ID: 1183964801

View in Genome Browser
Species Human (GRCh38)
Location 22:41435247-41435269
Sequence ACTGGTTTGCAGACTGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183964801_1183964810 27 Left 1183964801 22:41435247-41435269 CCTTCCACAGTCTGCAAACCAGT 0: 1
1: 0
2: 2
3: 16
4: 177
Right 1183964810 22:41435297-41435319 TGTCTTGGGCTAAGCCACAGCGG 0: 1
1: 0
2: 1
3: 17
4: 187
1183964801_1183964808 13 Left 1183964801 22:41435247-41435269 CCTTCCACAGTCTGCAAACCAGT 0: 1
1: 0
2: 2
3: 16
4: 177
Right 1183964808 22:41435283-41435305 TTTTCCTCTGGGAGTGTCTTGGG 0: 1
1: 0
2: 0
3: 41
4: 265
1183964801_1183964806 2 Left 1183964801 22:41435247-41435269 CCTTCCACAGTCTGCAAACCAGT 0: 1
1: 0
2: 2
3: 16
4: 177
Right 1183964806 22:41435272-41435294 CTTCTGCAGTGTTTTCCTCTGGG 0: 1
1: 0
2: 0
3: 37
4: 346
1183964801_1183964805 1 Left 1183964801 22:41435247-41435269 CCTTCCACAGTCTGCAAACCAGT 0: 1
1: 0
2: 2
3: 16
4: 177
Right 1183964805 22:41435271-41435293 CCTTCTGCAGTGTTTTCCTCTGG 0: 1
1: 0
2: 2
3: 21
4: 264
1183964801_1183964807 12 Left 1183964801 22:41435247-41435269 CCTTCCACAGTCTGCAAACCAGT 0: 1
1: 0
2: 2
3: 16
4: 177
Right 1183964807 22:41435282-41435304 GTTTTCCTCTGGGAGTGTCTTGG 0: 1
1: 0
2: 1
3: 19
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183964801 Original CRISPR ACTGGTTTGCAGACTGTGGA AGG (reversed) Exonic
902669725 1:17964679-17964701 AGTGTTTTGCAGACTGGTGAGGG + Intergenic
906203935 1:43976931-43976953 TCTGCTTTGCAGAGTGGGGATGG + Intronic
912529553 1:110310462-110310484 GCTGGTTTGGATGCTGTGGAGGG - Intergenic
913062224 1:115219077-115219099 CCTGGTTCCCATACTGTGGATGG - Intergenic
916192063 1:162189413-162189435 ACTGGTTTCCATAATTTGGATGG + Intronic
916651917 1:166840679-166840701 ACTGGTTTGTAGAGACTGGACGG - Intronic
917250846 1:173059196-173059218 AATGGTTTGCATACTTTTGACGG - Intergenic
917263914 1:173199147-173199169 ACTGGGTTGCAAACTCTGGGAGG + Intronic
917517453 1:175719808-175719830 GCTGGTTTGAAGAATGGGGAGGG - Intronic
921565038 1:216706513-216706535 ACAGGATTGCAAACTTTGGAAGG - Intronic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
923888942 1:238189685-238189707 ACAGGTTGGCACAATGTGGATGG - Intergenic
924693023 1:246370074-246370096 AGAGGGTTGCAGACAGTGGAAGG - Intronic
1063383939 10:5604207-5604229 ACTGGTTTGCCTTCTGTGGGGGG + Intergenic
1065313137 10:24435575-24435597 ACTGTCTTGCAGCCTGTGCAAGG + Intronic
1065634161 10:27713216-27713238 ACTTGATTGCACACTATGGAAGG - Intronic
1068246506 10:54378034-54378056 ACTAATCTGCAGACTGTGGTGGG - Intronic
1068703159 10:60041831-60041853 ACTGGTATGCAGAGTGCTGAGGG - Intronic
1069945438 10:71982285-71982307 GCTGGTTTGCAGATGGAGGAAGG + Intronic
1073081555 10:100863887-100863909 ACTTGTTTGCAGAGAGTGCAGGG + Intergenic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1077287693 11:1775092-1775114 TCTGGTCTGCAGGCTTTGGAGGG + Intergenic
1080749042 11:35135897-35135919 AGTGCTTTGCAAACTGTAGAAGG - Intergenic
1081687617 11:45053765-45053787 ACAGGTTTGTATGCTGTGGAGGG - Intergenic
1082246031 11:49923748-49923770 ACTGCTTTACTGACTGGGGAAGG - Intergenic
1084197341 11:67530873-67530895 AATGGTTTGCAGACTATGTGGGG + Intergenic
1086944473 11:92831534-92831556 ACAGCTTTGCAGACTTTTGAAGG - Intronic
1088052170 11:105530245-105530267 TCTGGTTTGGAGAGTCTGGAGGG + Intergenic
1090419468 11:126564281-126564303 CCTGGGCTGCAGACGGTGGATGG - Intronic
1090765671 11:129874128-129874150 GCTGGTTCTGAGACTGTGGAAGG + Exonic
1094610524 12:31991085-31991107 GCTGCTTGGCAGACTGAGGAAGG + Intronic
1097808314 12:63989727-63989749 ACAGGCTTCCAGCCTGTGGATGG - Intronic
1098088197 12:66871183-66871205 TCTGGAATGCAGACTGTTGAAGG + Intergenic
1099307927 12:80981587-80981609 ACTGGTCTGCAGCCTGGGGTTGG - Intronic
1102900003 12:116628993-116629015 ACTAGATTACAGACTCTGGAAGG + Intergenic
1104241426 12:126993854-126993876 ACTGGTTCGCAGCCAGTGGCAGG + Intergenic
1104262071 12:127193771-127193793 AGTGCTTTGCAGACTCTGAAGGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105821880 13:24087300-24087322 AATGCTTTGCAGAGTGTGCAGGG - Intronic
1106942122 13:34791017-34791039 CCTGGTTTGCAAACTCTGGATGG + Intergenic
1108150236 13:47525911-47525933 ACTGGTTTACACATTCTGGAGGG + Intergenic
1109202439 13:59445936-59445958 ACTCATTTGAAGACTTTGGATGG - Intergenic
1111494742 13:89033552-89033574 ACAGGTTGGAAGAGTGTGGAGGG + Intergenic
1111813227 13:93118552-93118574 GGTGATTTGCAGCCTGTGGAAGG + Intergenic
1112598009 13:100827299-100827321 ACTACTCTGGAGACTGTGGAGGG + Intergenic
1112978584 13:105352811-105352833 TCTGGTTTGGAGAATGTGGTAGG - Intergenic
1113303218 13:109045766-109045788 AGGGCTGTGCAGACTGTGGAAGG - Intronic
1114498111 14:23147964-23147986 ACTGGCTTGCTCACTGTGGAGGG + Intronic
1115467796 14:33735223-33735245 AGTGGTTAGCAGACTGGGGCTGG - Exonic
1116939517 14:50776953-50776975 TATGGTTTACAGAATGTGGATGG - Exonic
1118459984 14:65978825-65978847 ACTGGGTAGCAGACAGGGGATGG + Intronic
1119316826 14:73703580-73703602 AATGTTTTGCAGACAGTGGGTGG - Exonic
1119560611 14:75586237-75586259 AATGTTTTGCAGACAGTGGGTGG + Intronic
1121277166 14:92676375-92676397 AGTGGTTTGCTGAGTGTGGATGG - Intronic
1121714330 14:96062217-96062239 CCTAGTGGGCAGACTGTGGAAGG - Intronic
1122016805 14:98803390-98803412 ACTGGTTTCCTGAGTCTGGATGG - Intergenic
1122496791 14:102162720-102162742 ACTGTTTGGGAGACTGTGGGAGG - Intronic
1122497353 14:102167774-102167796 ACTAGATTGCAGACTATTGAGGG + Intronic
1202940915 14_KI270725v1_random:144214-144236 TCTGGTTTGGAAACTGTGGTTGG - Intergenic
1124403114 15:29367669-29367691 ACTGCCTTGCAGAATGTGGAAGG + Intronic
1128818375 15:70630418-70630440 ACTGGTGGACAGGCTGTGGAAGG + Intergenic
1130431478 15:83851894-83851916 ACTGGTTAGGAGTTTGTGGATGG - Intronic
1130963263 15:88679041-88679063 ACTGTTTGCCAGGCTGTGGAGGG - Intergenic
1133901087 16:9975510-9975532 ATTTATTTGCAGTCTGTGGATGG - Intronic
1137378955 16:47980012-47980034 GCTGTTCTGCAGAATGTGGAAGG - Intergenic
1140492328 16:75348240-75348262 ACTATTTTGGAGACTGAGGAGGG - Intronic
1141912566 16:87070219-87070241 GCAGGTTTGCAGACCGTGGGTGG - Intergenic
1145108600 17:20141585-20141607 ACTGGATTGCACACTGTAAATGG - Intronic
1147540338 17:41351999-41352021 AGTGGTTTACACACTGGGGAGGG + Intergenic
1148710222 17:49674887-49674909 ACTGTTTTGCAGATTGGGGAGGG - Intronic
1148887936 17:50787043-50787065 CCTGGGATCCAGACTGTGGAGGG - Intergenic
1153776814 18:8461777-8461799 ACTTGATTCCAGACGGTGGAGGG - Intergenic
1156258429 18:35422161-35422183 ACTGGTTTGCTCTCTGTGGTGGG + Intergenic
1158249887 18:55476039-55476061 AGTGGTTTACAGAATGTGGTGGG - Intronic
1159349809 18:67258089-67258111 CCTGTTTTGCAGGCTGGGGAGGG + Intergenic
1160448006 18:78942162-78942184 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448017 18:78942210-78942232 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448027 18:78942258-78942280 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448037 18:78942306-78942328 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448055 18:78942401-78942423 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448065 18:78942449-78942471 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448076 18:78942497-78942519 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1160448113 18:78942687-78942709 TCAGGTTTGCAGGCTGTGGTTGG - Intergenic
1161150878 19:2708323-2708345 ACTGGTTTTCAGTGGGTGGATGG - Intergenic
1163809010 19:19418810-19418832 ACTGGTTTTGAGAGTGGGGAGGG + Intronic
1166355450 19:42224793-42224815 TCTGGTTTGCAGACTCTCGGAGG - Exonic
1168074351 19:53971453-53971475 ACTGGGTTTCAGACTCAGGATGG - Intronic
1168469455 19:56628842-56628864 CCTGGCTTGCAGCCTGTGTAGGG + Intergenic
925573206 2:5333219-5333241 AGTGTTTTGCAAACTGTGTAAGG + Intergenic
927178286 2:20425469-20425491 ACTGGCTGGCAGACTGTTGGGGG - Intergenic
931832793 2:66070056-66070078 ACAGGTTTGGAGACAGGGGAAGG + Intergenic
938154962 2:128928095-128928117 ACTGGATTGTATACTGTGGTAGG + Intergenic
938172460 2:129091259-129091281 ACTGGTTAGCAAACTGAAGACGG - Intergenic
941152493 2:161932185-161932207 ACTGGCTTACAGACTGAGGTTGG + Intronic
941339153 2:164284655-164284677 ACTGGTTTCCAGAGGGTAGAGGG + Intergenic
941904794 2:170710394-170710416 ATTGGCTTGCAGAGTCTGGAAGG - Intergenic
944581028 2:201133017-201133039 TCTGGTTTGCAGAGTGCTGATGG + Exonic
1170269990 20:14515683-14515705 ACTGGTTAGCAGAGGCTGGATGG + Intronic
1170738511 20:19031859-19031881 TCTGACTTGCAGAGTGTGGAAGG - Intergenic
1170772029 20:19341184-19341206 GCTGGTTTGCCTACTGTGGTGGG - Intronic
1172519084 20:35555848-35555870 AGGAGTTTGCAGGCTGTGGAAGG + Intronic
1173910786 20:46668920-46668942 ACTGTTCAGTAGACTGTGGAAGG + Intronic
1176377795 21:6095406-6095428 ACAGTCTTGAAGACTGTGGATGG + Intergenic
1176582245 21:8542727-8542749 TCTGGTTTGAAAACTGTGGTTGG + Intergenic
1179745679 21:43442842-43442864 ACAGTCTTGAAGACTGTGGATGG - Intergenic
1179901257 21:44395885-44395907 AGGGGTGTGGAGACTGTGGAGGG + Intronic
1179901326 21:44396108-44396130 AGGGGTGTGGAGACTGTGGAGGG + Intronic
1180265080 22:10519775-10519797 TCTGGTTTGAAAACTGTGGTTGG + Intergenic
1181374698 22:22447658-22447680 ACTGGCTGGCTGACTGTGGTTGG + Intergenic
1182005736 22:26957980-26958002 ACTGCATTGCAGACTGTAAATGG - Intergenic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184596744 22:45518533-45518555 ACTGGTTTGCAGAGTGACTAAGG + Intronic
1184752994 22:46499861-46499883 AGGGGTTTGCAGACGGTGGAGGG - Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951465752 3:22998791-22998813 ACAGGTTTGGACACTGTGAAAGG - Intergenic
951599900 3:24362213-24362235 ACAGCTTTGCAGACTGTGAAAGG - Intronic
953823737 3:46232442-46232464 ACTGTTCTGCAGCCTGAGGAAGG + Intronic
953959264 3:47254988-47255010 CATGGTTTGGAGACTGGGGAGGG - Intronic
953959326 3:47255529-47255551 CATGGTTTGGAGACTGGGGAGGG + Intronic
954010570 3:47633387-47633409 GCAGGTTTGAAGACTGAGGAAGG + Intronic
954342291 3:49964514-49964536 ACTCATTTGCAGATTGTGTATGG + Intronic
955375940 3:58397398-58397420 ACTGATTGGAAAACTGTGGAGGG + Intronic
955385016 3:58472313-58472335 ACAGGCTTCCAGACTCTGGACGG + Intergenic
958442906 3:94178443-94178465 ACGGGCTTGCAGACTGGGGAAGG - Intergenic
959374436 3:105571114-105571136 ATTGGTTTTCAAACTGTGGCAGG + Intronic
959399397 3:105881345-105881367 ACAGGTGTGGAGACTGTGGTAGG + Intergenic
962076564 3:132088461-132088483 ACAGCCTTGGAGACTGTGGATGG + Intronic
969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG + Intronic
970128231 4:12838436-12838458 ACAGGTTCACAGATTGTGGAAGG + Intergenic
970661242 4:18288091-18288113 ACTGGGGAGCAGCCTGTGGATGG + Intergenic
971315771 4:25566703-25566725 ACTGCATTGCAGACTGTGGTGGG - Intergenic
974033920 4:56800695-56800717 ACTGGTTTTCTTACTGTGCAGGG - Intergenic
974128877 4:57729678-57729700 ACTGGGTTCCTGACTGTGGTGGG - Intergenic
975830315 4:78362275-78362297 ACTGGTATACTGACTCTGGAAGG + Intronic
976922689 4:90457874-90457896 ATGGGTCTGCAGGCTGTGGATGG - Intronic
978168590 4:105640501-105640523 ACTGGACTGGAGACTCTGGAAGG - Intronic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
982062600 4:151619883-151619905 ACTGGTGTGCAGAATATGAAAGG - Intronic
983559794 4:169089188-169089210 ATTGGTTTGCATAGTGTGCATGG - Intergenic
990039947 5:51367373-51367395 TCCAGTTTACAGACTGTGGAAGG + Intergenic
992495822 5:77292232-77292254 ACTGGTTCTCTGACTGTGGCTGG + Intronic
992673861 5:79085801-79085823 CCTGGTTTCCTGTCTGTGGAAGG - Intronic
995370431 5:111412498-111412520 ACTGGTTTGAGGACTGAGGCTGG - Intronic
995865422 5:116685245-116685267 AGTCCTATGCAGACTGTGGAGGG + Intergenic
996523533 5:124452762-124452784 CCTGGTTTGCAGAGTGCAGAGGG + Intergenic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
999671275 5:153960763-153960785 GCTGGTTTGCAGATTGTGGGTGG - Intergenic
1000903105 5:166932383-166932405 ACTGGTTCTAAGACTGGGGAAGG + Intergenic
1004324977 6:14666226-14666248 AGTGGGTTGGAGACTGGGGAAGG - Intergenic
1005681909 6:28216640-28216662 ACTGGTTTCCGGACTGCAGAGGG - Intergenic
1006648573 6:35532619-35532641 ACTGTTTTGCAGAGGCTGGAGGG - Intergenic
1008756021 6:54796526-54796548 ACTGGATAACAGACTGAGGATGG + Intergenic
1009061241 6:58400102-58400124 ACTGGTGAGCAGTCTGTGTATGG + Intergenic
1010759462 6:79706430-79706452 ACTGTTCTGCAGATTGTAGATGG - Intergenic
1012547177 6:100433139-100433161 ACTGGTTTGGAGAGTATGGATGG - Intronic
1014685478 6:124494055-124494077 ACTGGTTTGGAGAATCAGGAAGG - Intronic
1017744107 6:157431503-157431525 TCTGTTTTGGAGACTGAGGATGG + Intronic
1018278097 6:162154152-162154174 ACTGTTTTTCAGAGTGTGGTGGG - Intronic
1018640870 6:165902798-165902820 ACCTGTGTCCAGACTGTGGAAGG - Intronic
1019972703 7:4554365-4554387 AGTGCTTTGCACACTGTGGAGGG - Intergenic
1024502140 7:50121425-50121447 GCTGGTTTGCAGCCTGTGATTGG - Intronic
1027435519 7:78160113-78160135 ACTGGTCTGCAGGCTGTGGGAGG + Exonic
1028389105 7:90294871-90294893 ACTGGTTTGCACAGAGGGGAAGG + Intronic
1029452488 7:100648921-100648943 AGAGATTTGCAGACTGGGGATGG - Intronic
1033073552 7:138227077-138227099 ATTGGCTTTCAGACTATGGAAGG + Intergenic
1033243373 7:139699481-139699503 GCTGGGTTGGAGGCTGTGGATGG - Intronic
1036397416 8:8381169-8381191 TGTGATTTGCAGACTGTGTAGGG - Intronic
1038341688 8:26691461-26691483 ACTGTGTTGGAGACTGTTGAAGG + Intergenic
1040521344 8:48178812-48178834 CCTGGTTTTCAGGCTTTGGAGGG - Intergenic
1040794927 8:51279158-51279180 ATTTGTTTGCACATTGTGGATGG + Intergenic
1041591884 8:59596824-59596846 ACTGGTTTGCAAACTGGCCAGGG + Intergenic
1043922912 8:86004340-86004362 ACTGGATTGCAGACTTTTGGTGG - Intronic
1045455379 8:102373477-102373499 ACAGGTATTCAGAATGTGGATGG - Intronic
1048452323 8:134544212-134544234 AAGGATTTGCAGCCTGTGGAGGG - Intronic
1048500996 8:134974881-134974903 CCTGTCTTGCAGACTGGGGAAGG - Intergenic
1048846015 8:138604301-138604323 GCTGGGTAGAAGACTGTGGAGGG + Intronic
1048926750 8:139278306-139278328 AGTGGCTTGTAGACTGTTGAGGG - Intergenic
1051721534 9:20042105-20042127 CCTGGTGGGCAGACTGTGGCAGG + Intergenic
1051919882 9:22252250-22252272 AAAGGTTGGAAGACTGTGGAGGG - Intergenic
1055799219 9:80014740-80014762 GCTGGTTTGCAGTCTTTGTAAGG + Intergenic
1056998108 9:91483068-91483090 ACTGTTGAGCAGACTGTTGAGGG - Intergenic
1058261824 9:102842921-102842943 ACCGATTTGCAGTCTGTGCATGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1061129966 9:128703132-128703154 ACTGATTTGGAGACTGTGCAAGG - Intronic
1203612261 Un_KI270749v1:20741-20763 TCTGGTTTGGAAACTGTGGTTGG + Intergenic
1189037468 X:37507033-37507055 ACTGCTTTGAAGAATGTAGAGGG + Intronic
1189621562 X:42845896-42845918 ACTGGCTTGCACACTGGGGTGGG - Intergenic
1193198774 X:78663500-78663522 AAAGGTTTGCAGACTGCTGAAGG + Intergenic
1194306930 X:92259152-92259174 AGAGGTTGGAAGACTGTGGAGGG - Intronic
1194642362 X:96417627-96417649 CCTGGTGTCCAGACTGTAGATGG + Intergenic
1195715894 X:107818496-107818518 AGAGGTTGGAAGACTGTGGAGGG + Intergenic
1197907147 X:131437692-131437714 ACTGCCTTGGAGACTGTGGCTGG + Intergenic
1198279010 X:135123953-135123975 AGTGGCTTGCAGAGTGGGGAGGG + Intergenic
1198291948 X:135248567-135248589 AGTGGCTTGCAGAGTGGGGAGGG - Intergenic
1198297981 X:135305546-135305568 AGTGGCTTGCAGAGTGGGGAGGG - Intronic
1199672335 X:150157921-150157943 ACAGGTTTGGAGACTTAGGATGG + Intergenic