ID: 1183960676

View in Genome Browser
Species Human (GRCh38)
Location 22:41410211-41410233
Sequence ACTTGGGGGCACAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183960664_1183960676 6 Left 1183960664 22:41410182-41410204 CCCTCCTGCCATCTGGGCTTCAG No data
Right 1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG No data
1183960667_1183960676 -2 Left 1183960667 22:41410190-41410212 CCATCTGGGCTTCAGACTCCCAC No data
Right 1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG No data
1183960666_1183960676 2 Left 1183960666 22:41410186-41410208 CCTGCCATCTGGGCTTCAGACTC No data
Right 1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG No data
1183960665_1183960676 5 Left 1183960665 22:41410183-41410205 CCTCCTGCCATCTGGGCTTCAGA No data
Right 1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG No data
1183960660_1183960676 23 Left 1183960660 22:41410165-41410187 CCATCTGATGATCCTTGCCCTCC No data
Right 1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG No data
1183960659_1183960676 24 Left 1183960659 22:41410164-41410186 CCCATCTGATGATCCTTGCCCTC No data
Right 1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG No data
1183960663_1183960676 11 Left 1183960663 22:41410177-41410199 CCTTGCCCTCCTGCCATCTGGGC No data
Right 1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183960676 Original CRISPR ACTTGGGGGCACAGGGAAGC TGG Intergenic
No off target data available for this crispr