ID: 1183959409

View in Genome Browser
Species Human (GRCh38)
Location 22:41402273-41402295
Sequence GGCTGATGAAAGCTCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183959409_1183959413 21 Left 1183959409 22:41402273-41402295 CCCTCAGGGAGCTTTCATCAGCC No data
Right 1183959413 22:41402317-41402339 CAACCATGCGTCCTGATGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183959409 Original CRISPR GGCTGATGAAAGCTCCCTGA GGG (reversed) Intergenic
No off target data available for this crispr