ID: 1183959413

View in Genome Browser
Species Human (GRCh38)
Location 22:41402317-41402339
Sequence CAACCATGCGTCCTGATGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183959409_1183959413 21 Left 1183959409 22:41402273-41402295 CCCTCAGGGAGCTTTCATCAGCC No data
Right 1183959413 22:41402317-41402339 CAACCATGCGTCCTGATGCCCGG No data
1183959411_1183959413 0 Left 1183959411 22:41402294-41402316 CCTCTCACTTAAGCAAATCCTCG No data
Right 1183959413 22:41402317-41402339 CAACCATGCGTCCTGATGCCCGG No data
1183959410_1183959413 20 Left 1183959410 22:41402274-41402296 CCTCAGGGAGCTTTCATCAGCCT No data
Right 1183959413 22:41402317-41402339 CAACCATGCGTCCTGATGCCCGG No data
1183959406_1183959413 30 Left 1183959406 22:41402264-41402286 CCCAGCCAGCCCTCAGGGAGCTT No data
Right 1183959413 22:41402317-41402339 CAACCATGCGTCCTGATGCCCGG No data
1183959407_1183959413 29 Left 1183959407 22:41402265-41402287 CCAGCCAGCCCTCAGGGAGCTTT No data
Right 1183959413 22:41402317-41402339 CAACCATGCGTCCTGATGCCCGG No data
1183959408_1183959413 25 Left 1183959408 22:41402269-41402291 CCAGCCCTCAGGGAGCTTTCATC No data
Right 1183959413 22:41402317-41402339 CAACCATGCGTCCTGATGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183959413 Original CRISPR CAACCATGCGTCCTGATGCC CGG Intergenic
No off target data available for this crispr