGCAGGTGGG + Intronic
1185464530 X:346611-346633 GGGGCTTCTGCGGACGGGGCGGG - Intronic
1185906438 X:3937960-3937982 TGGGCTTGGGGTGAGCGGGTGGG + Intergenic
1188606138 X:32032724-32032746 GGGGCTTCTAGTGAGCATGTTGG - Intronic
1192420788 X:71028339-71028361 TGGGCTTAGGCTGAGAGGGTGGG + Intergenic
1192452690 X:71253673-71253695 GGGGCTCCTGCAGAGTGGGGAGG - Intronic
1199770688 X:150973457-150973479 GGGGCTTCCCCTGAGGAGGTGGG + Intergenic
1199996842 X:153031035-153031057 TGGGCGTCTGCTGGGCGCGTGGG - Intergenic
1200044932 X:153396404-153396426 TGGGCGTCTGCTGGGCGCGTGGG + Intergenic
1200060995 X:153483736-153483758 GGGGATTCTGCTGGGTGGGAGGG - Intronic