ID: 1183964650

View in Genome Browser
Species Human (GRCh38)
Location 22:41434494-41434516
Sequence CTAGGGGAACAGATGGTGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1204
Summary {0: 2, 1: 0, 2: 4, 3: 143, 4: 1055}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183964640_1183964650 4 Left 1183964640 22:41434467-41434489 CCCAGACTGGGCTGGCCCCTGAG 0: 2
1: 0
2: 1
3: 19
4: 286
Right 1183964650 22:41434494-41434516 CTAGGGGAACAGATGGTGCTGGG 0: 2
1: 0
2: 4
3: 143
4: 1055
1183964634_1183964650 30 Left 1183964634 22:41434441-41434463 CCGAGGATGAGGGAAACAAAGGG 0: 1
1: 0
2: 1
3: 30
4: 282
Right 1183964650 22:41434494-41434516 CTAGGGGAACAGATGGTGCTGGG 0: 2
1: 0
2: 4
3: 143
4: 1055
1183964641_1183964650 3 Left 1183964641 22:41434468-41434490 CCAGACTGGGCTGGCCCCTGAGA 0: 2
1: 0
2: 1
3: 17
4: 227
Right 1183964650 22:41434494-41434516 CTAGGGGAACAGATGGTGCTGGG 0: 2
1: 0
2: 4
3: 143
4: 1055

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183964650 Original CRISPR CTAGGGGAACAGATGGTGCT GGG Exonic
900478651 1:2887858-2887880 CTAGGGGCACACAGGGGGCTAGG - Intergenic
900723739 1:4200309-4200331 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
900859178 1:5214130-5214152 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
901538437 1:9899006-9899028 TTTGGGGAACAGGTGGTGTTTGG + Intronic
902366431 1:15977513-15977535 TTTGGGGAACACATGGTGTTTGG + Intergenic
902967797 1:20022286-20022308 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
903176081 1:21581645-21581667 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
903285079 1:22271664-22271686 CCAGGGGAACAAATGGTTCCAGG + Intergenic
903496210 1:23769306-23769328 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
904850023 1:33451841-33451863 TTTGGGGAACAGATGGTGTTTGG - Intergenic
904988888 1:34575676-34575698 ATCGGGGAACAGGTGGTGTTTGG - Intergenic
905255682 1:36681657-36681679 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
905303133 1:36999086-36999108 TCAGGGGAACAGATGGGGCATGG + Intronic
906252493 1:44321452-44321474 CTTGGGGAACAGAAGGTCCAGGG - Intronic
907964245 1:59313923-59313945 TTTGGGGAACAGGTGGTGTTCGG - Intronic
907965208 1:59322320-59322342 TTTGGGGAACAGGTGGTGTTTGG + Intronic
908246844 1:62234060-62234082 CTGGGCGAACATAGGGTGCTGGG - Intergenic
908604699 1:65783564-65783586 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
908614242 1:65899997-65900019 TTGGGGGAACAGGTGGTGTTTGG - Intronic
908692540 1:66798799-66798821 CTAGGTGAACAGATGCTGGTTGG + Intronic
908883944 1:68766067-68766089 TTGGGGGAACAGATGATGTTTGG - Intergenic
909060482 1:70873589-70873611 TTGGGGGAACAGGTGGTGTTTGG + Intronic
909144062 1:71906355-71906377 TTAGGGGAACAGATGGTGTTTGG - Intronic
909473756 1:76058851-76058873 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
909592455 1:77366019-77366041 TTCGGGGAACAGGTGGTGTTTGG - Intronic
909827876 1:80148417-80148439 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
909860595 1:80600220-80600242 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
910233662 1:85012211-85012233 TTTGGGGAACAGATAGTGTTTGG - Intronic
910270821 1:85392018-85392040 TTTGGGGAACAGGTGGTGTTTGG + Intronic
910355080 1:86344050-86344072 CTTGGGGAACAGGTGGTGTTTGG + Intergenic
910899143 1:92100949-92100971 GTGGGGGAACAGGTGGTGTTTGG + Intronic
911523423 1:98956372-98956394 TTAGGGGAACAGGTGGTGTTTGG + Intronic
911739541 1:101371875-101371897 TTGGGGTAACAGATGGTGTTTGG + Intergenic
911818949 1:102391549-102391571 TTAAGGGAACAGGTGGTGTTTGG - Intergenic
911898149 1:103466335-103466357 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
912193561 1:107370379-107370401 TTAGGGGAACAGGTGGTACTTGG + Intronic
912284517 1:108354810-108354832 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
912692975 1:111818591-111818613 CCAGGGGAACAGATGGAGTGCGG + Intronic
912962136 1:114205716-114205738 TTTGGGGAACAGATGGTGTTTGG - Intergenic
913540285 1:119813304-119813326 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
913587555 1:120290495-120290517 ATTGGGGAACAGATGGTGTTTGG + Intergenic
913620630 1:120607874-120607896 ATTGGGGAACAGATGGTGTTTGG - Intergenic
914377887 1:147089124-147089146 CTGGGGGAACAGGTGGTATTTGG - Intergenic
914569573 1:148902379-148902401 ATTGGGGAACAGATGGTGTTTGG + Intronic
914603255 1:149227877-149227899 ATTGGGGAACAGATGGTGTTTGG - Intergenic
915486561 1:156225323-156225345 TTTGGGGAACAGGTGGTGTTTGG + Intronic
915768637 1:158394033-158394055 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
915835843 1:159173749-159173771 CAATGGGAACTGATGGTGCTAGG + Intronic
915952963 1:160202109-160202131 CTGGGAGAACAGAGAGTGCTAGG + Intergenic
916266540 1:162895904-162895926 TTTGGGGAACAGGTGGTGTTCGG + Intergenic
916331170 1:163618891-163618913 TTTGGGGAACAGATGGTGTTTGG + Intergenic
916917792 1:169428526-169428548 TTGGGGGAACAGGTGGTGTTTGG + Intronic
917609670 1:176674285-176674307 TTTGGGGAACAGGTGGTGTTTGG + Intronic
917649075 1:177058713-177058735 TTTGGGGAACAGATGGTGTTTGG + Intronic
917716881 1:177747349-177747371 CCAGGGGAGCTGATGGTGCAGGG - Intergenic
917837620 1:178953584-178953606 CTTGGGGGGCAGGTGGTGCTTGG - Intergenic
917913054 1:179671615-179671637 TTTGGGGAACAGGTGGTGTTTGG + Intronic
918202591 1:182281026-182281048 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
918889855 1:190253010-190253032 CTATGAGAACATATGGTGTTTGG + Intronic
918960005 1:191262449-191262471 TTTGGGGAACAGCTGGTGTTTGG + Intergenic
919160685 1:193826228-193826250 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
919407579 1:197203820-197203842 TTAGGGGAACAGGTGGTATTTGG + Intergenic
919721338 1:200839815-200839837 TTAGGGGAACAGGTGGTGTTTGG - Intronic
919988603 1:202693014-202693036 TTGGGGGAACAGATGGTGTTTGG + Intronic
920185504 1:204156761-204156783 CTGGGAGGACAGATTGTGCTGGG - Exonic
920341372 1:205277041-205277063 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
920522794 1:206641102-206641124 TTTGGGGAACAGGTGGTGTTTGG + Intronic
920864506 1:209740708-209740730 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
921001221 1:211045383-211045405 ATTGGGGAACAGGTGGTGTTTGG - Intronic
921001494 1:211048807-211048829 TTTGGGGAACAGGTGGTGTTTGG - Intronic
921316894 1:213900522-213900544 TTGGGGGAACAGGTGGTGCTTGG + Intergenic
922889771 1:229052704-229052726 TTTGAGGAACAGATGGTGTTTGG - Intergenic
922978161 1:229802204-229802226 TTGGGGGAACAGATGGTGTTTGG - Intergenic
923000894 1:230005556-230005578 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
923990651 1:239433485-239433507 TTTGGGGAACAGGTGGTGTTTGG + Intronic
924114790 1:240734586-240734608 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
924251204 1:242134819-242134841 CTATGAGAACCAATGGTGCTGGG - Intronic
924257282 1:242194993-242195015 TTTGGGGAACAGGTGGTGTTTGG - Intronic
924512958 1:244742859-244742881 ATTGGGGAACAGATGGTATTTGG + Intergenic
924789632 1:247233157-247233179 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
924879661 1:248146322-248146344 TTTGGGGAACAGATGGTGTTTGG + Intergenic
924917185 1:248583083-248583105 TTTGGGGAACAGTTGGTGTTTGG + Intergenic
1062998130 10:1887895-1887917 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1063069949 10:2651343-2651365 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1063081299 10:2770267-2770289 ATAGGGGAACAGGTGGTGTTTGG - Intergenic
1063242408 10:4184731-4184753 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1063470507 10:6280827-6280849 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1063532180 10:6844164-6844186 CTAGGAGAACACATGCTGCCTGG + Intergenic
1063821293 10:9839391-9839413 TTGGGGGAACAGATGGTGTTTGG - Intergenic
1063872077 10:10428531-10428553 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1064070391 10:12223888-12223910 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1064077649 10:12282533-12282555 TTAGGGGAACAGGTGGTGTTTGG + Intergenic
1064116385 10:12580913-12580935 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1064428838 10:15254245-15254267 GGAGGGGAAGAGGTGGTGCTTGG - Intronic
1064433069 10:15287789-15287811 TTAGGGGAACAGGTGGTGTTTGG + Intronic
1064476687 10:15697933-15697955 TTAGGGGAACAGGTGGTGTTTGG + Intronic
1064965188 10:21008444-21008466 TTTGGGGAACAGATGGTATTTGG + Intronic
1065158912 10:22898696-22898718 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1065259421 10:23909320-23909342 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1065894089 10:30146364-30146386 TTTGGGGAACAGGTGGTGGTTGG + Intergenic
1066170843 10:32843054-32843076 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1066710649 10:38230185-38230207 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1066979358 10:42397316-42397338 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1067422425 10:46165627-46165649 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1068047405 10:51905261-51905283 CTGGTGCAACAGATGGTCCTGGG + Intronic
1068098895 10:52527386-52527408 TTAGGGGAACAGGTGGTGTTTGG + Intergenic
1068114976 10:52727182-52727204 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1068177297 10:53477775-53477797 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1068406142 10:56592091-56592113 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1068565089 10:58565840-58565862 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1068912282 10:62391254-62391276 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1069229003 10:65982733-65982755 TTTGGGGAGCAGATGGTGTTTGG - Intronic
1069287144 10:66729758-66729780 TTGGGGGAACACATGGTGTTTGG - Intronic
1069938226 10:71934381-71934403 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1070421401 10:76241227-76241249 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1070859894 10:79645449-79645471 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1071015359 10:80990477-80990499 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1071023685 10:81087164-81087186 ACTGGGGAACAGGTGGTGCTTGG + Intergenic
1071303092 10:84272518-84272540 ACAGGTGAACAGATGGGGCTGGG - Intergenic
1071441539 10:85701932-85701954 GTTGGGGAACAGGTGGTGTTTGG - Intronic
1071488334 10:86118449-86118471 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1071801848 10:89072314-89072336 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1072803892 10:98412083-98412105 CATGGGGAACAGAGGGTGCCAGG + Intronic
1072873692 10:99148987-99149009 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1073820694 10:107260266-107260288 TTGGGGGAACAGCTGGTGTTTGG - Intergenic
1073877182 10:107938425-107938447 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1073923296 10:108483424-108483446 TTTGGGGAAGAGATGGTGTTTGG + Intergenic
1074731468 10:116381052-116381074 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1075005169 10:118824939-118824961 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1075071624 10:119323721-119323743 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1075494303 10:122906475-122906497 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1075510018 10:123064409-123064431 CTCGGAGAACAGTTGGTGCCTGG - Intergenic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1075660977 10:124196105-124196127 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1075886987 10:125908716-125908738 TTTGGGGAACAGATGGTGTTTGG - Intronic
1076077097 10:127542508-127542530 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1076338055 10:129723146-129723168 TTTGGGGAACAGATGGTATTTGG + Intronic
1076376377 10:129989941-129989963 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1076488737 10:130841525-130841547 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1076664983 10:132082253-132082275 ATTGGGGAACAGGTGGTGTTCGG + Intergenic
1076696177 10:132248471-132248493 CTAGGTGGACAGAGGGTCCTTGG - Intronic
1077682448 11:4255427-4255449 TTTGGGGAACAGATGGTTTTTGG - Intergenic
1077692753 11:4362500-4362522 TTTGGGGAACAGATGGTTTTTGG + Intergenic
1077833748 11:5904620-5904642 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1077975787 11:7247125-7247147 ATTGGGGAACAGGTGGTGTTTGG + Intronic
1078724200 11:13914182-13914204 TTTGGGGAACAGATGGTGTTTGG + Intergenic
1078903218 11:15660929-15660951 CTATGGGAAGAGCTGGGGCTGGG - Intergenic
1079015187 11:16862750-16862772 GTAGGGGAAGAGATGGTGATGGG - Intronic
1079270258 11:18977864-18977886 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1079582346 11:22081188-22081210 TTAGGGGAGAGGATGGTGCTGGG - Intergenic
1079862590 11:25692724-25692746 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1079984867 11:27189742-27189764 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1080021742 11:27568651-27568673 ATTGGGGAACAGATGGTGTTTGG - Intergenic
1080022124 11:27573221-27573243 CTATGGGAAAACATGGTGGTGGG + Intergenic
1080206410 11:29734640-29734662 TTGGGGGAACAGATAGTGCTTGG + Intergenic
1080691436 11:34561986-34562008 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1080724344 11:34880587-34880609 GTAGGGGAACAGCTGGTGGAAGG - Intronic
1080835480 11:35936659-35936681 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1081090593 11:38861404-38861426 TTTGGGGAACAGATGGTGTTTGG + Intergenic
1081232150 11:40598790-40598812 CTTGTGGAACAGAGGGTGCTGGG + Intronic
1081317127 11:41644205-41644227 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1081326254 11:41748760-41748782 TTTGAGGAACAGGTGGTGCTTGG + Intergenic
1081514764 11:43816642-43816664 ATTGGGGAACAGGTGGTGTTTGG + Intronic
1081846758 11:46246242-46246264 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1082728877 11:56770928-56770950 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1082772436 11:57218743-57218765 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1083046141 11:59736898-59736920 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1083078241 11:60063983-60064005 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1083529383 11:63405083-63405105 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1083537735 11:63486777-63486799 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1083703298 11:64495496-64495518 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1084578869 11:70009797-70009819 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1084930899 11:72554859-72554881 CTAGGAGAACAGGTGGTGTTTGG + Intergenic
1084972609 11:72780173-72780195 CCAGGGGACCAGATGGGGCAGGG - Intronic
1085115523 11:73928232-73928254 CTAGAGGAAGAGATGGTGGAGGG + Intergenic
1085751310 11:79163424-79163446 TTGGGGGAACAGGTGGTTCTTGG + Intronic
1085872470 11:80366928-80366950 ATTGGGGAACAAGTGGTGCTTGG + Intergenic
1085890012 11:80567389-80567411 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1085917664 11:80909183-80909205 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1086298070 11:85394024-85394046 TTTGGGGAACAGGTGGAGCTTGG - Intronic
1086299614 11:85412397-85412419 ATTGGGGAACAGGAGGTGCTTGG + Intronic
1086769978 11:90749866-90749888 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1086844891 11:91736555-91736577 TTTGGGAAACAGGTGGTGCTTGG - Intergenic
1087838390 11:102897584-102897606 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1088001368 11:104885562-104885584 TTTGGGGAACAGATTGTGTTTGG - Intergenic
1088061548 11:105657339-105657361 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1088217947 11:107534781-107534803 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1088386999 11:109269918-109269940 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1088581066 11:111317431-111317453 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1088661015 11:112046352-112046374 CGATGGGGAAAGATGGTGCTGGG - Intronic
1088981672 11:114870178-114870200 TTAAGGGGACAGATGGTGCAGGG + Intergenic
1089404747 11:118188121-118188143 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1089420073 11:118325356-118325378 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1089477342 11:118775342-118775364 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1089569232 11:119392015-119392037 TTAGGGGAACAGGTGGTATTTGG + Intergenic
1089819982 11:121215991-121216013 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1089837330 11:121382547-121382569 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1090104076 11:123833071-123833093 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1090221103 11:125026762-125026784 GTTGGGGAACAGATGGTTTTTGG + Intronic
1090403956 11:126466342-126466364 CTAGGGGCCCAGGAGGTGCTGGG - Intronic
1090559000 11:127909555-127909577 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1091728362 12:2861387-2861409 TTTGGGGAACAGGTGGTGTTTGG - Exonic
1092158252 12:6299126-6299148 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1092248696 12:6879188-6879210 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1092438202 12:8470863-8470885 TTGGGGGAACATATGGTGTTTGG - Intronic
1092506022 12:9101021-9101043 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1092628776 12:10356974-10356996 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1092647120 12:10587309-10587331 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1092705885 12:11284073-11284095 CTTGGGGAACAGGTGGTGTTTGG + Intergenic
1092710135 12:11327558-11327580 GTTGGGGAACAGGTGGTGTTTGG + Intergenic
1092713890 12:11368044-11368066 GTTGGGGAACAGGTGGTGTTTGG + Intronic
1092717603 12:11407229-11407251 GTTGGGGAACAGGTGGTGTTTGG + Intronic
1093001529 12:14002027-14002049 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1093011134 12:14108331-14108353 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1093506476 12:19872360-19872382 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1093940498 12:25048994-25049016 CAATGGGAATAAATGGTGCTGGG - Intronic
1094157910 12:27356780-27356802 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1094446761 12:30539387-30539409 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1094692391 12:32782726-32782748 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1095178415 12:39119457-39119479 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1095500543 12:42833420-42833442 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1095599183 12:43995555-43995577 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1095687929 12:45056617-45056639 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1096012309 12:48230259-48230281 TTGGGGGAACAGGTGGTACTTGG - Intergenic
1096190571 12:49615230-49615252 TTTGGGAAACAGATGGTGTTTGG - Intronic
1096564161 12:52462411-52462433 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1096889112 12:54748634-54748656 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1096963893 12:55608846-55608868 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1097088066 12:56483791-56483813 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1097102007 12:56596482-56596504 CTAGGGAAAGAGATGGAGCTGGG + Exonic
1097989083 12:65815635-65815657 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1098740478 12:74167819-74167841 TTTGGGGAACAGATAGTGTTTGG - Intergenic
1098882062 12:75926827-75926849 CCAGGGTGACAGCTGGTGCTAGG + Intergenic
1099248528 12:80222926-80222948 TTGGGGGAAGAGATGGTGTTTGG + Intronic
1099329838 12:81270038-81270060 TTTGGGGAACAGGTGGTGTTAGG - Intronic
1099430411 12:82577444-82577466 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1099441513 12:82705299-82705321 ATTGGGGAACAGATGGTCTTTGG - Intronic
1099545389 12:83973372-83973394 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1100085699 12:90907667-90907689 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1100139310 12:91597162-91597184 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1100421848 12:94442482-94442504 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1100537738 12:95526929-95526951 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1100706789 12:97209523-97209545 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1100906270 12:99303655-99303677 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1101267722 12:103108083-103108105 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1101290872 12:103367410-103367432 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1101295025 12:103413505-103413527 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1101520510 12:105478201-105478223 TTAGGAGAACAGATATTGCTGGG + Intergenic
1102366065 12:112335785-112335807 ATTGGGGAACAGGTTGTGCTTGG - Intronic
1102434860 12:112913970-112913992 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1102984345 12:117266133-117266155 TTTGGGGAACAGGTGGTGCTTGG + Intronic
1103046566 12:117739953-117739975 TTCGGGGAACAGGTGGTGTTTGG + Intronic
1103050588 12:117776049-117776071 TTTGGGGAACAGGTGGTACTTGG - Intronic
1103085009 12:118056085-118056107 CAAGGAGAACCGATGGTGCGGGG - Intronic
1103196406 12:119047357-119047379 TTTGGGGAACAGGTGGTGCTTGG + Intronic
1103247865 12:119473478-119473500 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1103248772 12:119481630-119481652 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1103378371 12:120474544-120474566 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1103642354 12:122361908-122361930 TTTGGGGAACAGATGGTGTTTGG - Intronic
1104183152 12:126402134-126402156 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1104329968 12:127835587-127835609 CTTGGAGAACAGGTGGTGTTTGG + Intergenic
1104524615 12:129507825-129507847 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1105524866 13:21167815-21167837 TTAGGGGAACAGATGGTGTTTGG - Intronic
1105763993 13:23540318-23540340 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1106247155 13:27960408-27960430 CTCTGGGAAGAGATGGGGCTTGG - Intergenic
1106350731 13:28928008-28928030 ATAGGGAAATAAATGGTGCTGGG + Intronic
1106425015 13:29619632-29619654 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1106770051 13:32953004-32953026 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1107251812 13:38372745-38372767 ATTGGGGAACAGATGGTGTTTGG - Intergenic
1107291196 13:38855846-38855868 TTAGGGGAACAGGAGGTGTTTGG - Intronic
1107557089 13:41526070-41526092 TTCGGGGAACAGGTGGTGTTTGG + Intergenic
1107700729 13:43045057-43045079 CAAGGGGAGCAGATCATGCTGGG - Intronic
1107701335 13:43051303-43051325 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1108062589 13:46548394-46548416 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1108151309 13:47537643-47537665 CTGGGGAAACAGGTGGTGTTTGG - Intergenic
1108189654 13:47924498-47924520 GGAGGGGAACAGGTGGTGTTTGG - Intergenic
1108240580 13:48459285-48459307 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1108300839 13:49074108-49074130 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1108563498 13:51670751-51670773 TTTGGGGAACAGGTGGTGCTTGG + Intronic
1108832131 13:54492747-54492769 TTTGGGGAACAGATGGTGTTTGG - Intergenic
1108902408 13:55428143-55428165 TTTGGGGAACAGCTGGTGTTTGG - Intergenic
1108996736 13:56743758-56743780 ATTGGGGAACAGATGGTGTTTGG + Intergenic
1109125882 13:58516455-58516477 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1109644431 13:65235031-65235053 TTGGGGGAACAGGTGGTGCTTGG + Intergenic
1109786924 13:67188810-67188832 TTAGGGGAACAGGTGGTATTTGG + Intronic
1109824690 13:67702796-67702818 TTGGGGGAACAGTTGGTGTTTGG - Intergenic
1109966164 13:69699224-69699246 TTAGGGGAACAGGTGGTGTTTGG - Intergenic
1110075285 13:71232641-71232663 TTGGGGGAACAGGTGGTGCTTGG + Intergenic
1110122516 13:71900856-71900878 TTGGGGGAACAGGTGGTGTTCGG + Intergenic
1110340165 13:74381040-74381062 TTATGGGAACAGGTGGTGTTTGG + Intergenic
1110428060 13:75391736-75391758 GTAGGGCATCAGATGGTGCAGGG - Intronic
1110605016 13:77422033-77422055 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1110675098 13:78233164-78233186 TTTGGGGAACAGATGGTGTTTGG - Intergenic
1110755760 13:79171990-79172012 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1110764065 13:79262973-79262995 TTGGGGGAACAGATGGTTTTTGG - Intergenic
1110793163 13:79607213-79607235 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1111021221 13:82454878-82454900 TTAGGGGAACAGGTAGTGTTTGG - Intergenic
1111192938 13:84832942-84832964 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1111638975 13:90943709-90943731 CTAAAGGAAAAGATGTTGCTTGG - Intergenic
1112088023 13:96052436-96052458 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1112582135 13:100685477-100685499 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1112655002 13:101442427-101442449 TTTGGGAAACAGATGGTGTTTGG - Intergenic
1112814648 13:103257886-103257908 TTTGGGGAACAGATGGTATTTGG + Intergenic
1113114687 13:106862825-106862847 ATGGGGGAACAGGTGGTGTTTGG - Intergenic
1113355016 13:109570753-109570775 CTTGGGGAACAGCTGGTGTTTGG + Intergenic
1113660972 13:112105971-112105993 CTAGGGGTAGAGATGGTGGCAGG + Intergenic
1113800570 13:113084344-113084366 CTGGGGGTACAGAAGGTTCTGGG - Intronic
1114277388 14:21159118-21159140 CCAGGGGAAAAGATGGCTCTGGG - Intergenic
1114466170 14:22924375-22924397 CTTAGGGTACTGATGGTGCTGGG - Exonic
1114514706 14:23290998-23291020 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1114545830 14:23499938-23499960 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1114750876 14:25203650-25203672 TTTGAGGAACAGATGGTGTTTGG + Intergenic
1114906594 14:27135735-27135757 TTAGGGGTACAAATGGTTCTTGG - Intergenic
1114952385 14:27771529-27771551 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1115306676 14:31940743-31940765 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1115392739 14:32871624-32871646 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1115937632 14:38572313-38572335 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1116494208 14:45540831-45540853 TTTGGGGAACAGATGGTATTTGG - Intergenic
1116836888 14:49777365-49777387 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1117192703 14:53308821-53308843 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1117315492 14:54567411-54567433 CGAGGGCATCAGAGGGTGCTGGG - Intronic
1117342202 14:54802167-54802189 TTTGGGGAACAGATGGTGTTTGG - Intergenic
1117406334 14:55407789-55407811 ATAGGGGAAAAGATGGAGGTGGG + Intronic
1117490607 14:56242968-56242990 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1117614550 14:57520102-57520124 TTAGGGGAACAGATGGTGTTTGG + Intergenic
1117825075 14:59693377-59693399 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1118098489 14:62567478-62567500 CTATGTGAAATGATGGTGCTGGG + Intergenic
1118142829 14:63103575-63103597 TTAGGGGAACAGGTGGTGTTTGG + Intergenic
1118189276 14:63565751-63565773 TTTGGGGAACAGATGGTGTTTGG - Intergenic
1118325431 14:64777368-64777390 CCAGGGAAACAGATGCAGCTAGG + Intronic
1118398240 14:65355717-65355739 CTAGGGGAGCAGTTGGTGCCTGG - Intergenic
1119582181 14:75795449-75795471 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1120252137 14:82070744-82070766 CTGGTGGAAAAGAAGGTGCTTGG - Intergenic
1120471686 14:84933623-84933645 TCGGGGGTACAGATGGTGCTTGG + Intergenic
1120785103 14:88526679-88526701 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1121281269 14:92700479-92700501 TTTGGGGAACAGGTGGTGTTGGG - Intergenic
1121475892 14:94202270-94202292 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1122207790 14:100156825-100156847 CTGGGGGAACAGCTTGTGCCGGG + Intronic
1122325009 14:100876596-100876618 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1122825586 14:104368980-104369002 GGAGGGGAGCAGATGGAGCTGGG - Intergenic
1202871125 14_GL000225v1_random:165293-165315 TTTGGGGAACAGATGGTGTTTGG + Intergenic
1123443374 15:20305251-20305273 CTAGGGGCAGAGCTGGTACTAGG + Intergenic
1124174914 15:27415623-27415645 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1124190138 15:27567544-27567566 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1125268845 15:37915659-37915681 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1125368022 15:38940033-38940055 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1125496041 15:40195009-40195031 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1126374625 15:47984584-47984606 TTTGGGGAACAGATAGTGTTTGG + Intergenic
1126691634 15:51293228-51293250 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1127442189 15:59020941-59020963 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1127505853 15:59597025-59597047 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1127810687 15:62562568-62562590 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1127970243 15:63953009-63953031 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1128009912 15:64283126-64283148 ATTGGGGTACAGATGGTGTTTGG - Intronic
1128131136 15:65227935-65227957 CTAGGGGAGGAGAGGGTGTTTGG + Intergenic
1128772336 15:70291755-70291777 CTAGGTGTGCAGAAGGTGCTTGG - Intergenic
1129249268 15:74299670-74299692 CTGGGGGACCCGATGGTGCCAGG - Intronic
1129463158 15:75710008-75710030 TTGGGGGGACCGATGGTGCTCGG - Intronic
1129632394 15:77275281-77275303 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1129721726 15:77881393-77881415 TTGGGGGGACCGATGGTGCTCGG + Intergenic
1129924622 15:79352185-79352207 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1130014242 15:80174913-80174935 CTAGGGGAGCAGGTGCTGCTGGG + Intronic
1131307215 15:91255586-91255608 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1131326351 15:91450556-91450578 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1131341923 15:91610631-91610653 CTTGGAAATCAGATGGTGCTAGG - Intergenic
1131469280 15:92682369-92682391 ATTGGGGAACAGATGGTGTTTGG + Intronic
1131505004 15:93009904-93009926 TTAGGGAAACAGGTGGTGTTTGG + Intronic
1131548448 15:93335343-93335365 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1131902070 15:97098877-97098899 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1132154909 15:99488834-99488856 TTTGGGGAACAGATGGTGTTTGG - Intergenic
1132297660 15:100753330-100753352 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1132708817 16:1257692-1257714 CGAGGGGAACACAGGGCGCTGGG - Intronic
1133676224 16:8075472-8075494 CTGGGGGAACATATGGAACTAGG - Intergenic
1133815966 16:9197623-9197645 TTAGGGGAACAGGTGGTGTTTGG + Intergenic
1134413300 16:14021447-14021469 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1134466543 16:14483866-14483888 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1134806410 16:17129590-17129612 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1134878159 16:17720618-17720640 GTAAGAGAACAGATGGTGGTTGG + Intergenic
1135162935 16:20113572-20113594 TTGGGGGAACAGATGGTGTTTGG - Intergenic
1135424061 16:22323652-22323674 CTAGGAGCAAAGATGCTGCTCGG - Intronic
1135644159 16:24146744-24146766 TTGGGGGAACAGATGTGGCTTGG + Intronic
1135973735 16:27091246-27091268 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1137368600 16:47883358-47883380 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1137529048 16:49265230-49265252 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1137739551 16:50754501-50754523 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1138848686 16:60599473-60599495 CCAAGGAAACAGATGGTTCTTGG - Intergenic
1139012740 16:62652905-62652927 CTCTGGGAACAGATGGCTCTTGG - Intergenic
1139245885 16:65443210-65443232 TTTGGGTAACAGGTGGTGCTTGG + Intergenic
1140679765 16:77373682-77373704 TTTGGGGGACAGATGGTGTTTGG - Intronic
1141066986 16:80921942-80921964 ATTGGGGAACAGATGGTATTTGG + Intergenic
1141129199 16:81423584-81423606 TTTGGGGAACAGGTGGTACTTGG - Intergenic
1141225975 16:82115148-82115170 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1143132705 17:4690391-4690413 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1143435011 17:6917591-6917613 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1143940510 17:10536282-10536304 TTTGGGGAACAGGTGGTGTTGGG - Intronic
1144120491 17:12147949-12147971 TTTGGGGAACAGGTGGTGGTTGG - Intergenic
1144161219 17:12560800-12560822 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1144194675 17:12879006-12879028 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1144246368 17:13369773-13369795 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1144298195 17:13899291-13899313 CCAGGGAGTCAGATGGTGCTGGG + Intergenic
1144504009 17:15814366-15814388 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1144633751 17:16889993-16890015 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1145167866 17:20629868-20629890 TTTGGGGAACAGATGGTGTTTGG - Intergenic
1145215669 17:21050216-21050238 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1145941955 17:28747291-28747313 CAAGGGCAACAGACTGTGCTTGG - Intronic
1146321299 17:31848735-31848757 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1146699850 17:34948071-34948093 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1147059878 17:37867010-37867032 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1148065922 17:44869732-44869754 CGAGGGAAAGAGATGGGGCTTGG - Intronic
1148270930 17:46261177-46261199 ATTGGGGAACAGCTGGTGTTTGG - Intergenic
1148409150 17:47449493-47449515 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1149052478 17:52323554-52323576 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1149117456 17:53115089-53115111 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1149279950 17:55092275-55092297 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1149392887 17:56209693-56209715 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1149717336 17:58805139-58805161 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1149874131 17:60213898-60213920 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1149960876 17:61108633-61108655 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1150087913 17:62291167-62291189 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1150431106 17:65118170-65118192 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1150469937 17:65428654-65428676 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1150516512 17:65816312-65816334 ATTGGGGAACAGGTGGTGTTTGG + Intronic
1150528943 17:65956744-65956766 TTTGGGGCACAGGTGGTGCTTGG - Intronic
1150902754 17:69299815-69299837 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1150911488 17:69392263-69392285 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1151375877 17:73688789-73688811 TTAGGGAAACAGATGGCCCTGGG + Intergenic
1151876171 17:76869240-76869262 CTGGGGGAACGGATGGCGTTGGG + Intronic
1153012597 18:553015-553037 ATTGGGGAACAGATGGTGTTTGG - Intergenic
1153402991 18:4701688-4701710 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1153406313 18:4744262-4744284 TTTGGGGAACAGATGGTGTTTGG - Intergenic
1153425589 18:4959928-4959950 TTTGGGGAACAGCTGGTGTTTGG - Intergenic
1153660943 18:7325732-7325754 CTGAGGGAACAGAAGGTGCAAGG + Intergenic
1155225213 18:23723904-23723926 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1155375259 18:25150398-25150420 TTAGGGAAACAGGTGGTGTTTGG - Intronic
1155433170 18:25783225-25783247 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1155641335 18:28019259-28019281 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1156081210 18:33338855-33338877 TTTGGGGAACAGGTGGTGTTGGG - Intronic
1156217440 18:35014204-35014226 CTAAGGGAAGAGAAGGTGGTAGG + Intronic
1156327617 18:36088228-36088250 TTTGGGGAACAGATGGTGTTTGG - Intergenic
1156368337 18:36449945-36449967 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1156643414 18:39129717-39129739 TTTGAGGAACAGATGGTGTTTGG - Intergenic
1156851289 18:41729972-41729994 TTTGGGGAACAGATGGTGTTTGG + Intergenic
1157045061 18:44092653-44092675 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1157144465 18:45147637-45147659 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1157219519 18:45817233-45817255 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1157452607 18:47799777-47799799 CTAGGGGAGAAGAAGGTGCAGGG + Intergenic
1157680455 18:49601492-49601514 CTACGGGAACAGGAGGTGCAAGG + Intergenic
1157718727 18:49907159-49907181 CTGGGGGAACTGAAGGTGATTGG + Intronic
1157945572 18:51975985-51976007 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1158003134 18:52642438-52642460 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1158112152 18:53952136-53952158 CTCAGGGAACAGCTGGTGCTGGG + Intergenic
1158171327 18:54603934-54603956 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1158387288 18:57009409-57009431 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1158692476 18:59672971-59672993 TTTGGGGAACAGGTGGTACTTGG - Intronic
1159109055 18:64035466-64035488 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1159612379 18:70540225-70540247 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1159735868 18:72097370-72097392 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1159787870 18:72736889-72736911 TTTGGGGAACAGATGGTGTTTGG + Intergenic
1160111653 18:76037781-76037803 CTATGGGAACAGATAATGCAGGG - Intergenic
1160177708 18:76609409-76609431 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1160219301 18:76961029-76961051 ATTGGGGAACAGATAGTGTTTGG + Intronic
1161315745 19:3616635-3616657 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1162349133 19:10138246-10138268 CTAGGGAAGCAGATGATGCAGGG + Intronic
1162875308 19:13616908-13616930 TAAGGGGAACAGATGGTACAGGG + Intronic
1162941592 19:14013497-14013519 ATTGGGGAACAGGTGGTGCCTGG - Intergenic
1163828065 19:19534934-19534956 GTAGGGGAAGGGATGGGGCTTGG - Intronic
1163889293 19:19996788-19996810 TTAGGGGAACGGGTGGTGTTTGG - Intergenic
1164267969 19:23639359-23639381 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1164677879 19:30113983-30114005 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1164850131 19:31475402-31475424 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1164944837 19:32284720-32284742 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1164946061 19:32294098-32294120 ATTGGGGAACAGATGGTGTTTGG + Intergenic
1165177049 19:33938184-33938206 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1165927489 19:39335934-39335956 CTATGGGAAGAGCTGGGGCTGGG - Intronic
1165988278 19:39789834-39789856 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1166709941 19:44930394-44930416 GTAGGGGAACAGATAGGGCAAGG + Intergenic
1167128073 19:47565273-47565295 TTGGGGGAACAGGTGGTACTCGG - Intergenic
1168123573 19:54270137-54270159 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1168178901 19:54646191-54646213 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1168475704 19:56673573-56673595 CTAGGGGAACAGATGGTGCTGGG + Intergenic
925167886 2:1729676-1729698 TTTGGGGAACAGGTGGTGTTTGG - Intronic
925321108 2:2969590-2969612 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
925417834 2:3684443-3684465 TTGGGGGAACAGGTGGTGTTTGG + Intronic
925602542 2:5623831-5623853 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
925651719 2:6097557-6097579 TTTGGGGAACAGTTGGTGCTTGG + Intergenic
925961735 2:9023503-9023525 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
926622252 2:15057456-15057478 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
926866496 2:17365048-17365070 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
926869261 2:17394500-17394522 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
927080353 2:19622293-19622315 TCTGGGGAACAGATGGTGTTTGG - Intergenic
927249549 2:20985304-20985326 CTAGGGGAACTGCAGGGGCTCGG + Intergenic
927701293 2:25270536-25270558 CCTGGGGAACAGCTGGAGCTGGG + Intronic
927785222 2:25969450-25969472 TTGGGGGAACAGGTGGTGTTTGG - Intronic
928050155 2:27984719-27984741 TTTGGGGAACAGGTGGTGTTTGG + Intronic
928175348 2:29029917-29029939 ATTGGGGAACAGGTGGTGGTTGG - Intronic
928472255 2:31586072-31586094 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
928826136 2:35423500-35423522 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
929013329 2:37469832-37469854 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
929057657 2:37892249-37892271 CTTGGGCAACCGATGGTGCCAGG - Intergenic
929197633 2:39202302-39202324 TTTGGGGAACAGGTGGTGTTTGG - Intronic
929399179 2:41560322-41560344 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
929407095 2:41655238-41655260 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
929725713 2:44424880-44424902 ATTGGGGAACAGGTGGTGTTTGG - Intronic
930807391 2:55504582-55504604 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
930814803 2:55584370-55584392 GTTGGGGAACAGGTGGTGTTTGG + Intronic
930836369 2:55798096-55798118 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
931161399 2:59695103-59695125 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
931554201 2:63481857-63481879 TTGGGGGAACAGGTGGTGTTTGG - Intronic
931758994 2:65399935-65399957 TTGGGGGAACAGGTGGTGTTTGG - Intronic
931835212 2:66091924-66091946 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
932944721 2:76214395-76214417 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
933149192 2:78893746-78893768 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
933398704 2:81764846-81764868 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
933494569 2:83032901-83032923 TTTGGGGAACAGATGATGTTTGG + Intergenic
933601354 2:84334677-84334699 TTGGGGGAACAGATGGTGTTTGG - Intergenic
934020035 2:87939480-87939502 CTGTGTGACCAGATGGTGCTAGG - Intergenic
934050236 2:88204242-88204264 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
934484926 2:94697785-94697807 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
934579000 2:95423342-95423364 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
934600447 2:95653361-95653383 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
934675116 2:96244354-96244376 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
935007614 2:99095362-99095384 TTTGGGGAACAGATGGTGTTTGG - Intronic
935163746 2:100551537-100551559 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
935261324 2:101358285-101358307 ATAAGGGACCAGATGGGGCTGGG - Intronic
936087967 2:109482400-109482422 CTTTGGCAACAGATGGAGCTGGG - Intronic
936347398 2:111685721-111685743 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
936486723 2:112932035-112932057 CTAGAGGAAAAAATGATGCTTGG + Intergenic
936533807 2:113295422-113295444 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
936614567 2:114035308-114035330 TTTGGGGAACAGATGGGGTTTGG + Intergenic
936702123 2:115024124-115024146 TTTGGGGAACAGGTGGTGTTTGG - Intronic
936771880 2:115923612-115923634 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
936858330 2:116986870-116986892 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
936894961 2:117417008-117417030 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
936963353 2:118100235-118100257 CTAGGGGAAGGCAAGGTGCTGGG - Intronic
937290305 2:120777937-120777959 CTGGGGGTACAGAAGTTGCTGGG + Intronic
937483661 2:122291114-122291136 CTTGGGGAACAGGTGGTGTTTGG - Intergenic
937663529 2:124458636-124458658 ATTGGGGAACAGGTGGTGTTTGG - Intronic
937699066 2:124842929-124842951 TTGGGGGAACAGGTGGTGTTTGG + Intronic
937722552 2:125120262-125120284 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
937793469 2:125987992-125988014 TTGGGGGAACAGATGGTGTTTGG + Intergenic
937828461 2:126393679-126393701 ATTGGGGAACAGATGGTGTTTGG + Intergenic
938037214 2:128045195-128045217 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
938809593 2:134840788-134840810 ATTGGGGAACAGGTGGTGTTTGG + Intronic
938853502 2:135286096-135286118 TTGGGGGAACAGGTGGTGTTTGG + Intronic
939087301 2:137736888-137736910 ATTGGGGAACAGATGGTGTTTGG - Intergenic
939150326 2:138464878-138464900 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
939329639 2:140740625-140740647 TTGGGGGAACAGGTGGTGTTTGG - Intronic
939442589 2:142268947-142268969 CTAGTGTAACAGGTGGTGGTCGG + Intergenic
939534907 2:143416092-143416114 ATTGGGGAACAGGTGGTGTTTGG - Intronic
939744643 2:145953646-145953668 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
939919606 2:148092778-148092800 TTGGGGGAACAGGTGGTGTTTGG - Intronic
940045133 2:149401736-149401758 TTTGGGGAACAGGTGGTGTTTGG + Intronic
940125787 2:150322563-150322585 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
940423169 2:153502113-153502135 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
940585476 2:155643267-155643289 CCATGGGAACAGATGGTGCAAGG - Intergenic
940796176 2:158081919-158081941 TTTGGGGAACAGGTGGTGTTTGG + Intronic
940964291 2:159820647-159820669 TTTGGGGAACAGGTGGTGGTTGG - Intronic
941079593 2:161045276-161045298 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
941119950 2:161516974-161516996 TTTGGGGAACAGGTGGTGTTTGG + Intronic
941401538 2:165037338-165037360 TTAGGGGAACAGGTGGTGTTTGG + Intergenic
941738111 2:169002980-169003002 TTTGGGGAACAGGTGGTGTTGGG + Intronic
942275135 2:174315955-174315977 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
942326547 2:174781286-174781308 CTATGGGTACCGCTGGTGCTGGG + Intergenic
942666697 2:178327126-178327148 TTTGGGGAACAGGTGGTGTTTGG - Intronic
943119960 2:183723601-183723623 ATTGGGGAACAGTTGGTGTTTGG - Intergenic
943607255 2:189990733-189990755 TTTGGGGAACAGATGGTGTTTGG + Intronic
944346960 2:198679707-198679729 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
944350400 2:198719696-198719718 GCTGGGGAACAGATGGTGTTTGG + Intergenic
944431483 2:199638361-199638383 ATTGGGGAACAGCTGGTGTTTGG + Intergenic
944960390 2:204865751-204865773 TTTGGGGAACAGGTGGTGTTTGG - Intronic
945128832 2:206544087-206544109 TTTGGGGAACAGGTGGTGTTGGG - Intronic
945337554 2:208610719-208610741 TTGGGGGAACAGGTGGTGTTTGG + Intronic
945377091 2:209091620-209091642 CTGGGAGAACAGGTGGTGTTTGG + Intergenic
946312269 2:218888949-218888971 TCTGGGGAACAGATGGTGTTTGG + Intronic
946435163 2:219646584-219646606 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
946446739 2:219746473-219746495 CGATGGGAACAGATGCTGGTGGG + Intergenic
946544411 2:220721919-220721941 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
946715677 2:222552892-222552914 ATTGGGGAACAGGTGGTGGTTGG - Intronic
946729553 2:222695788-222695810 TTTGGGGAACAGGTGGTGTTTGG + Intronic
946768087 2:223058881-223058903 ATTGGGGAACAGGTGGTGTTTGG - Intronic
946933232 2:224692515-224692537 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
947046956 2:225998576-225998598 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
947163236 2:227235470-227235492 ATTGGGGAACAGGTGGTGTTTGG + Intronic
947317876 2:228881574-228881596 CTAGGGAAACTGATGGGACTTGG + Intronic
947907325 2:233775033-233775055 CTAGGGAAGGAGATGGAGCTGGG - Intergenic
948068580 2:235101509-235101531 TTAGGGGAACAGGTGATGTTTGG + Intergenic
948134841 2:235628644-235628666 ATTGGGGAACAGGTGGTGTTTGG + Intronic
948288429 2:236805859-236805881 TTAGGGGAACAGATGGTATTTGG + Intergenic
948387257 2:237588677-237588699 TTAGGGGAACAGGTGGTATTTGG - Intronic
948638882 2:239360640-239360662 CTAAGGGACCAGGTGGAGCTCGG - Intronic
1169188004 20:3635327-3635349 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1169528738 20:6460312-6460334 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1169753088 20:9015436-9015458 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1169840712 20:9933980-9934002 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1170726386 20:18931162-18931184 TTTGGGGAACAGGTGATGCTTGG + Intergenic
1171041170 20:21765028-21765050 ATTGGGGAACAGATGGTGTTTGG + Intergenic
1171130475 20:22648124-22648146 ATTGGGGAACAGCTGGTGTTTGG + Intergenic
1171198087 20:23217080-23217102 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1171309391 20:24134444-24134466 CAAGGGGTGCAGATGGAGCTTGG + Intergenic
1171375026 20:24686581-24686603 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1171464903 20:25320445-25320467 ACAGGGGAACAGATGGGGGTGGG + Intronic
1171785701 20:29462788-29462810 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1172850875 20:37963212-37963234 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1173645723 20:44631998-44632020 CTAGGGGACGGGCTGGTGCTGGG - Intronic
1174332701 20:49832421-49832443 ATAGGGGACCAGAGGGCGCTTGG + Intronic
1174477633 20:50807528-50807550 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1174564808 20:51456993-51457015 CTCTGGGAACAGAGGGTGCCTGG - Intronic
1174590042 20:51637726-51637748 TTTGGGGAACACATGGTGTTTGG + Intronic
1174680209 20:52399341-52399363 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1174704354 20:52640402-52640424 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1174782340 20:53401418-53401440 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1174893760 20:54426771-54426793 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1175645316 20:60666053-60666075 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1176358125 21:5969663-5969685 CCAGAGGAACAGCTGGTGCTGGG + Intergenic
1176999719 21:15597214-15597236 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1177069094 21:16479958-16479980 TTTGGGGAACAGATAGTGTTTGG + Intergenic
1177460166 21:21398379-21398401 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1177882588 21:26711651-26711673 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1177935295 21:27337809-27337831 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1178091208 21:29165358-29165380 TTTGGGGCACAGGTGGTGCTTGG + Intronic
1178135249 21:29619598-29619620 TTAGGGGAACAGGTGGTATTTGG - Intronic
1178482560 21:32992049-32992071 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1178778345 21:35574535-35574557 TTTGGGGAACAGGTGGTGATTGG + Intronic
1178805123 21:35833111-35833133 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1178823506 21:35996041-35996063 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1179241176 21:39594328-39594350 ATTGGGGAACAGGTGGTGTTCGG - Intronic
1179280286 21:39928065-39928087 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1179765393 21:43568888-43568910 CCAGAGGAACAGCTGGTGCTGGG - Intronic
1180233470 21:46442222-46442244 CTAGGGGACCATATGGTCCACGG + Intronic
1181313228 22:21956684-21956706 CTAGTGGAGCAGGTGGGGCTGGG - Intergenic
1181454779 22:23052710-23052732 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1181724231 22:24800367-24800389 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1181967853 22:26669092-26669114 CTTGGGGAACAGAAGGTGGCAGG + Intergenic
1181978492 22:26749623-26749645 TTTGGGGAGCAGATGGTGTTTGG + Intergenic
1181979400 22:26755334-26755356 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1182199701 22:28555803-28555825 TTTGGGGAACAGTTGGTGTTTGG - Intronic
1182265926 22:29115400-29115422 CTTGGGGAACAGGTGGTGTTTGG - Intronic
1182324125 22:29498969-29498991 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1182848497 22:33451382-33451404 TTTGGGGAACAGGTGATGCTTGG + Intronic
1183230075 22:36576494-36576516 GTTGGGGAACAGGTGGTGTTTGG - Intronic
1183541025 22:38429533-38429555 CTACGGGGACAGCAGGTGCTGGG + Intronic
1183778514 22:39983703-39983725 CTGTGGGTACAGATGGTGGTGGG - Intergenic
1183945478 22:41323482-41323504 TTAAGGGACCAGGTGGTGCTTGG + Intronic
1183964650 22:41434494-41434516 CTAGGGGAACAGATGGTGCTGGG + Exonic
1184237861 22:43194662-43194684 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1184427515 22:44421599-44421621 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1185351553 22:50342324-50342346 CTAGGGGAAAAGCTTTTGCTGGG + Intergenic
949378445 3:3416717-3416739 TTTGAGGAACAGGTGGTGCTTGG - Intergenic
949469698 3:4381452-4381474 ATTGGGGAACAGGTGGTGTTTGG - Intronic
949916078 3:8965716-8965738 CTAGAGGAAGAGAGAGTGCTGGG - Intergenic
950341616 3:12251126-12251148 CTAGGGGGAGAGAGGGAGCTAGG + Intergenic
950342017 3:12255904-12255926 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
950789493 3:15461262-15461284 CTGTGGGACCAGATGGTGCTGGG - Intronic
950841491 3:15972704-15972726 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
951001594 3:17567373-17567395 TGATGGTAACAGATGGTGCTAGG - Intronic
951763738 3:26173491-26173513 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
951948816 3:28174776-28174798 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
952083369 3:29787803-29787825 TTGGGGTAACAGATGGTGTTTGG - Intronic
952182760 3:30935808-30935830 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
952265595 3:31783472-31783494 TTTGGGGAACAGGTGGTGTTGGG - Intronic
952460065 3:33515187-33515209 TTTGAGGAACAGATGGTGTTTGG - Intronic
952475983 3:33711182-33711204 CTAGGGCAACTGAAGGTGTTTGG - Intronic
952703668 3:36353434-36353456 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
952999342 3:38917873-38917895 TTGGGGGAACAGGTGGTACTTGG - Intronic
953103423 3:39852411-39852433 TTTGTGGAACAGGTGGTGCTTGG + Intronic
953277221 3:41513929-41513951 TTTAGGGAACAGGTGGTGCTTGG - Intronic
953880479 3:46688775-46688797 CTAGGGCACCTGATGGTGCCGGG - Intronic
954932117 3:54293225-54293247 TTTGGGGAACAGGTGGTGTTTGG + Intronic
955026695 3:55174374-55174396 CTAGGGGAAAAGATGAGCCTGGG + Intergenic
955355599 3:58229032-58229054 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
955706942 3:61737535-61737557 CTTGGGGAATAGATGGCGATGGG + Intronic
955802306 3:62698987-62699009 TTTGGGGAACAGGTGGTGTTTGG + Intronic
956099201 3:65749639-65749661 TTGGGGGAACAGATGGTATTTGG - Intronic
956224719 3:66944438-66944460 TGAGGGGAACAGGTGGTGTTTGG - Intergenic
956240852 3:67128585-67128607 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
956383013 3:68686049-68686071 CTGGGGGAAAGGATGGTGGTGGG - Intergenic
956507591 3:69959131-69959153 TTGGGGGAACAGGTGGTGCTTGG - Intronic
956570625 3:70690509-70690531 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
956984090 3:74676703-74676725 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
957152657 3:76505704-76505726 CTAGGGGAAAAAATGTTTCTTGG - Intronic
957384379 3:79476879-79476901 ATTGGGGAACAGGTGGTGTTTGG - Intronic
957471409 3:80662136-80662158 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
957516925 3:81267134-81267156 CTAGGGGAACAACTGGTACAAGG - Intergenic
957536437 3:81510699-81510721 TTTGGGGAACAGGTGGTGTTTGG - Intronic
958014313 3:87920367-87920389 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
958065273 3:88536814-88536836 TTAGGGGAACATGTGATGCTAGG - Intergenic
958661357 3:97071749-97071771 TGAGGGGAACAGGTGGTGTTTGG + Intronic
958672964 3:97228189-97228211 TTTGGGGAACAGGTGGTGTTTGG + Intronic
958739563 3:98052279-98052301 TTTGGGGAACAGTTGGTGTTTGG - Intergenic
958771168 3:98427789-98427811 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
959023053 3:101210092-101210114 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
959347615 3:105219035-105219057 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
959362388 3:105409672-105409694 TTTGGGGAACAGGTGGTGTTTGG - Intronic
959763062 3:109991764-109991786 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
959867523 3:111288214-111288236 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
960032999 3:113073613-113073635 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
960204287 3:114876157-114876179 ATTGGGGAACAGGTGGTGTTTGG + Intronic
960264677 3:115606827-115606849 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
960296632 3:115952684-115952706 TTTGGGGAACAGATGGTTTTTGG - Intronic
960517081 3:118614294-118614316 ATTGGGGAAGAGATGGTGTTTGG - Intergenic
960549024 3:118952924-118952946 TTTGGGGAACAGGTGGTGTTTGG + Intronic
960857385 3:122117084-122117106 TTTGGGGAACAGATGGTTTTCGG + Intronic
961116093 3:124331401-124331423 TTTGGGGAACAGGTGGTGTTTGG - Intronic
961159596 3:124712167-124712189 TTTGGGGAACAGGTGGTGTTTGG - Intronic
961407090 3:126687249-126687271 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
961996176 3:131246128-131246150 TTTGGGGAACAGTTGGTGTTTGG + Intronic
962144476 3:132825624-132825646 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
962709824 3:138076873-138076895 TTTGGGGAACAGGTGGTGTTTGG - Intronic
962999872 3:140669879-140669901 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
963176805 3:142306348-142306370 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
963490363 3:145992761-145992783 CTAAGAGACCAGGTGGTGCTAGG + Intergenic
963895291 3:150679253-150679275 TTTGGGGAACAGGTGGTGTTTGG + Intronic
963958854 3:151285649-151285671 TTGGGGGAACAGGTGGTGCTTGG - Intronic
964017830 3:151968924-151968946 TTAGGGGAACAGGTGGTGTTTGG - Intergenic
964076203 3:152695217-152695239 TTTGGAGAACAGATGGTGTTTGG - Intergenic
964394026 3:156226664-156226686 TTTGGGGAACAGGTGGTACTTGG - Intronic
964537689 3:157742633-157742655 ATTGGGGTACAGATGGTGTTTGG + Intergenic
964707109 3:159630835-159630857 TTTGGGGAACAGGTGGTGTTTGG - Intronic
964707531 3:159635356-159635378 CGAGGGGCAACGATGGTGCTTGG + Intronic
964841345 3:160996749-160996771 TTTGGGGAACAGGTGGTGTTTGG - Intronic
965132664 3:164721981-164722003 TTTGGGGAACAGATGGTGTTTGG + Intergenic
965296164 3:166949476-166949498 TTTGGGGAACAGATGGTGTTTGG + Intergenic
965454356 3:168879357-168879379 TTTGGGGAACAGATGGTGTTTGG - Intergenic
965940477 3:174173849-174173871 ATTGGGGAACAGGTGGTGTTTGG + Intronic
966220957 3:177550605-177550627 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
966546136 3:181151177-181151199 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
966628643 3:182047557-182047579 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
966686499 3:182701523-182701545 TTTGGGGAACAGATGGTATTTGG + Intergenic
966948224 3:184792677-184792699 ATTGGGGAACAGGTGGTGTTCGG + Intergenic
966958170 3:184906668-184906690 TTAGGGGAACAAATGGACCTGGG + Intronic
967205530 3:187117153-187117175 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
967250073 3:187528406-187528428 ATTGGGGAACAGATGGTGTTTGG - Intergenic
967439775 3:189493033-189493055 ATTGGGGAACAGTGGGTGCTTGG - Intergenic
968173657 3:196529936-196529958 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
968521311 4:1035951-1035973 CCAGGGGAAGAGACAGTGCTGGG + Intergenic
969324511 4:6433490-6433512 CCAGGGGAAGTGATGCTGCTGGG - Intronic
969546649 4:7834476-7834498 ATTGGGGAACAGGTGGTGTTTGG - Intronic
969566600 4:7982297-7982319 CTTGGGGCTCAGATGGTGCTGGG + Intronic
969835414 4:9836266-9836288 TTTGGGGAACAGGTGGTGTTTGG - Intronic
969901814 4:10356980-10357002 ATGGGGGTACAGGTGGTGCTTGG + Intergenic
970235193 4:13951867-13951889 CGAGTGGAAGTGATGGTGCTGGG - Intergenic
970284144 4:14490657-14490679 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
970458781 4:16252094-16252116 TTTGGGGAACAGGTGGTGCTTGG + Intergenic
970539553 4:17063790-17063812 TTTGGGGAACAGGGGGTGCTTGG - Intergenic
970548803 4:17157866-17157888 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
970563792 4:17311022-17311044 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
970818223 4:20183153-20183175 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
971014700 4:22475894-22475916 TTGGGGGAACAGGTGGTGTTTGG - Intronic
971276409 4:25201870-25201892 ATTGAGGAACAGATGGTGTTTGG - Intronic
971453550 4:26822477-26822499 TTAGGGAAACATATGGGGCTTGG - Intergenic
971509239 4:27403583-27403605 TTGGGGGAACAGATGGTGTTTGG - Intergenic
971643744 4:29168946-29168968 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
971852555 4:32001758-32001780 CTTGGGGAACAGGTGGTTTTTGG - Intergenic
971934311 4:33128005-33128027 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
972166172 4:36287002-36287024 TTAGGGGAACAGGTGGTGTTTGG + Intronic
972668148 4:41188120-41188142 CTAGGGGAACATGTGGAGGTTGG + Intronic
973226212 4:47787643-47787665 ATTGGGGAACAGGTGGTGTTTGG + Intronic
974133282 4:57783355-57783377 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
974276837 4:59731482-59731504 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
975068166 4:70096405-70096427 TTGGGGAAACAGATGGTGTTTGG + Intergenic
975204617 4:71630441-71630463 TTGGGGGAGCAGATGGTGTTTGG - Intergenic
975296865 4:72744710-72744732 ATAGGGCAACAGATGGTGACTGG - Intergenic
975397010 4:73887171-73887193 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
975613626 4:76224775-76224797 TTTGGGGAACAGGTGGTGTTTGG + Intronic
975714078 4:77188997-77189019 CCAGGGGAACAGGTGGTGAAAGG - Intronic
975790019 4:77938941-77938963 TTTGGGGAACAGGTGGTGTTTGG + Intronic
976157665 4:82164689-82164711 TTTGGGGAACAGATGGTGTTTGG - Intergenic
976191104 4:82487962-82487984 TTTGGGGAACAGGTGGTGTTTGG + Intronic
976209313 4:82651580-82651602 TTTGGGGAACAGGTGGTGTTTGG - Intronic
976445262 4:85123761-85123783 TTTGGGGAACAGATAGTGTTTGG + Intergenic
976556792 4:86459882-86459904 ATTGGGGAACAGGTGGTGTTTGG - Intronic
976562218 4:86514871-86514893 TTGGGGGAACAGGTAGTGCTTGG + Intronic
976664064 4:87571481-87571503 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
976791834 4:88887252-88887274 TTGGGGGAACAGGTGGTGTTTGG - Intronic
976903682 4:90209362-90209384 GTAGTGGAACAGATGGTGGAGGG + Intronic
976984108 4:91271290-91271312 ATTGGGGAACAGGTGGTGTTTGG + Intronic
977507362 4:97918931-97918953 TTTGGGGAACAGGTGGTGTTTGG - Intronic
977636003 4:99299359-99299381 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
977763339 4:100766902-100766924 CTTGGGGAACAGGTGGTTTTTGG - Intronic
977904798 4:102464624-102464646 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
978456244 4:108895746-108895768 TTGGGGGAACAGGTGGTGTTTGG + Intronic
978726037 4:111970665-111970687 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
978762319 4:112367165-112367187 TTTGGGGAACAGGTGGTGTTTGG - Intronic
978857994 4:113414991-113415013 ATTGAGGAACAGATGGTGTTTGG + Intergenic
978917053 4:114139956-114139978 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
978934951 4:114363360-114363382 TTGGGGGAACAGGTGGTACTTGG + Intergenic
978941068 4:114436358-114436380 TTAGGGGAACAGGTGGTGTTTGG + Intergenic
979041027 4:115795377-115795399 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
979064778 4:116116256-116116278 TTTGGGGAACAGCTGGTGTTTGG - Intergenic
979143807 4:117214771-117214793 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
979357451 4:119721737-119721759 TTAGGGGAACAGGTGGTGTTTGG - Intergenic
979479825 4:121203581-121203603 TTTGGGGAACAGGTGGTGTTTGG - Intronic
979661800 4:123264327-123264349 TTTGGGGAACACATGGTGTTTGG - Intronic
980019498 4:127691618-127691640 TTTGGGGAACAGGTGGTGTTTGG + Intronic
980212582 4:129808847-129808869 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
980238325 4:130137558-130137580 ATTGGGGAACAGATGGTGTTTGG - Intergenic
980263520 4:130485228-130485250 TTGGGGGAACAGATGGTATTTGG - Intergenic
980431419 4:132703277-132703299 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
980580695 4:134746389-134746411 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
980586476 4:134822941-134822963 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
981130122 4:141149260-141149282 TTTGGGGAACAGGTGGTGTTTGG + Intronic
981651777 4:147068463-147068485 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
981680799 4:147395537-147395559 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
982593690 4:157350425-157350447 TTGGGGGAACAGGTGGTGTTTGG + Intronic
982632343 4:157846567-157846589 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
982950930 4:161695081-161695103 ATCGGGGAATAGATGGTGTTTGG + Intronic
983350562 4:166582481-166582503 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
985235768 4:187872320-187872342 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
985240217 4:187923154-187923176 ATTGGGAAACAGGTGGTGCTTGG + Intergenic
985325893 4:188769830-188769852 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
986007779 5:3682709-3682731 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
986047613 5:4054672-4054694 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
986362688 5:6996401-6996423 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
986568366 5:9138626-9138648 ATTGGGGAACAGGTGGTGTTTGG + Intronic
986644483 5:9903351-9903373 TTTGGGGAACAGGTGGTGCTTGG + Intergenic
986651966 5:9972843-9972865 GTTGGGGAACAGGTGGTGTTCGG - Intergenic
987182161 5:15379490-15379512 TTTGGGGAACAGTTGGTGTTTGG - Intergenic
987328215 5:16831839-16831861 TTGGGGGAACAGTTGGTGTTTGG - Intronic
987362590 5:17120654-17120676 CGAGGCAAACAGAAGGTGCTAGG - Intronic
987415492 5:17657278-17657300 TTTGGGGAGCAGGTGGTGCTTGG + Intergenic
987436434 5:17900166-17900188 TTTGGGGAACAGATGGTGTTTGG + Intergenic
988355311 5:30166278-30166300 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
988729806 5:33960726-33960748 ATTGGGGAACAGGTGGTGTTTGG - Intronic
988846622 5:35134146-35134168 TTTGGGGAACAGATGGTGTTTGG - Intronic
988876392 5:35451594-35451616 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
989338148 5:40342970-40342992 CTTGGGGAACAGGTGGTGTTTGG - Intergenic
989396832 5:40966136-40966158 TTTGGGGAACAGATGGTGTTCGG + Intronic
989689791 5:44127450-44127472 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
989735652 5:44701378-44701400 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
990573475 5:57102565-57102587 CTGGGGGAATAGGTGGTGTTCGG - Intergenic
990723045 5:58719895-58719917 TTTGGGGAACAGGTGGTGTTTGG - Intronic
991294884 5:65070331-65070353 CTTGGGGAATAGAAGGTGCTAGG - Intergenic
991370186 5:65910493-65910515 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
991418769 5:66418960-66418982 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
991543590 5:67757144-67757166 TTTGGGGAATAGATGGTGTTTGG - Intergenic
991924585 5:71692375-71692397 ATTGGGGTACAGGTGGTGCTTGG - Intergenic
992335506 5:75764408-75764430 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
992339561 5:75808650-75808672 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
992599349 5:78382443-78382465 TTTGGGGAACAGGTGGTGTTTGG + Intronic
992899167 5:81276170-81276192 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
992931936 5:81656492-81656514 CTGGGGGAACAGGTGGTATTTGG + Intronic
993383503 5:87235100-87235122 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
993441943 5:87967939-87967961 TTGGGGGAACAGATGGTATTTGG - Intergenic
993499540 5:88649646-88649668 TTGGGGGAACAGATGGTGTTTGG - Intergenic
993601277 5:89928024-89928046 TTTGGGGAACAGATGGTGTTTGG - Intergenic
993753353 5:91697781-91697803 ATAGGGGAACAGGTGGTGGTTGG - Intergenic
993930693 5:93935199-93935221 TTTGGGGAACAGGTGGTGTTTGG - Intronic
993947389 5:94132090-94132112 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
994202257 5:96990932-96990954 TTTGGGGAACAGGTGGTGTTCGG + Intronic
994896864 5:105717683-105717705 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
995444662 5:112229435-112229457 TTAGGGGAACAGGTGGTTCTTGG + Intronic
995557205 5:113341863-113341885 TTTGGGGAACAGGTGGTGTTTGG + Intronic
995723182 5:115158081-115158103 ATTGGGGTACAGATGGTGTTTGG - Intronic
995943389 5:117612196-117612218 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
996295394 5:121908965-121908987 TTGGGGGAACAGTTGGTGTTTGG - Intergenic
996671865 5:126127380-126127402 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
996834861 5:127779757-127779779 TTGGGGGTACAGATGGTGTTTGG + Intergenic
996930620 5:128882287-128882309 TTGGGGGAACAGGTGGTGTTTGG + Intronic
997007204 5:129832268-129832290 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
997218897 5:132140887-132140909 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
997593847 5:135093031-135093053 TTTGGGGAACAGGTGGTGTTTGG + Intronic
998734723 5:145123805-145123827 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
999350603 5:150867042-150867064 TTTGGGGAACAGGTGGTGTTTGG + Intronic
999490669 5:152047351-152047373 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
999667241 5:153925905-153925927 TGAGGGGAACAGAGGATGCTGGG - Intergenic
999839307 5:155407781-155407803 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
999912982 5:156226091-156226113 CTGGGGGGACAGGTGGTGTTTGG + Intronic
999916059 5:156262560-156262582 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1000104382 5:158044914-158044936 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1000158571 5:158576957-158576979 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1000217854 5:159181051-159181073 CTGGGGGAACACATGGTGTTTGG - Intronic
1000265061 5:159628206-159628228 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1000272033 5:159695222-159695244 TTTGGAGAACAGATGGTGTTTGG - Intergenic
1000352876 5:160365978-160366000 ATTGGGGAACAGGTGGTGTTTGG + Intronic
1000367114 5:160501953-160501975 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1000387260 5:160686455-160686477 ATTGGGGAACAGGTGGTGTTTGG + Intronic
1000511118 5:162184499-162184521 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1000612976 5:163395551-163395573 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1000688397 5:164283218-164283240 TTTGGGGAACAATTGGTGCTTGG + Intergenic
1000744923 5:165020657-165020679 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1000861645 5:166462863-166462885 ATTGGGGAACAGGTGGTGGTTGG + Intergenic
1001189417 5:169614115-169614137 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1001256854 5:170190161-170190183 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1001323493 5:170702023-170702045 TTAGGGGAACCGCTGGTGTTTGG - Intronic
1001904011 5:175455819-175455841 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1002039923 5:176505488-176505510 ATTGGGGAACAGGTGGTGTTTGG + Intronic
1002214513 5:177620481-177620503 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1002848899 6:973703-973725 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1003260913 6:4515402-4515424 CTAGGGGTTCAGAGGGTGCTTGG + Intergenic
1003441551 6:6147268-6147290 TTTGGGGAACAGTTGGTGTTTGG - Intronic
1004081685 6:12400839-12400861 ATCGGGGAACAGGTGGTGTTTGG - Intergenic
1004227114 6:13795852-13795874 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1004520956 6:16360034-16360056 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1004592613 6:17068454-17068476 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1004858652 6:19778049-19778071 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1005377160 6:25194644-25194666 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1005715906 6:28548161-28548183 TTTGGGGAACAGATGGTCTTTGG - Intergenic
1005792690 6:29322286-29322308 TTTGGGGAACAGATGGTGTTTGG + Intergenic
1006100610 6:31683924-31683946 CTAGCAGAAAAGATGGCGCTGGG - Intronic
1006476007 6:34254528-34254550 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1007397882 6:41587649-41587671 CGGGGTGTACAGATGGTGCTTGG + Intronic
1008116110 6:47552171-47552193 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1008231975 6:48994305-48994327 TTGGGGGAACAGATGGTGTTTGG - Intergenic
1008232029 6:48994897-48994919 CTAGAGGCACAGAAGGTGTTTGG + Intergenic
1008271437 6:49494949-49494971 CTAGTGGAGCAGATGGAGCAGGG + Intergenic
1008361706 6:50626657-50626679 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1008446752 6:51600556-51600578 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1008618919 6:53252867-53252889 TTTGGGGAACAGGTGGTGGTTGG + Intergenic
1008774855 6:55026125-55026147 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1009392191 6:63157444-63157466 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1009428691 6:63542391-63542413 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1009589540 6:65648672-65648694 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1009845857 6:69133711-69133733 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1010293055 6:74162505-74162527 TTTGGGGAACAGGTGGTACTTGG - Intergenic
1010596923 6:77775212-77775234 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1010711084 6:79175327-79175349 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1011016419 6:82760729-82760751 TTTGGGGAACAGATGGTTTTTGG - Intergenic
1011372968 6:86659629-86659651 TTTGGGGAACAGGTGGTGGTTGG + Intergenic
1011401392 6:86965970-86965992 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1011965353 6:93150604-93150626 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1012070404 6:94606330-94606352 GTTGGGGAACAGGTGGTGTTTGG - Intergenic
1012176636 6:96094869-96094891 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1012179410 6:96132961-96132983 TTTGGGGAACAGATGGTGTTTGG + Intronic
1012182262 6:96168962-96168984 ATATGGGTACAGATGCTGCTAGG + Intronic
1012183214 6:96181464-96181486 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1012207896 6:96483782-96483804 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1012273202 6:97240520-97240542 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1012717086 6:102688902-102688924 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1012819834 6:104072363-104072385 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1013161893 6:107553063-107553085 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1013406073 6:109845207-109845229 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1013800782 6:113939415-113939437 ATTGGGGAACAGGTGGTGTTTGG - Exonic
1013857076 6:114585841-114585863 TTTGGGGAACAGATGGTGTTTGG - Intergenic
1013930772 6:115529776-115529798 TGAGGGGAACAGATGGAGTTTGG + Intergenic
1014226443 6:118853475-118853497 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1014406748 6:121062118-121062140 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1014462464 6:121713284-121713306 TTTGGGGAACAGTTGGTGTTTGG + Intergenic
1014797281 6:125740384-125740406 TCTGGGGAACAGATGGTGTTTGG + Intergenic
1014853341 6:126368543-126368565 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1014859073 6:126441484-126441506 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1015222686 6:130822718-130822740 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1015529616 6:134208404-134208426 TTTGGGGAACAGATGGTGTATGG + Intronic
1015601294 6:134913597-134913619 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1015802943 6:137078803-137078825 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1015900411 6:138059385-138059407 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1016176697 6:141085201-141085223 TTGGGGGAATAGATGGTGTTCGG - Intergenic
1016213960 6:141572823-141572845 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1016397809 6:143644849-143644871 ATTGGGGAACAGGTGGTGTTTGG + Intronic
1016537164 6:145121047-145121069 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1016604748 6:145907529-145907551 CTAGGGGACCAGATGTTGAAGGG - Intronic
1016864723 6:148754331-148754353 TTAGGGGAACAGGTGGTATTTGG + Intronic
1018342916 6:162870448-162870470 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1018352916 6:162980911-162980933 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1018383041 6:163277129-163277151 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1018434635 6:163749278-163749300 CGAGGGGAACAGATGGGGTGAGG + Intergenic
1018666075 6:166139704-166139726 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1018778240 6:167038825-167038847 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1019952572 7:4385418-4385440 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1020331848 7:7026519-7026541 TTGGAGGAACAGATGGTGTTTGG + Intergenic
1020348538 7:7192167-7192189 TTTGGGGAACAGGTGGTGTTGGG + Intronic
1020403135 7:7800465-7800487 TTGGGGGAACAGATGGTGTTTGG + Intronic
1021183802 7:17539156-17539178 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1021620239 7:22544007-22544029 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1021778391 7:24076464-24076486 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1022487901 7:30794495-30794517 CTAGGGGCACAGGTGGGGTTAGG + Intronic
1022605901 7:31813681-31813703 TTTGGGGAAAAGATGGTGTTTGG + Intronic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1022998564 7:35784235-35784257 TTGGGGGAACAGATGGTATTTGG - Intergenic
1023182150 7:37495640-37495662 TTAGGGGAACAGGTGGTGTTCGG - Intergenic
1023355608 7:39364289-39364311 ATTGGGGAACAGGTGGTGTTTGG + Intronic
1023544302 7:41301321-41301343 ATCGGGGAACAGGTGGTGTTTGG + Intergenic
1023669844 7:42564089-42564111 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1023864411 7:44232082-44232104 CAAGGGGCACCCATGGTGCTAGG - Intronic
1024201282 7:47109263-47109285 TTTGGGGAACAGATGGTGTTTGG + Intergenic
1024351373 7:48368333-48368355 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1024366832 7:48529940-48529962 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1024665070 7:51537967-51537989 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1024827758 7:53412415-53412437 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1025097558 7:56108172-56108194 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1025261353 7:57420552-57420574 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1026511628 7:71032135-71032157 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1026938956 7:74275596-74275618 CCAGGGGCACAGCTGGTCCTTGG + Intergenic
1028262204 7:88680239-88680261 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1028792327 7:94866934-94866956 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1028819036 7:95184491-95184513 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1028823151 7:95236106-95236128 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1028968908 7:96834737-96834759 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1028996272 7:97103934-97103956 TTGGGGGAACAAATGGTGTTTGG - Intergenic
1029024870 7:97405524-97405546 ATATGGGAACAGCTGGTGGTAGG - Intergenic
1029743102 7:102502401-102502423 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1029761092 7:102601562-102601584 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1029811723 7:103055876-103055898 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1029957155 7:104652121-104652143 CTTGGGGACAAGATGGTGTTTGG + Intronic
1030013251 7:105192081-105192103 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1030425621 7:109373620-109373642 ATAGTGGAACAGGTGGTGTTTGG + Intergenic
1031186534 7:118487895-118487917 ATTGGGGAACAGATGGTGTTTGG - Intergenic
1031575062 7:123405641-123405663 ATTGGGGAACAGATGGTGTTTGG + Intergenic
1031878665 7:127170957-127170979 TTGGGGGAATAGATGGTGTTTGG - Intronic
1031923569 7:127618645-127618667 CTCTGGGGACAGCTGGTGCTAGG - Intergenic
1032139898 7:129318814-129318836 TTGGGGGAACAGGTGGTGGTTGG + Intronic
1032289210 7:130572209-130572231 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1033630919 7:143156837-143156859 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1033763169 7:144459259-144459281 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1033961073 7:146913778-146913800 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1034115760 7:148582398-148582420 ATTGGGGAGCAGGTGGTGCTTGG + Intergenic
1034216222 7:149408242-149408264 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1034460156 7:151193625-151193647 CTAGGGGACCTGCTGGTGTTGGG - Intronic
1034468438 7:151243369-151243391 CTAGGGGATCAGAAGCTGCCAGG - Intronic
1034711939 7:153200555-153200577 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1034969318 7:155409237-155409259 CGAGGGGAACAGCTGGATCTAGG + Intergenic
1035644416 8:1207113-1207135 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1035734250 8:1876311-1876333 CTCGGGGTACAGATGGGGCAGGG + Intronic
1035820593 8:2587552-2587574 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1035983292 8:4396994-4397016 TTTAGGGAACAGATGGTGTTTGG - Intronic
1035995337 8:4540336-4540358 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1037123091 8:15313581-15313603 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1037341754 8:17853131-17853153 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1037366898 8:18132293-18132315 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1037476527 8:19263231-19263253 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1037549746 8:19958598-19958620 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1037693164 8:21200636-21200658 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1037733100 8:21545693-21545715 CTTGGGGAAGAGTTTGTGCTGGG - Intergenic
1038408224 8:27338509-27338531 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1039615954 8:38955083-38955105 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1039643102 8:39245420-39245442 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1040525677 8:48222443-48222465 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1041128195 8:54666838-54666860 CTCTGAGAACAGATGGGGCTTGG - Intergenic
1041212544 8:55567321-55567343 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1041365695 8:57101617-57101639 TTGGGGGAACAGGTGGTGCTTGG + Intergenic
1041673828 8:60517641-60517663 CTAGGGGAGCAGAAGGTGTTGGG + Intronic
1041761347 8:61370236-61370258 TTGGGGGAACAGGTGGTGTTCGG + Intronic
1042769941 8:72368565-72368587 TTTGGGGAACAGTTGGTGTTTGG - Intergenic
1043103946 8:76084050-76084072 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043691603 8:83160341-83160363 TTTGGGGAACAGGTAGTGCTTGG + Intergenic
1043796167 8:84543460-84543482 TTTGGGGAACAGATGGTATTTGG - Intronic
1043988421 8:86721517-86721539 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1044080541 8:87876967-87876989 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1044230191 8:89766005-89766027 TTAGGGGTACAGATTGTGGTAGG - Intronic
1044769353 8:95613766-95613788 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1044903807 8:96977939-96977961 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1044947383 8:97402393-97402415 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1045095496 8:98793294-98793316 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1045121694 8:99044522-99044544 ATTGGGGAACAGGTGGTGTTTGG + Intronic
1045414423 8:101952184-101952206 CTAAGGGAACTGAGAGTGCTGGG + Intronic
1045671562 8:104559578-104559600 TTTGGGGAACAGATGGTGTTTGG - Intronic
1045746100 8:105424115-105424137 TTGGGGGAACAGGTGGTGTTTGG - Intronic
1046639982 8:116718844-116718866 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1046759202 8:118003367-118003389 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1046829476 8:118728558-118728580 ATTGGGGAACAGATGGTGTTTGG - Intergenic
1046982198 8:120348644-120348666 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1047057303 8:121180172-121180194 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1047107418 8:121748330-121748352 GAAGGGGAACTGATGGGGCTTGG + Intergenic
1047606815 8:126482767-126482789 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1047937165 8:129793697-129793719 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1048000697 8:130377345-130377367 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1048190314 8:132282411-132282433 CAAGGGGGACAGATGGGACTGGG - Intronic
1048485066 8:134839997-134840019 ATTGGGGTACAGGTGGTGCTTGG - Intergenic
1048530564 8:135245150-135245172 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1048642580 8:136380748-136380770 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1049066974 8:140323919-140323941 TTCGGGGAACAGGTGGTGTTTGG + Intronic
1050400775 9:5251374-5251396 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1050470332 9:5981996-5982018 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1050734197 9:8744764-8744786 TTTGAGGAACAGATGGTGTTTGG - Intronic
1050996005 9:12218467-12218489 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1051190146 9:14502757-14502779 TTCGGGAAACAGGTGGTGCTTGG + Intergenic
1051294750 9:15583745-15583767 TTTGGGGAACAGATGGTGTTCGG - Intronic
1051800936 9:20933220-20933242 ATTGGGGAACAGGTGGTGTTTGG + Intronic
1052343820 9:27388487-27388509 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1052514145 9:29458453-29458475 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1052717837 9:32139270-32139292 CTAGGGGAAAAAAAGGTGCCTGG - Intergenic
1052738029 9:32364680-32364702 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1052744200 9:32423872-32423894 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1052847321 9:33348461-33348483 CTTGGGGAACAGGTGGTGTTTGG - Intronic
1053188792 9:36042086-36042108 TTAGGGGAACAGGTGGTATTTGG + Intronic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1053922682 9:43012959-43012981 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1054383980 9:64526642-64526664 ATTGGGGAACAGATGGTGTTTGG - Intergenic
1054459382 9:65454637-65454659 GAAGGAGAGCAGATGGTGCTGGG + Intergenic
1054511756 9:65989705-65989727 ATTGGGGAACAGATGGTGTTTGG + Intergenic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1054872766 9:70064192-70064214 ATTGGGGAACAGGTGGTGTTTGG + Intronic
1054941018 9:70741939-70741961 TTGGGGGAACAGATGGTGTTTGG - Intronic
1055124770 9:72706447-72706469 CTTGGGGAACAGGTGGTATTTGG + Intronic
1055283716 9:74704978-74705000 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1055572966 9:77635043-77635065 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1055703235 9:78969760-78969782 TTTGGGGAACACATGGTGTTTGG - Intergenic
1056765658 9:89443127-89443149 CTAGGGGACCTGATGGGGCTGGG - Intronic
1056897023 9:90560443-90560465 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1056901260 9:90601913-90601935 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1057392709 9:94652901-94652923 CTGGGGGGCCAGATGGTGCAGGG - Intergenic
1057453687 9:95188420-95188442 CTAGGGGCAATGATGGTGCTGGG - Intronic
1057476219 9:95405143-95405165 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1057643971 9:96855277-96855299 ATTGGGGAACAGATGGTGTTTGG + Intronic
1057912281 9:99028806-99028828 TTTGGGGAACAGATGGTATTTGG - Intronic
1058073191 9:100622596-100622618 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1058094687 9:100846389-100846411 TTTGGGGAACAGATGGTGTTTGG + Intergenic
1058219845 9:102284927-102284949 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1058277635 9:103065218-103065240 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1058556177 9:106169867-106169889 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1058654790 9:107210360-107210382 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1058832204 9:108828961-108828983 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1060322670 9:122578913-122578935 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1060322678 9:122579002-122579024 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1061468223 9:130800430-130800452 TTTGGGGAACACATGGTGTTTGG - Intronic
1062616340 9:137398215-137398237 CCAGGGGAACAGAGGGCGCCCGG - Intronic
1062705953 9:137942930-137942952 ATTGGGGAACAGATGGTGTTTGG - Intronic
1203733330 Un_GL000216v2:111294-111316 TTTGGGGAACAGATGGTGTTTGG - Intergenic
1203446487 Un_GL000219v1:61929-61951 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1185596932 X:1312896-1312918 CTTGGGGAAGAGATGGAGCCAGG + Intergenic
1185704605 X:2257441-2257463 CTAGATGACCAGATGGTGGTAGG - Intronic
1185852672 X:3503891-3503913 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1185887267 X:3793926-3793948 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1185949687 X:4418947-4418969 ATTGGGGAACAGATGGTATTTGG - Intergenic
1185978255 X:4745993-4746015 TTAGGGAAACAGGTGGTGTTTGG - Intergenic
1185978335 X:4747175-4747197 TTTGGGGAACAGATGGTGTTTGG + Intergenic
1186070485 X:5814389-5814411 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1186075779 X:5876723-5876745 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1186228467 X:7426870-7426892 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1186296860 X:8158842-8158864 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1186528946 X:10276149-10276171 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1186582930 X:10840413-10840435 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1186822738 X:13307641-13307663 TTTGGGGAACAGGTGGTGGTTGG + Intergenic
1187186814 X:16994778-16994800 TTGGGGGAACAGATGGTATTTGG - Intronic
1187716016 X:22103330-22103352 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1187723669 X:22179347-22179369 TTGGGGGAACAGATGGTGGTTGG + Intronic
1188050172 X:25474843-25474865 CTAGGAGACCAGAGGGTGCAGGG + Intergenic
1188393883 X:29656292-29656314 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1188640792 X:32501754-32501776 CTGGTGGAACAGATGGTGAATGG - Exonic
1189133540 X:38525595-38525617 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1189273214 X:39766339-39766361 CTAGGGGACAAGAATGTGCTGGG - Intergenic
1189463031 X:41257886-41257908 CTAAAGGAACAGAAGGTACTGGG - Intergenic
1189733444 X:44045758-44045780 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1189836014 X:45023667-45023689 TTGGGGGAACAGGTGGTGTTTGG + Intronic
1189905553 X:45755326-45755348 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1189945513 X:46173572-46173594 TTTGGGGAACAGATGGTGTTTGG + Intergenic
1190048531 X:47131972-47131994 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1190589779 X:51988083-51988105 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1190716866 X:53111997-53112019 TTTGGGGAACAGGTGGTGGTTGG + Intergenic
1191164427 X:57372748-57372770 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1191222823 X:58008591-58008613 TTTAGGGAACAGATGGTGGTTGG + Intergenic
1191692594 X:63956388-63956410 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1191871328 X:65748252-65748274 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1191905757 X:66087793-66087815 ATTGAGGAACAGATGGTGTTTGG + Intergenic
1192164461 X:68818713-68818735 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1192231873 X:69270897-69270919 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1192530893 X:71883701-71883723 TTGGGGGAACAGATGGTGTTTGG + Intergenic
1192538390 X:71948010-71948032 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1192687840 X:73325333-73325355 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1192895005 X:75433304-75433326 TTTGGGGAACAGGTGGTGTTTGG + Intronic
1192904335 X:75534366-75534388 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1193076475 X:77361249-77361271 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1193281744 X:79659244-79659266 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1193390851 X:80927101-80927123 TTTGGGGAACAGATGGTGTTTGG - Intergenic
1193423287 X:81310152-81310174 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1193618927 X:83726702-83726724 TTTGGGGAACAGATTGTGTTCGG - Intergenic
1193630746 X:83884592-83884614 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1193680736 X:84516156-84516178 ACTGGGGAACAGATGGTGTTTGG + Intergenic
1193750758 X:85340264-85340286 CTAGGGGCACAGAAGGTGGATGG + Intronic
1193775504 X:85636268-85636290 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1193792122 X:85827545-85827567 ATTGGGGAACAGATGGTGTTTGG - Intergenic
1193883794 X:86960290-86960312 CTAGGGGCACTGTTGGTGCTGGG + Intergenic
1193989720 X:88291543-88291565 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1194094819 X:89626355-89626377 TTGGGGTAACAGGTGGTGCTTGG + Intergenic
1194138215 X:90174548-90174570 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1194347381 X:92782939-92782961 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1194349205 X:92804993-92805015 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1194547210 X:95252002-95252024 TTAGGGGAACAGGTGGTATTTGG + Intergenic
1194602181 X:95935686-95935708 TTTGGGGAACAGGTGGTGGTTGG + Intergenic
1194606126 X:95980778-95980800 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1194656775 X:96582907-96582929 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1194806227 X:98331504-98331526 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1194827371 X:98579257-98579279 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1194866501 X:99075189-99075211 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1194881407 X:99256119-99256141 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1195021807 X:100835927-100835949 ATTGGGGAACAGGTGGTGTTTGG - Intronic
1196213645 X:113024840-113024862 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1196218329 X:113081722-113081744 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1196235488 X:113274708-113274730 ATTGGGGAACAGGTGGTGTTTGG - Intergenic
1197376196 X:125684607-125684629 TTAGGGAAACAGGTGGTGTTTGG - Intergenic
1197620999 X:128748170-128748192 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1197642269 X:128980063-128980085 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1197664107 X:129204727-129204749 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1198159310 X:133991258-133991280 ATAGAGTAACAGGTGGTGCTGGG - Intergenic
1198559352 X:137831941-137831963 TTTGGGGAACAGGTGGTGTTTGG + Intergenic
1198617003 X:138469310-138469332 ATTGGGAAACAGATGGTGTTTGG - Intergenic
1198665225 X:139013845-139013867 TTTGGGGAACAGGTGGTGTTTGG - Intronic
1199120606 X:144048663-144048685 TTGGGGAAACAGGTGGTGCTTGG - Intergenic
1199124490 X:144099650-144099672 CTGTGTGACCAGATGGTGCTAGG + Intergenic
1199206397 X:145153940-145153962 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1199283851 X:146034643-146034665 ATTGGGGAACAGGTGGTGTTTGG + Intergenic
1199349618 X:146785746-146785768 TTTGGGGAGCAGATGGTGTTTGG - Intergenic
1199465556 X:148132086-148132108 ATTGGGAAACAGATGGTGTTTGG - Intergenic
1199880812 X:151973312-151973334 CTAGGGCAAAAGATGGCTCTGGG - Intronic
1200171338 X:154077755-154077777 TTAGGGGAACAGGTGGTATTTGG - Intronic
1200484012 Y:3744788-3744810 TTGGGGGAACAGGTGGTGTTTGG - Intergenic
1200655704 Y:5899572-5899594 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1200657530 Y:5921593-5921615 TTTGGGGAACAGGTGGTGTTTGG - Intergenic
1200718943 Y:6581930-6581952 CTATGAGAACATATGGTGTTTGG + Intergenic
1200723329 Y:6632547-6632569 CTATGAGAACATATGGTGTTTGG - Intergenic
1200738058 Y:6821743-6821765 TTGGGGAAACAGATGGTGTTTGG + Intergenic
1201269565 Y:12241798-12241820 TTGGGGGAACAGGTGGTGTTGGG + Intergenic
1201670026 Y:16509522-16509544 TTGGGGGAACAGGTGGTGTTTGG + Intergenic
1202627681 Y:56877131-56877153 TTTGGGGAACAGATGGTGTTTGG + Intergenic