ID: 1183958961

View in Genome Browser
Species Human (GRCh38)
Location 22:41399445-41399467
Sequence ACTGTGATGAAGGGGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183958961 Original CRISPR ACTGTGATGAAGGGGGTGTC TGG (reversed) Intergenic
900392548 1:2440026-2440048 CCTGTGGAGAAGGGGGAGTCAGG + Intronic
902766512 1:18619782-18619804 AGTGTGGTGAAGGGGTTTTCTGG - Intergenic
903269958 1:22181787-22181809 ACTCTGATGAAGAGGGAGTTAGG - Intergenic
906085210 1:43127125-43127147 ATAGTGATGAATGAGGTGTCTGG + Intergenic
906490377 1:46263672-46263694 ACAGTGATGAAGCAGATGTCAGG - Intronic
909576704 1:77184378-77184400 CCTGGGATGAAGGGGAGGTCAGG + Intronic
913174886 1:116264279-116264301 ACTGGAATGAAAGGGCTGTCAGG - Intergenic
915602722 1:156932340-156932362 ACTGGGATGCTGGGGATGTCTGG + Intronic
918178619 1:182067144-182067166 ACTGTTCTGCAGGGGGTGCCAGG - Intergenic
920560597 1:206935773-206935795 ACTGTGGTGAAGGGGGTGGCAGG - Exonic
924721662 1:246628718-246628740 AGTGTGAAGAAGGGGGTATCTGG - Intronic
924825515 1:247534010-247534032 AAGGTGAGGAAGGGGGTGTGTGG - Intronic
1063054079 10:2484422-2484444 GCTGTGATGAAGGGACTGTGTGG + Intergenic
1063781679 10:9332143-9332165 GCTGGGATGGAGGGGGTGCCTGG - Intergenic
1063876281 10:10482779-10482801 AGTTAGATGAAGGGGGTGGCTGG - Intergenic
1067194884 10:44108634-44108656 ACTGAGATGATGGGGTTTTCTGG + Intergenic
1069885027 10:71618331-71618353 CCTGTGATGCAGGGTGTGTCAGG - Intronic
1070791795 10:79193991-79194013 AGGCTGATGAAGGGGCTGTCTGG + Intronic
1071158957 10:82724239-82724261 ACTGAGATGAAAGGGAGGTCTGG - Intronic
1074370318 10:112895397-112895419 ACTGTGATGAGTGGAGAGTCAGG + Intergenic
1075083509 10:119399105-119399127 TCTGAGCTGATGGGGGTGTCTGG - Intronic
1076932886 10:133545539-133545561 ACTGCCAAGAAGGGGTTGTCTGG + Intronic
1077413278 11:2413313-2413335 ACTGGGATGCAGGGGCTGTGGGG + Intronic
1077994322 11:7440161-7440183 ACAGTGATGAATGGTGTGTTTGG + Intronic
1080409454 11:32009978-32010000 ATTTTGGTGAAGGGTGTGTCGGG + Intronic
1082989001 11:59191363-59191385 ACTATGCTGAAGGGGGAGGCGGG - Intronic
1084696161 11:70756720-70756742 ACTGAGATGATAGGGGTGTGGGG - Intronic
1085199247 11:74691814-74691836 ACTCTGATGGAGGAGGTGGCAGG + Intergenic
1089598591 11:119598639-119598661 ACAGGGTTGAAGGGGATGTCAGG + Intergenic
1089893252 11:121902163-121902185 ACTGACATGAAGGAGCTGTCAGG - Intergenic
1090333586 11:125948590-125948612 ACTGTGGTGGGGGGGCTGTCAGG + Intergenic
1091265542 11:134268404-134268426 ATTGTGATGAATGAGGGGTCTGG + Intergenic
1094635905 12:32227068-32227090 ACTGTGAAGGAGGAGGTGGCTGG + Intronic
1094716001 12:33015978-33016000 ACTGTGATGAAGGATGAGGCTGG + Intergenic
1096116586 12:49059034-49059056 GTTGTGATGAAGGGGGTAGCTGG - Intronic
1096590348 12:52654804-52654826 ACTGTGATGATGAGGCTGTAAGG - Intergenic
1097854860 12:64451963-64451985 ACGGTAATGAGGGGGATGTCTGG - Exonic
1102568979 12:113815828-113815850 ACTGTCCTGAAGGTGGTCTCAGG + Intergenic
1102886794 12:116528246-116528268 TCTTTGATGATGGGGGTGTAGGG + Intergenic
1102924318 12:116815244-116815266 ACTGTCATGAGGGTAGTGTCAGG - Intronic
1104098933 12:125588164-125588186 ACGGTGAGGAAGGTGGAGTCAGG - Intronic
1104420145 12:128628196-128628218 ACTGTGAGGAAGGGGCTCCCAGG - Intronic
1104445245 12:128827774-128827796 ACTTTCATGACTGGGGTGTCCGG + Intergenic
1105954693 13:25269317-25269339 ATTGTGATAAAGGAGGTATCAGG - Intronic
1106394341 13:29366047-29366069 ACTATAATGAAGGGGCTGTCAGG + Intronic
1106423230 13:29601292-29601314 GCTGTGATGAAGGGGGTATATGG + Intergenic
1107725268 13:43292861-43292883 GCTGTGATGAAGATGGTGACTGG - Intronic
1110666924 13:78127777-78127799 AGTGAGATGAAGGAGGTATCAGG - Intergenic
1111431188 13:88150062-88150084 AATGTCATGAAAGTGGTGTCTGG - Intergenic
1111983335 13:95039980-95040002 ACCATGATGAAAGGGGTGTACGG + Intronic
1117941724 14:60973990-60974012 ACTGTGATGAGTGGTTTGTCTGG + Exonic
1118602839 14:67482524-67482546 ACTGTAGTGATGGGGGTGGCTGG - Intronic
1121529895 14:94644853-94644875 AATGGGATGGAGGGGGTGTGTGG + Intergenic
1129480021 15:75816240-75816262 CCTGTGATGACTGGAGTGTCTGG + Intergenic
1129685304 15:77682735-77682757 ACTGTGTGGATGGGGGTGGCTGG - Intronic
1129827646 15:78645104-78645126 AGTCTGATGAAGGAGGTGGCTGG - Intronic
1129861055 15:78862031-78862053 TCTGTAATAATGGGGGTGTCTGG - Intronic
1130017033 15:80195626-80195648 TTTGTTATGAAGGGGGTGTTTGG - Intergenic
1130733245 15:86521512-86521534 ACTCTGATCAAGGGGGCCTCAGG + Intronic
1130923425 15:88367541-88367563 ACGGTGAAAAAGAGGGTGTCAGG - Intergenic
1133207099 16:4240324-4240346 ACTGTCATGATGGGGGCGTGAGG + Intronic
1134433814 16:14236520-14236542 AATGTGATGATGGGGGTGCTGGG + Intronic
1135541120 16:23331126-23331148 GCTGTGTTGAAGAGGGTGGCAGG + Intronic
1138398998 16:56730463-56730485 ACAGTGGGGAAGGGGGAGTCGGG - Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1138857816 16:60715804-60715826 TCTGTGATAAAGGGTGTTTCAGG + Intergenic
1140603473 16:76506313-76506335 ACTGTGATTCAGGGGGTGTGGGG + Intronic
1141524987 16:84605235-84605257 GCTGGGGTGCAGGGGGTGTCAGG + Intronic
1144058133 17:11559309-11559331 ACTGTGATGTGCGGGGTCTCGGG + Exonic
1145015752 17:19397032-19397054 ACTGAGATGACTGGGATGTCAGG - Intergenic
1146263657 17:31437470-31437492 ACTGAGAAGAAGCGGGTGCCTGG + Intronic
1146721523 17:35127367-35127389 TCAAAGATGAAGGGGGTGTCCGG - Exonic
1147995777 17:44359725-44359747 ACTCAGATGGAGGGGGTGCCTGG - Intronic
1149519771 17:57309958-57309980 ACGGTGATGATGGGGGTGCAGGG + Intronic
1150007463 17:61478735-61478757 ACAGAGATGAAGGAGGTCTCTGG - Exonic
1153478079 18:5518351-5518373 ACTGTCCTGAAGGGCGTGTGAGG - Intronic
1157060325 18:44280693-44280715 ACTATGATGGAAGGGGTGTGAGG - Intergenic
1158200319 18:54932059-54932081 GCTGTGAGGAAGGGTGTCTCAGG - Intronic
1160726398 19:619653-619675 ACGGTGATGACGGTGGTGTACGG - Exonic
1161608904 19:5229941-5229963 AGGGTGAAGAAGAGGGTGTCTGG - Intronic
1161644455 19:5444537-5444559 ACTGTGGGGATGGGGGTGGCAGG - Intergenic
1162740878 19:12772912-12772934 CCTGGGGAGAAGGGGGTGTCAGG + Exonic
1165461174 19:35945125-35945147 ACTCTGATGGGGAGGGTGTCGGG + Exonic
1167159346 19:47756917-47756939 ACTGAAAGGCAGGGGGTGTCAGG + Intronic
925001558 2:406979-407001 GTTGTCAGGAAGGGGGTGTCAGG - Intergenic
925726929 2:6882136-6882158 TCTGTGATGAAGGGAGGGGCTGG - Intronic
928312698 2:30223642-30223664 GCTGTTATGAAGGGAGTGTGGGG + Intergenic
934623519 2:95831039-95831061 AATGTGATTATGGGGGTGTGTGG + Intergenic
935296411 2:101653545-101653567 ATTGTGATGAATGAGGGGTCTGG - Intergenic
937813300 2:126222454-126222476 ACTGTGATGAAGTGGGAGGTAGG - Intergenic
940137601 2:150456509-150456531 ATGGTGATGAAGGGGGTTTATGG + Intergenic
940803716 2:158160798-158160820 ACTGAGATGAAGTGGGTTTGAGG + Intergenic
941350887 2:164433724-164433746 ACTGAGCTGAAGGGGGTATGAGG - Intergenic
942606577 2:177698129-177698151 ACTTTGATGAAGTGTGTGGCAGG + Intronic
947682770 2:232050882-232050904 ACAGAGATGAAGGAGGTGTATGG + Intronic
948321184 2:237071092-237071114 GCTGTGATTAAGGTGTTGTCTGG - Intergenic
949053381 2:241909957-241909979 ACTGTGAGGACGGGGGTGGACGG + Intergenic
1174784766 20:53422037-53422059 ACTGTGAGAAATGGGGTGGCGGG - Intronic
1177279147 21:18956574-18956596 AATGTGAGGAAGGAAGTGTCAGG - Intergenic
1177996268 21:28103255-28103277 TCTGAGAGGAAGGAGGTGTCAGG + Intergenic
1178353113 21:31887095-31887117 ACTATGTTGAATGGGTTGTCTGG + Intronic
1179661505 21:42879000-42879022 ACTGGGAAGAAGCGGGTCTCGGG - Intronic
1180144737 21:45912852-45912874 ACTGTGGGGAAGGGGATGTGGGG - Intronic
1180226721 21:46397874-46397896 ACTGTGATGAGGGGGGTATTTGG + Intronic
1183614910 22:38938161-38938183 TCAGTGATGAACTGGGTGTCAGG + Intergenic
1183958961 22:41399445-41399467 ACTGTGATGAAGGGGGTGTCTGG - Intergenic
949370563 3:3329855-3329877 GCTGTGAGGCAGGGGGTTTCAGG + Intergenic
949818666 3:8090742-8090764 AATGTGATTAATGGAGTGTCTGG - Intergenic
950217843 3:11172176-11172198 ATTCTGAGGAAGGGAGTGTCAGG + Intronic
951941354 3:28082245-28082267 GGTGTGATGAAGGCTGTGTCTGG - Intergenic
952576845 3:34784522-34784544 ACTGTTTTGGAGGGGGTGTGAGG - Intergenic
952902836 3:38121210-38121232 AGTGTGATGCAGGGGCTGCCAGG + Intronic
954270001 3:49500359-49500381 ACTGGGAGGAAGGGAGTGCCTGG + Intronic
956746706 3:72316504-72316526 ACTGAGAAGAAAGGGGTGTGGGG - Intergenic
959646882 3:108713214-108713236 TGTGTGATGAATGGGGTCTCAGG + Intergenic
961477154 3:127154646-127154668 AGTGTGATGAAGTGTGTGTGGGG + Intergenic
961884132 3:130084710-130084732 GCTGAGATGAAGGGATTGTCAGG + Intronic
963834926 3:150048477-150048499 AGTGGGTGGAAGGGGGTGTCTGG - Intronic
968544779 4:1193319-1193341 CCAGTGATGAAGGGTGTGTGGGG - Intronic
969183613 4:5460022-5460044 ACTCTGAAGGAGGGGGTCTCAGG - Intronic
969442947 4:7227946-7227968 GCTGTGAGGCAGGGGGTGGCGGG + Intronic
971134820 4:23856792-23856814 TCGGTGATGAAGGGAGAGTCCGG - Intronic
975802914 4:78081113-78081135 ACTGTGAGGATGGGGGTTTGTGG + Intronic
977744720 4:100532731-100532753 ACTGTGGTGGAGAGGGAGTCTGG - Intronic
979225255 4:118277890-118277912 AATTGGATGAAGGGGGTGTGGGG - Intergenic
979474094 4:121134810-121134832 ACTGTGAGGAAGGGTGTGGCTGG - Intronic
981157167 4:141451980-141452002 TCTGTGGTAAAGGGGGTGTTGGG + Intergenic
982296733 4:153836665-153836687 ACTGTGATGGAGGAAGTGACAGG - Intergenic
983905406 4:173176343-173176365 ACTCAGATGATGGGGGTGTGTGG + Intronic
988052541 5:26049634-26049656 ACTCTGATTGAAGGGGTGTCAGG - Intergenic
989173233 5:38494304-38494326 GCTGGGCTGAAGGGGTTGTCTGG + Intronic
991005199 5:61822054-61822076 AATGTGATCAAGGGGATGCCAGG + Intergenic
991986611 5:72293878-72293900 TCTGTGATGAAGGGTGTATTTGG - Intronic
992327114 5:75671133-75671155 ACTATGATGATGGTGGTGACAGG + Exonic
998025526 5:138812542-138812564 CTTGTGATGAAGGTAGTGTCTGG + Intronic
999132951 5:149298649-149298671 ACTGTGATGAAGCTGGTCTTTGG + Intronic
999234935 5:150084884-150084906 TCTGAGATGAAGGGGGTGGCGGG + Intronic
999331522 5:150676756-150676778 TCCGGGATGAAGGGGGTGCCTGG - Exonic
999496228 5:152101052-152101074 ACTATGATGGTGGGGGTGTCGGG - Intergenic
1000166153 5:158650640-158650662 ACTGTGAAGAAGAGTGTGGCTGG - Intergenic
1000369869 5:160524711-160524733 TCTGTGATGAATGGGCTCTCTGG + Intergenic
1002090479 5:176802680-176802702 ACGGTCATGCAGCGGGTGTCTGG + Intergenic
1003729277 6:8802817-8802839 ACTGTGCTCAAGGGGTAGTCAGG - Intergenic
1003926464 6:10882135-10882157 ACTGTGGTGGAGGGGGCGACCGG - Intronic
1004336269 6:14767328-14767350 ACTGAGAGGAAGGGAGTGTTTGG + Intergenic
1005340059 6:24835407-24835429 AATGTGATTAAGGGGGTGGGGGG - Intronic
1005940165 6:30554974-30554996 ACTGTGAGGAAGGAGGGGTCTGG - Intronic
1007304451 6:40893189-40893211 ACAGAGATGAAGGGCGTGGCGGG - Intergenic
1011498353 6:87961064-87961086 GCTTTGGTTAAGGGGGTGTCTGG + Intergenic
1015261472 6:131242655-131242677 ACTGTGATAAAGTGGGCCTCAGG + Intronic
1016332241 6:142965657-142965679 ACAGTGATGATGGGGGTTTGGGG - Intergenic
1016526951 6:145012186-145012208 ACTGTGGAGATGAGGGTGTCGGG + Intergenic
1017011643 6:150067700-150067722 TCTGTGATGAGGGGTGTGGCTGG + Intronic
1017064920 6:150519674-150519696 ACTGTGAGCAAGGGGGTGTGTGG + Intergenic
1018442850 6:163828929-163828951 ACTGGGATGATGGTGATGTCTGG + Intergenic
1019467137 7:1196108-1196130 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1019467174 7:1196218-1196240 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1019467233 7:1196398-1196420 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1019467258 7:1196470-1196492 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1019467282 7:1196542-1196564 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1019467310 7:1196614-1196636 GCTGTGATGAAGGGGGGGGTGGG + Intergenic
1019467348 7:1196723-1196745 GCTGTGATGAAGGGGGGGGTGGG + Intergenic
1019467362 7:1196759-1196781 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1019467375 7:1196793-1196815 GCTGTGATGAAGGGGGGGTGGGG + Intergenic
1020559593 7:9714056-9714078 ACTGTGATGAGGGGTCTGTATGG + Intergenic
1022682249 7:32559840-32559862 ACTGTGATAAAGCGAGTCTCAGG + Intronic
1024095785 7:45981346-45981368 GCTGTGTTGAAGGTGGTGCCGGG + Intergenic
1028676711 7:93472450-93472472 ACTGTGATGAAAAAGGTGTTTGG - Exonic
1028952793 7:96655692-96655714 GCTGTGATGAAAGGGGTATGGGG - Intronic
1029729451 7:102429827-102429849 AAGGTGATGATGGGGTTGTCAGG + Intergenic
1030678575 7:112409838-112409860 ACTTTACTGAAGGAGGTGTCAGG - Intergenic
1031545285 7:123044544-123044566 ACTGTGATGAGGAGGGTCTTTGG - Intergenic
1032891522 7:136199910-136199932 ACGGAGATGCAGGGGCTGTCAGG + Intergenic
1033050979 7:138003811-138003833 AATGTGATGAAGGGGATACCAGG - Intronic
1034514639 7:151565776-151565798 GCTTTGATGATGGGAGTGTCTGG + Exonic
1039395196 8:37219834-37219856 ACTGTGCTGAAGGAGGTGAAAGG - Intergenic
1040959778 8:53019326-53019348 CCAGTGAGGAAGGGTGTGTCAGG - Intergenic
1045970912 8:108079135-108079157 ACTATTTTGAAGGGGGAGTCAGG + Intronic
1046782381 8:118229739-118229761 TCTGTAATGAAGGGGGAGACTGG - Intronic
1047462511 8:125080606-125080628 ACTGTCAAGAAGGAGGAGTCAGG - Intronic
1048831080 8:138478158-138478180 CCTGAGATGCAGGGAGTGTCAGG - Intronic
1049569968 8:143364921-143364943 ACTGTGATGAATGGAGTAACAGG - Intergenic
1052804108 9:32997456-32997478 ATTGGGAGGAAGGAGGTGTCAGG + Intronic
1056994857 9:91446167-91446189 ACAGTGGTGATGGGGGTTTCAGG + Intergenic
1057051573 9:91928075-91928097 AGTGTGATGCAGGAGGTGGCGGG - Intronic
1058067581 9:100566429-100566451 ACTGAGATGAAGAAGGTGGCAGG - Intronic
1061271077 9:129543067-129543089 ACTGTGATGCTGGCGGTGGCAGG - Intergenic
1061297217 9:129683197-129683219 ACTGTTATGAAGGGAGTCCCAGG - Intronic
1185757793 X:2665875-2665897 ACTGAGGTGAGGGGGGTGGCTGG - Intergenic
1185845898 X:3438112-3438134 ACTGTGATGAAGCTTGTGGCTGG + Intergenic
1187224132 X:17359608-17359630 ACTCTGCTGGAGGGGGTGTCTGG - Intergenic
1188425770 X:30045001-30045023 CCTGTGATGATGGGTGTATCAGG - Intergenic
1190593742 X:52032353-52032375 TCTGTGCTGACGTGGGTGTCAGG - Intergenic
1194583807 X:95708709-95708731 ACTGTGATGAAGGAGTGATCTGG + Intergenic
1195262736 X:103149535-103149557 ACTGTGAAGAATGGTTTGTCTGG + Intergenic
1195550152 X:106159941-106159963 ACTGTGATGAGGTAGTTGTCAGG + Intergenic
1195552812 X:106187273-106187295 ACTGTAATGATGGGGTTGTGAGG + Intronic
1197809664 X:130429994-130430016 ACTTTGATGAAGGGGTTTTCGGG + Intergenic
1200224950 X:154412151-154412173 ACGGTGATGAGGGGCGTGGCCGG - Exonic