ID: 1183964680

View in Genome Browser
Species Human (GRCh38)
Location 22:41434624-41434646
Sequence CCTACCCAGGGACCCCAAGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 161}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183964680_1183964696 24 Left 1183964680 22:41434624-41434646 CCTACTTGGGGTCCCTGGGTAGG 0: 2
1: 0
2: 0
3: 16
4: 161
Right 1183964696 22:41434671-41434693 CTTTGGTGCTTTCTGGTGATTGG 0: 2
1: 0
2: 0
3: 15
4: 191
1183964680_1183964692 1 Left 1183964680 22:41434624-41434646 CCTACTTGGGGTCCCTGGGTAGG 0: 2
1: 0
2: 0
3: 16
4: 161
Right 1183964692 22:41434648-41434670 TGGAGTGGGTGGGGTGCCAGGGG 0: 2
1: 0
2: 3
3: 52
4: 625
1183964680_1183964695 17 Left 1183964680 22:41434624-41434646 CCTACTTGGGGTCCCTGGGTAGG 0: 2
1: 0
2: 0
3: 16
4: 161
Right 1183964695 22:41434664-41434686 CCAGGGGCTTTGGTGCTTTCTGG 0: 2
1: 0
2: 0
3: 24
4: 184
1183964680_1183964697 25 Left 1183964680 22:41434624-41434646 CCTACTTGGGGTCCCTGGGTAGG 0: 2
1: 0
2: 0
3: 16
4: 161
Right 1183964697 22:41434672-41434694 TTTGGTGCTTTCTGGTGATTGGG 0: 1
1: 0
2: 1
3: 25
4: 337
1183964680_1183964689 -8 Left 1183964680 22:41434624-41434646 CCTACTTGGGGTCCCTGGGTAGG 0: 2
1: 0
2: 0
3: 16
4: 161
Right 1183964689 22:41434639-41434661 TGGGTAGGATGGAGTGGGTGGGG 0: 2
1: 0
2: 6
3: 76
4: 809
1183964680_1183964693 7 Left 1183964680 22:41434624-41434646 CCTACTTGGGGTCCCTGGGTAGG 0: 2
1: 0
2: 0
3: 16
4: 161
Right 1183964693 22:41434654-41434676 GGGTGGGGTGCCAGGGGCTTTGG 0: 2
1: 0
2: 6
3: 75
4: 942
1183964680_1183964688 -9 Left 1183964680 22:41434624-41434646 CCTACTTGGGGTCCCTGGGTAGG 0: 2
1: 0
2: 0
3: 16
4: 161
Right 1183964688 22:41434638-41434660 CTGGGTAGGATGGAGTGGGTGGG 0: 2
1: 0
2: 10
3: 62
4: 548
1183964680_1183964691 0 Left 1183964680 22:41434624-41434646 CCTACTTGGGGTCCCTGGGTAGG 0: 2
1: 0
2: 0
3: 16
4: 161
Right 1183964691 22:41434647-41434669 ATGGAGTGGGTGGGGTGCCAGGG 0: 2
1: 0
2: 2
3: 49
4: 674
1183964680_1183964690 -1 Left 1183964680 22:41434624-41434646 CCTACTTGGGGTCCCTGGGTAGG 0: 2
1: 0
2: 0
3: 16
4: 161
Right 1183964690 22:41434646-41434668 GATGGAGTGGGTGGGGTGCCAGG 0: 2
1: 0
2: 4
3: 68
4: 818
1183964680_1183964687 -10 Left 1183964680 22:41434624-41434646 CCTACTTGGGGTCCCTGGGTAGG 0: 2
1: 0
2: 0
3: 16
4: 161
Right 1183964687 22:41434637-41434659 CCTGGGTAGGATGGAGTGGGTGG 0: 2
1: 0
2: 4
3: 75
4: 979

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183964680 Original CRISPR CCTACCCAGGGACCCCAAGT AGG (reversed) Exonic
900358948 1:2278778-2278800 CCTGCCCAGGGACTGCAAGAAGG - Intronic
900391416 1:2435563-2435585 CCTCCCCAGGGACCCCATTGAGG - Intronic
900403618 1:2482981-2483003 CCCACCCAGGGGCTCCAAGGGGG - Intronic
900429362 1:2594577-2594599 CCTCCTCAGGGACCCCAGGAAGG - Intronic
900965076 1:5952183-5952205 CCTTCCCAGGGGCCCAAGGTGGG + Intronic
903828818 1:26162793-26162815 CATACCCAGTGACCACAACTGGG - Intergenic
905424726 1:37874205-37874227 CCTGCCCAGCCACCCCAACTGGG + Intronic
905483080 1:38275071-38275093 CCCACCCTGGGACCCAAAGAGGG + Intergenic
909159791 1:72131985-72132007 CCTGCCTCAGGACCCCAAGTAGG - Intronic
913524153 1:119675367-119675389 CCTTCCCAAGGACACCCAGTTGG + Intronic
914899664 1:151705026-151705048 CCTACTGAGGGCCCCCAGGTGGG - Exonic
915931483 1:160063137-160063159 CCTGCCCAGGGAACCCCAGCAGG + Intronic
917139611 1:171822459-171822481 CCTACAAACGGACCCCAGGTAGG - Intergenic
920617630 1:207509190-207509212 CCTCCCCAGGGCCCCGAAGAGGG - Intronic
923534570 1:234839002-234839024 CCTACCCAGTGAGCCCTACTTGG - Intergenic
1067579627 10:47434042-47434064 CCTACCCAGGGAAGCCATGACGG - Intergenic
1069255432 10:66325716-66325738 ACTACCAAGGGACTCTAAGTGGG + Intronic
1073247899 10:102104655-102104677 CCTACCCCCTGCCCCCAAGTAGG + Intergenic
1076612510 10:131735607-131735629 CCTGCACAGGGACCCTGAGTTGG - Intergenic
1076807800 10:132867841-132867863 CCCACCCAGGGACCTGTAGTTGG - Intronic
1077184695 11:1230842-1230864 CCTGCCCAGGGGCCCCCACTGGG - Intronic
1078153313 11:8777235-8777257 CCCACCCAGGCACCCCACCTTGG + Intronic
1084118172 11:67053960-67053982 CCAAGCCAGGAACCCCAAGCAGG + Intergenic
1084304437 11:68272231-68272253 CGCACCCCGGGACCCCAAGACGG - Intergenic
1084537350 11:69764846-69764868 CCTCCCCCAGGACCCCATGTAGG - Intergenic
1085395170 11:76203496-76203518 CCTACCCAGGAAAGCCAAGAAGG + Intronic
1087907641 11:103717636-103717658 CCTACAAAGGGAACCCAAGCAGG + Intergenic
1090039680 11:123279686-123279708 CCTACACTGGGACACCAAGGCGG - Intergenic
1090750633 11:129743720-129743742 CCTCCCCACGGACCCCGTGTCGG + Intergenic
1090772579 11:129934255-129934277 CATAACCATGAACCCCAAGTGGG + Intronic
1091259070 11:134219435-134219457 CCTCCCCAGGGACCTCAGGGAGG - Intronic
1092258296 12:6938840-6938862 CCGGCCCAGGGACCCCATGTAGG - Exonic
1092569560 12:9708021-9708043 CACACCCAGGCACCCGAAGTGGG - Intergenic
1096591816 12:52665160-52665182 CCCACCCAGGGACCCCACTTAGG + Intergenic
1096637756 12:52971888-52971910 CCCACCCAGGGCTCCCAGGTGGG - Intergenic
1097033123 12:56104122-56104144 CCGACCCAGGGATCCGAAGAAGG + Intronic
1102047874 12:109841040-109841062 CCCACCCAGGGACCCCAGCTTGG - Intergenic
1102345702 12:112159788-112159810 CCTGGCCAGGGAGCCCAGGTTGG - Intergenic
1105879257 13:24589476-24589498 CAAACCCAGTGACACCAAGTTGG - Intergenic
1105920578 13:24959582-24959604 CAAACCCAGTGACACCAAGTTGG + Intergenic
1106257223 13:28032496-28032518 CCTACTCAGGGGCCTGAAGTGGG + Intronic
1110060522 13:71033341-71033363 ACTAGCCAGAGAGCCCAAGTGGG - Intergenic
1111191397 13:84812048-84812070 TCTAGCCAGAGACCCCAAATTGG - Intergenic
1117453594 14:55876008-55876030 CCTAACCAGGGATCCCATCTGGG + Intergenic
1118319317 14:64743791-64743813 CCTGCCCAGGGCCCTCAGGTGGG + Exonic
1121701998 14:95961731-95961753 CCAACCCAGAGAGCCCAAGATGG + Intergenic
1122786625 14:104167061-104167083 CCCACCCAGGGCCCCGAACTCGG - Intronic
1122868047 14:104618339-104618361 CCTACCAAGTGACCCCAGCTAGG - Intergenic
1122969333 14:105146120-105146142 CCTACCCAGGGCTCCCAGGGAGG + Intronic
1123538319 15:21261547-21261569 CCTCCTCAGGGAGCCCGAGTAGG + Intergenic
1125236264 15:37517259-37517281 CATACCCAGGGGCCCAGAGTGGG - Intergenic
1128228025 15:66015971-66015993 CCTACCCACCCACCCCAAGTAGG - Intronic
1132657740 16:1048412-1048434 GCTCCCCAGGGACCCCCACTAGG - Intergenic
1132833761 16:1942532-1942554 CCTGCCCAGGGACTCCAAATTGG - Intronic
1134123534 16:11600987-11601009 CCAAACCAGGGACCCCCAGTAGG - Intronic
1138545788 16:57718670-57718692 CCTACCCAGGACCTCCCAGTGGG + Intronic
1139489949 16:67280651-67280673 CCTATCCAGAGACCCCTACTTGG - Intronic
1139529941 16:67537983-67538005 CCCACCCCGGGAGCCCAAGGAGG - Intronic
1139690823 16:68640997-68641019 CCTCCCCTGGTTCCCCAAGTAGG + Intronic
1141740271 16:85887066-85887088 CGTCCCCAGAGACCACAAGTTGG - Intergenic
1142255101 16:89009981-89010003 CCTGCCCAGGGACCCACAGGTGG - Intergenic
1142422148 16:89978199-89978221 CCTACAGAAGGACTCCAAGTGGG - Intergenic
1143640045 17:8190532-8190554 CCTCTCTAGGAACCCCAAGTGGG - Exonic
1143859289 17:9876265-9876287 CCCAGCCAGGGACCCTAAGAGGG - Intronic
1144047418 17:11466407-11466429 CCCACCCAAGGTCCCCCAGTGGG + Intronic
1145723156 17:27090858-27090880 CCTTCTCGGGGAACCCAAGTAGG - Intergenic
1146283054 17:31557839-31557861 CCTACCCAGGGATCCCGATGTGG + Intergenic
1147578807 17:41617362-41617384 TCTGTCCAGGCACCCCAAGTGGG - Intergenic
1148871263 17:50660037-50660059 GCCTCCCAGGGTCCCCAAGTTGG + Intronic
1149647688 17:58252184-58252206 CCCACCCAATGACCCCAAGGCGG + Exonic
1152335906 17:79700202-79700224 CCTGCCCAGGGCCCCCCAGCAGG + Intergenic
1152457398 17:80424106-80424128 CCTCCTCTGGGACCCCATGTTGG + Intronic
1152980062 18:268211-268233 GCTACCCAAGAACCCCGAGTAGG - Intergenic
1161068684 19:2250109-2250131 CCAACCCAGAGACCCCAGGGCGG + Intronic
1163316159 19:16542126-16542148 CCTTGCCGGGGACCCCAAGGGGG + Intronic
1166540837 19:43604646-43604668 TCTTCCCAAGCACCCCAAGTGGG + Intronic
1166915612 19:46194158-46194180 GCTTTCCAGGGACCCCCAGTGGG - Intergenic
1167651893 19:50735927-50735949 CCCACCCAGGCCCACCAAGTTGG + Intergenic
1167665345 19:50820201-50820223 CCCACCGAGGAACCCGAAGTGGG - Exonic
1168475735 19:56673703-56673725 CCTACCCAGGGACCCCAAGTAGG - Intergenic
925884250 2:8380916-8380938 GTTACCCAGGGACTCAAAGTAGG + Intergenic
930651595 2:53970254-53970276 GCTACCCAGGGCCCCCCAGGTGG + Intronic
933980374 2:87544374-87544396 CCTAGGCAGGGACCCCATGAGGG - Intergenic
935147808 2:100408052-100408074 CCTTCCCAGGTTCCCCAAGTCGG + Intronic
935669506 2:105543192-105543214 CCCAGCCAGGGACCCTAAGAGGG + Intergenic
936313452 2:111406417-111406439 CCTAGGCAGGGACCCCATGAGGG + Intergenic
936898348 2:117454913-117454935 CCTACACAGGGTCCCCAATGGGG + Intergenic
937891779 2:126944613-126944635 CCTAGCCAGGGACCCCAAAAGGG - Intergenic
939179029 2:138782379-138782401 CCTATCCAGGGACGCAAAGTTGG - Intergenic
942857456 2:180566870-180566892 CCTGCCCAGGGACCTCACATTGG - Intergenic
943573864 2:189607618-189607640 GCTACTCAGGGACCTGAAGTGGG - Intergenic
946551244 2:220804108-220804130 CCTAACCAGGGACCACTACTAGG - Intergenic
946646894 2:221846962-221846984 GCTTCCCAGGGAACCCAAGCTGG + Intergenic
947753442 2:232544612-232544634 CCTCCCCTGGGACCCCAGCTGGG + Intronic
948366228 2:237456522-237456544 TTTATCCAGGGACTCCAAGTGGG - Intergenic
948784987 2:240347640-240347662 CCGGCCCTGGGACCCCCAGTGGG + Intergenic
1169475103 20:5923908-5923930 CCTCGCCAGGGTCCCCAAGCTGG + Exonic
1169622208 20:7520060-7520082 CCCAGCCAGTGACCCCAAGTAGG - Intergenic
1170275677 20:14584137-14584159 CCTATCCAGGAAACTCAAGTGGG + Intronic
1171372512 20:24670661-24670683 CCTACCCTGGGACCCCACCCTGG - Intergenic
1172164919 20:32893276-32893298 CCTCCCCAGGGCCTCCAAGTGGG + Exonic
1172807453 20:37622664-37622686 CCTAGCCATGGCCCCCAAGAAGG - Intergenic
1173292439 20:41726722-41726744 ACTACACAGGGTCCCCAATTTGG - Intergenic
1175125525 20:56748574-56748596 CCTAGCCAGGGCCCCCATGAGGG - Intergenic
1175173027 20:57093086-57093108 CCAACTCAGGGAACCCAAGAGGG - Intergenic
1176128865 20:63487903-63487925 CCTGCCCGGGGACCCCAGGGTGG - Intergenic
1180100236 21:45580527-45580549 GCTAGCCAGGGACCCCATCTGGG - Intergenic
1181028720 22:20139982-20140004 CCTGCCCAGGGATCCCCAGTGGG + Intronic
1183964680 22:41434624-41434646 CCTACCCAGGGACCCCAAGTAGG - Exonic
1184576120 22:45367667-45367689 CCTTGCCAGGGAACCCAAGATGG + Intronic
1185173084 22:49304752-49304774 GCTCCCAAGGGACCCCAAGAAGG + Intergenic
949716010 3:6932244-6932266 CCTACCGAGGGCCCACAATTAGG + Intronic
950522634 3:13505782-13505804 CATGCCCAGGGGCCCCAGGTGGG + Exonic
953513975 3:43572133-43572155 ACCACCCAGGTAGCCCAAGTAGG + Intronic
953908768 3:46881783-46881805 CCTCCCCAGGGACCCCGACCCGG + Intronic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
954691133 3:52396277-52396299 CCTGCCCAGGGACCCTGAGGTGG - Intronic
955579446 3:60403358-60403380 ACTATCCAGGGACACCAAATAGG + Intronic
962912322 3:139864235-139864257 CCTACCCAGAGGCACCAGGTGGG + Intergenic
966915717 3:184583262-184583284 CCTACCCAGGGACCCTACCCAGG - Intronic
968650460 4:1758340-1758362 CATGCCCAGTGGCCCCAAGTGGG - Intergenic
969649415 4:8455316-8455338 CCTTCTCAGAGGCCCCAAGTAGG - Intronic
969877968 4:10149927-10149949 CCTACCCAGGGGTCCCCAGGAGG - Intergenic
972099765 4:35399948-35399970 CCCAGCCAGGGACCCTAAGAGGG + Intergenic
979635888 4:122953890-122953912 TCTACCCAGAGCCCCCTAGTAGG - Intronic
981977989 4:150754681-150754703 CCTACCTTGGTCCCCCAAGTTGG - Intronic
983999035 4:174218064-174218086 CCTGCCCAGGGACCTCTAATAGG + Intergenic
986293296 5:6417500-6417522 CCTTCCCAGGGACCACAGGAAGG + Intergenic
992092177 5:73327001-73327023 CGTACACAGGGACTCCAAGGTGG + Intergenic
992164462 5:74035679-74035701 CCTAAACACTGACCCCAAGTGGG - Intergenic
994249589 5:97520312-97520334 TCTACCCAGGTACCACAAGGGGG - Intergenic
996249832 5:121316293-121316315 CCTACAAAGGGAACCCAACTGGG - Intergenic
998156900 5:139792252-139792274 CCTACCCAGGCACCCCACCTGGG + Intergenic
999309466 5:150542740-150542762 CCTTCCCAGGAGCCCCCAGTGGG + Intronic
999477972 5:151918971-151918993 TGTACCCAGGGACCCCATATTGG - Intronic
999615463 5:153418235-153418257 CCTACCCAGTGACTCTAATTTGG + Intergenic
1001274744 5:170342406-170342428 CCTACTCAGGGACCCCACTCTGG + Intergenic
1006741019 6:36309059-36309081 CCCATCCAGGGACCCCACTTGGG - Intergenic
1007661160 6:43487362-43487384 CCTTCACAGGTAGCCCAAGTAGG + Intronic
1014353869 6:120379072-120379094 CCTACACAGGCACTGCAAGTCGG + Intergenic
1015115808 6:129648281-129648303 CCTACTCAGGGAGGCTAAGTTGG - Intronic
1016918420 6:149266479-149266501 CCTACACAGGGACCCAAATGTGG - Intronic
1017610064 6:156176104-156176126 CCTACCCAGGCACCACATTTTGG + Intergenic
1018071384 6:160167351-160167373 CCTGCTCAGGGTCCCCAGGTGGG - Intergenic
1019471032 7:1221118-1221140 CCTCCCCAGGGACCCCTCGGGGG + Intergenic
1021823271 7:24519147-24519169 ACTTCTCAGGGACCCCAAATGGG + Intergenic
1023860242 7:44214003-44214025 TCTCCCCAGGGTCCTCAAGTGGG - Exonic
1025275956 7:57581240-57581262 CCTACTCAGGCTCCCCAAGGAGG + Intergenic
1030299908 7:107964543-107964565 CCTACTCACAGGCCCCAAGTTGG + Exonic
1032011456 7:128350712-128350734 CCCACCCAGGGACCCCTGGATGG + Exonic
1033622570 7:143075520-143075542 CCTTCCCAGTGACCCCTACTGGG + Intergenic
1035038128 7:155908546-155908568 CCTACCCAGGGACCCTGCCTCGG - Intergenic
1035755634 8:2029053-2029075 GCTCCCCAGGGACCCCAAAGAGG - Intergenic
1036396509 8:8376024-8376046 CCCAAGCAGGGACCACAAGTAGG + Intronic
1038513477 8:28162589-28162611 CCCAGCCAGGGACCCTAAGAGGG - Intronic
1038741511 8:30220936-30220958 CCTCCTCAGAGACCTCAAGTCGG - Intergenic
1039184439 8:34900876-34900898 CCTTGCCAGGAACCCCAAGAGGG + Intergenic
1044594151 8:93942053-93942075 GCAAGCCAGGGACCCCCAGTTGG + Intergenic
1048253218 8:132884396-132884418 TCTACCCAGCTTCCCCAAGTTGG - Intronic
1049980916 9:902852-902874 CATTCACAGGAACCCCAAGTAGG + Intronic
1053009469 9:34624970-34624992 CCTTCCCAGGGACCCTCAGTAGG - Intronic
1053556861 9:39146275-39146297 CCTGCTCAGGGAGCCCCAGTTGG + Intronic
1053820971 9:41966553-41966575 CCTGCTCAGGGAGCCCCAGTTGG + Intronic
1054089840 9:60834692-60834714 CCTGCTCAGGGAGCCCCAGTTGG + Intergenic
1054111251 9:61110250-61110272 CCTGCTCAGGGAGCCCCAGTTGG + Intergenic
1054609606 9:67220875-67220897 CCTGCTCAGGGAGCCCCAGTTGG - Intergenic
1056128910 9:83564893-83564915 CCTGCTCAGTGGCCCCAAGTTGG - Intergenic
1057903255 9:98965727-98965749 CCTTCCCAGTGTCCCCCAGTGGG + Intronic
1058450439 9:105091411-105091433 CCTCCCCAGGGACTCTAAGCCGG + Intergenic
1061283342 9:129609607-129609629 CCTCCCCAGGGGCCCCAACAGGG - Intronic
1061296488 9:129679607-129679629 CCAATCCAGGGACTCCAGGTCGG - Intronic
1061604296 9:131697232-131697254 CCAACCCAGGGACTCCAAGAAGG + Intronic
1186434088 X:9528570-9528592 CCTGCCCAGGGGCCCAGAGTGGG - Intronic
1190731614 X:53230205-53230227 CCCACCCACACACCCCAAGTTGG + Intergenic
1192253266 X:69431827-69431849 TCTACCAAGGGAACACAAGTGGG - Intergenic
1195675801 X:107506635-107506657 CCTTCCCAGGTCCCCCGAGTGGG + Intergenic
1198273921 X:135083151-135083173 CCTACCCAGGGAACAAGAGTGGG + Intergenic
1199984059 X:152937819-152937841 CTTCCCCAGGGAACCCAAGTTGG + Intronic
1202598870 Y:26572091-26572113 CAAACCCAGTGACACCAAGTTGG - Intergenic