ID: 1183966186

View in Genome Browser
Species Human (GRCh38)
Location 22:41444384-41444406
Sequence CTCCATGTTCCTCAGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 371}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183966178_1183966186 10 Left 1183966178 22:41444351-41444373 CCCCTTTCGGCTATGAAGACCCT 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1183966186 22:41444384-41444406 CTCCATGTTCCTCAGGAGCTAGG 0: 1
1: 0
2: 2
3: 25
4: 371
1183966180_1183966186 8 Left 1183966180 22:41444353-41444375 CCTTTCGGCTATGAAGACCCTTT 0: 1
1: 0
2: 0
3: 5
4: 60
Right 1183966186 22:41444384-41444406 CTCCATGTTCCTCAGGAGCTAGG 0: 1
1: 0
2: 2
3: 25
4: 371
1183966183_1183966186 -9 Left 1183966183 22:41444370-41444392 CCCTTTCTAGGGCACTCCATGTT 0: 1
1: 0
2: 2
3: 8
4: 115
Right 1183966186 22:41444384-41444406 CTCCATGTTCCTCAGGAGCTAGG 0: 1
1: 0
2: 2
3: 25
4: 371
1183966179_1183966186 9 Left 1183966179 22:41444352-41444374 CCCTTTCGGCTATGAAGACCCTT 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1183966186 22:41444384-41444406 CTCCATGTTCCTCAGGAGCTAGG 0: 1
1: 0
2: 2
3: 25
4: 371
1183966176_1183966186 30 Left 1183966176 22:41444331-41444353 CCTTAGGTCTGACAACAAGGCCC 0: 1
1: 0
2: 1
3: 7
4: 75
Right 1183966186 22:41444384-41444406 CTCCATGTTCCTCAGGAGCTAGG 0: 1
1: 0
2: 2
3: 25
4: 371
1183966184_1183966186 -10 Left 1183966184 22:41444371-41444393 CCTTTCTAGGGCACTCCATGTTC 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1183966186 22:41444384-41444406 CTCCATGTTCCTCAGGAGCTAGG 0: 1
1: 0
2: 2
3: 25
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183966186 Original CRISPR CTCCATGTTCCTCAGGAGCT AGG Intronic
900643748 1:3699422-3699444 CTCCTTGTTCTACAAGAGCTGGG + Intronic
900833734 1:4984423-4984445 CTCCATGCTTCTCAGGAGAAAGG - Intergenic
901082024 1:6588917-6588939 CTCCATGTGCCTCCGCAGGTGGG - Exonic
901314493 1:8296868-8296890 CTCCATCTTGAACAGGAGCTGGG - Intergenic
901648410 1:10728897-10728919 CCCTTTGTTCCACAGGAGCTGGG + Intronic
901913208 1:12477847-12477869 TTCCAGGTTCCACAGGAGATGGG - Intronic
903849350 1:26296842-26296864 CGGCATGTTCCTCAGGAGCTGGG - Intronic
905271202 1:36788898-36788920 TTCCATATTTCCCAGGAGCTGGG - Intergenic
905862328 1:41359955-41359977 CTCCAGCGTCCTCAGGAGCAAGG + Intergenic
906000799 1:42423142-42423164 CTCCCTGACCCTCAGAAGCTGGG - Intergenic
906170394 1:43720111-43720133 CTTCAGCTTCCTCAGCAGCTGGG - Intronic
906256351 1:44353889-44353911 CTGCCTTTTCCTCAGGAGGTGGG - Intronic
906518317 1:46452564-46452586 CTCCGTGTCCCACAGGTGCTGGG - Intergenic
906751029 1:48260147-48260169 CTCTAAGTTCCTCAAGAGCAGGG + Intergenic
907617235 1:55937808-55937830 CACCATGATCCCCAGGAGCAGGG - Intergenic
908271765 1:62429455-62429477 TGCCATGTTTCTCTGGAGCTGGG + Intergenic
908765066 1:67547197-67547219 ATCCATGTCCCTGAGTAGCTGGG + Intergenic
909430450 1:75582204-75582226 GCGCATGTTCCTCAGGAACTTGG - Intronic
910681184 1:89866769-89866791 CTCCATGCTCCTGAGGGGATGGG - Intronic
911349812 1:96739727-96739749 CGCCATCTTCCTGAGTAGCTGGG + Intronic
912124249 1:106513456-106513478 CTGCATTTTCTTCTGGAGCTTGG + Intergenic
914868650 1:151454989-151455011 CTTCAGCTTCCTCAGTAGCTGGG - Intronic
915552621 1:156644154-156644176 CTCCATGTTCCAGAGCAGTTAGG + Intronic
915690500 1:157684377-157684399 CTCCCTGTTCCTCAGGGAGTGGG + Intronic
916788327 1:168102784-168102806 CTCCATGTTCCACGGGACCCAGG + Intronic
916873080 1:168938572-168938594 GCCCATGTTCCTCAGGAACTTGG - Intergenic
917046040 1:170861344-170861366 GTCCATGATCCTCAGGACCTGGG + Intergenic
919900810 1:202042941-202042963 CTTCATGTTCGTCACCAGCTTGG + Intergenic
921376940 1:214484286-214484308 CCCCAGCTTCCTGAGGAGCTAGG - Intronic
922540697 1:226417098-226417120 CCCCAGGCTCCTGAGGAGCTGGG + Intergenic
922704214 1:227780522-227780544 CTTCATCCTCCTCAGGATCTGGG - Exonic
923986821 1:239391020-239391042 CTGCATCTTCCTTAGTAGCTAGG - Intronic
924060356 1:240167954-240167976 CCTCAGCTTCCTCAGGAGCTGGG - Intronic
924683919 1:246268076-246268098 CTCCATCTTGAACAGGAGCTGGG + Intronic
1064053339 10:12077341-12077363 CTTCATCTTCCTGAGTAGCTGGG + Intronic
1064075514 10:12265545-12265567 CTCCATCTTAAACAGGAGCTGGG - Intergenic
1064994272 10:21282690-21282712 CTCCATGTTGAATAGGAGCTGGG + Intergenic
1065681570 10:28239259-28239281 CCCCAGGCTCCTGAGGAGCTGGG + Intronic
1067090348 10:43263174-43263196 GTCCCTGTTCCTCAAGACCTGGG - Intronic
1070537970 10:77393557-77393579 CTCCATCTGTCTCAGGGGCTTGG - Intronic
1070874228 10:79786911-79786933 CCCCATTGTCCTCAAGAGCTAGG - Intergenic
1071641158 10:87309052-87309074 CCCCATTGTCCTCAAGAGCTAGG - Intergenic
1072617063 10:97056941-97056963 CACCAAGCTCCTCAGGAGCACGG + Intronic
1073780897 10:106837407-106837429 CTGCCTGGTTCTCAGGAGCTGGG + Intronic
1074592838 10:114829702-114829724 CTCCATCTTGAACAGGAGCTGGG - Intronic
1076610287 10:131722149-131722171 TTCCATGAGCCTCAGGAGGTGGG - Intergenic
1076905453 10:133358575-133358597 CTCCCGGTCCCTCAGGAGCGTGG - Intergenic
1076987650 11:250825-250847 CTGAATTTTCCTCAGAAGCTGGG - Exonic
1077005328 11:352544-352566 CTCCATCTTGATTAGGAGCTGGG - Intergenic
1077007948 11:367964-367986 CTTCAGGTTCTTGAGGAGCTGGG - Intergenic
1077049169 11:559045-559067 CTCAATGTTCTTCGGGAGCTGGG + Intronic
1077310418 11:1886465-1886487 CTCCATGCTCCTCATGGGGTAGG - Intronic
1079788106 11:24701151-24701173 CTCCGTGGAACTCAGGAGCTTGG + Intronic
1080532481 11:33190372-33190394 GCACATGTTCCTCAGGAACTTGG + Intergenic
1080960021 11:37147133-37147155 CTTCAGCTTCCTGAGGAGCTGGG - Intergenic
1081747394 11:45482730-45482752 CTCCTTGGTTCTCAGTAGCTTGG - Intergenic
1084045643 11:66566397-66566419 CTCCTTGGTCCTCAGAAGCCCGG - Exonic
1084385657 11:68841551-68841573 CCCCATGTTCCCCAGGGGATTGG - Intronic
1086097142 11:83061792-83061814 CTTCCTGTTCCTGAGTAGCTGGG + Intronic
1089307945 11:117538485-117538507 CTCCTTCCTCCTCAGGAGCTGGG + Intronic
1090422667 11:126586242-126586264 CTCTATGTTCCTCATGAACAAGG - Intronic
1091868154 12:3860790-3860812 CTTCAGCTTCCTGAGGAGCTGGG + Intronic
1092354921 12:7786842-7786864 CTCCATCTTCAATAGGAGCTGGG - Intergenic
1092367629 12:7890170-7890192 CTCCATCTTCAATAGGAGCTGGG - Intronic
1092524637 12:9302244-9302266 CTCCATGTACTGCAGCAGCTGGG - Intergenic
1092542628 12:9429568-9429590 CTCCATGTACTGCAGCAGCTGGG + Intergenic
1092881895 12:12893133-12893155 TTCCATGTTCCTGCGGAGCTGGG - Intronic
1093027129 12:14255278-14255300 CCCCATCTTCCTCAGGGGTTGGG - Intergenic
1096337242 12:50765577-50765599 CTCCATCTTAAACAGGAGCTGGG + Intronic
1096632693 12:52938967-52938989 CCTCATCCTCCTCAGGAGCTAGG - Intronic
1100384842 12:94096216-94096238 CTCCAGGTTCCTCAGCATTTGGG - Intergenic
1100531761 12:95467730-95467752 GCGCATGTTCCTCAGGAACTTGG + Intergenic
1100887215 12:99084600-99084622 CTTCATCTTCCTGAGTAGCTGGG - Intronic
1101430912 12:104626443-104626465 CTCCTTGTTTCTCAGGGGTTCGG - Intronic
1102536356 12:113584279-113584301 CTCCATCTTGACCAGGAGCTGGG - Intergenic
1102916148 12:116753909-116753931 CCCCATGTTGCTCAGCACCTGGG + Intronic
1103266729 12:119636791-119636813 CTTCATGTTACTCAGGAGTAAGG + Intronic
1103384703 12:120522986-120523008 GCGCATGTTCCTCAGGAACTTGG + Intronic
1104092976 12:125531299-125531321 CTTCAGGTTCCTGAGGAGCTGGG + Intronic
1104307597 12:127623536-127623558 CTCCATCTTGAACAGGAGCTGGG + Intergenic
1106460488 13:29963806-29963828 CTGCATGTTCCTCAGGGACCTGG + Intergenic
1106562311 13:30857281-30857303 CTCGAGGTTCCTCAGTGGCTTGG + Intergenic
1107376051 13:39805799-39805821 CTCCATGTTGAATAGGAGCTGGG - Intergenic
1107525121 13:41222785-41222807 CTCCATACTCTTCTGGAGCTTGG - Intronic
1107750004 13:43554773-43554795 CACCATGTTGCTCAGGAGTCTGG + Intronic
1107855515 13:44611710-44611732 CCCCAGCTTCCTGAGGAGCTGGG - Intergenic
1107966416 13:45602219-45602241 CTCCCTTTTCCTCAGGAGGCTGG + Intronic
1111541367 13:89671227-89671249 CTGCATGTTGCTCAAGAGTTAGG - Intergenic
1111711086 13:91815268-91815290 CTCAGTGTTCCTGAGTAGCTGGG - Intronic
1112020813 13:95369606-95369628 ATCCATCTCCCTGAGGAGCTTGG + Intergenic
1112187302 13:97139760-97139782 CTCCATGTGCGTCTGAAGCTGGG - Intergenic
1113089783 13:106605141-106605163 CTCCATGTTGAATAGGAGCTAGG + Intergenic
1113108349 13:106795706-106795728 CTCCATCTTGCACAGGGGCTGGG + Intergenic
1113651378 13:112036337-112036359 CTGCATTTTCCTCAGCAGCAGGG + Intergenic
1115482375 14:33874013-33874035 CTCCATCTTAAACAGGAGCTGGG + Intergenic
1115994453 14:39181249-39181271 CCCCAAGTTACTCAGGAGCAAGG + Exonic
1116576430 14:46581716-46581738 TTCCATGATCCTCAGTAGGTAGG - Intergenic
1117218764 14:53579999-53580021 CTTCAGGTTGCTCAGCAGCTTGG - Intergenic
1119879140 14:78086415-78086437 CCTCATAGTCCTCAGGAGCTAGG - Intergenic
1121309217 14:92926036-92926058 CTCCATGTTCATCATGGGATGGG - Intronic
1121568556 14:94929317-94929339 CCTCATCCTCCTCAGGAGCTGGG - Intergenic
1121633264 14:95436916-95436938 CCCAAAGTTCCTCAGGAGCTGGG + Exonic
1121820115 14:96959287-96959309 ATCCCTGTTCCTAAGAAGCTTGG + Intergenic
1122104972 14:99446169-99446191 CTCGCTGTTCCTCCAGAGCTGGG - Intronic
1123014891 14:105368921-105368943 CTCCACGGTCCCCAGGAGCTTGG + Intronic
1125499584 15:40231082-40231104 CTCCAAGTTGTTCAGGAACTTGG - Intergenic
1125994968 15:44150676-44150698 CTTCATCTTCCTGAGTAGCTGGG - Intronic
1126133224 15:45364416-45364438 CTCCAGCTTCCTAAGTAGCTGGG - Intronic
1127566782 15:60197044-60197066 CCCCAGGTTCCTAAGTAGCTGGG + Intergenic
1127888623 15:63227203-63227225 CTCCATCTTAAACAGGAGCTGGG - Intronic
1129160797 15:73746646-73746668 CTCCATCTTCCTGAGGTGTTTGG + Intronic
1131177823 15:90220968-90220990 CTCCATGTTCTGCAGGAGGGTGG - Exonic
1131915360 15:97259517-97259539 GTGCATGGTCCTCAGGACCTGGG + Intergenic
1132519128 16:379360-379382 CGCCAGGTTCCCCTGGAGCTTGG - Intronic
1133024594 16:2982700-2982722 CTCCAGCCTCCTGAGGAGCTGGG - Intergenic
1133569260 16:7025495-7025517 CTCCATCTTCCATAGGGGCTGGG - Intronic
1135720171 16:24810493-24810515 CTCAATGCTCCTAAGGAACTTGG - Intronic
1136092165 16:27928350-27928372 CTGCAGGGTCCTGAGGAGCTGGG - Intronic
1137629933 16:49936053-49936075 CTCCCGTGTCCTCAGGAGCTGGG - Intergenic
1138919043 16:61504186-61504208 CTCGCTGTTCCTGAGTAGCTGGG - Intergenic
1139958860 16:70706259-70706281 CTCCAGGTCCCTCAGAGGCTGGG + Intronic
1139971632 16:70779956-70779978 CTTCAGCTTCCTGAGGAGCTGGG + Intronic
1140500771 16:75432025-75432047 CTCCAGCCTCCTGAGGAGCTGGG + Intronic
1140941634 16:79726618-79726640 CTTCTTGTTCCACAGAAGCTTGG - Intergenic
1141277261 16:82599668-82599690 CACAATGTTTCTCAGGACCTAGG + Intergenic
1141447073 16:84067750-84067772 GTCCACGTCCCTCCGGAGCTTGG + Exonic
1141760525 16:86025948-86025970 CTCCATGTTCCCCAGGAGACAGG - Intergenic
1142377174 16:89712082-89712104 CTCCATCTTTCTCTGGAGCTGGG + Exonic
1142523618 17:522136-522158 CTCAGTCTTCCTCAGTAGCTGGG - Intronic
1142771175 17:2098102-2098124 CCTCAACTTCCTCAGGAGCTGGG + Intronic
1143095196 17:4475192-4475214 CTCCATGTTTCTCAGGCTCCAGG + Intronic
1143378098 17:6479069-6479091 CTACATGTTCCACACTAGCTGGG - Intronic
1143570394 17:7754496-7754518 GCGCATGTTCCTCAGGAACTTGG - Intronic
1143685860 17:8515035-8515057 CTCTGAGTTCCTCAGGAGCAGGG + Intronic
1144473061 17:15561754-15561776 CTCCATCTTCAATAGGAGCTGGG + Intronic
1144923421 17:18782966-18782988 CTCCATCTTCAATAGGAGCTGGG - Intronic
1145165108 17:20607925-20607947 CTTCAGCTTCCTGAGGAGCTGGG + Intergenic
1145411538 17:22670117-22670139 TTCCATGTTCCTCATGAACCTGG + Intergenic
1147536614 17:41326203-41326225 CTCAAGGTTCCTCATTAGCTTGG + Intergenic
1148545331 17:48514412-48514434 CTACAGGTTCCCCAGGACCTGGG + Intergenic
1150316876 17:64176186-64176208 CTTCCTCTTTCTCAGGAGCTGGG + Intronic
1150495560 17:65605436-65605458 CTCCACCTTCCACAAGAGCTTGG + Intronic
1150532442 17:65998265-65998287 CCCCAGTTTCCTGAGGAGCTGGG - Intronic
1150680972 17:67284254-67284276 CTCCATCTTGAACAGGAGCTGGG - Intergenic
1151194753 17:72423604-72423626 GTCCATGTTGCCCAGGAGCCTGG + Intergenic
1151786562 17:76278087-76278109 CTCAATGTTCATCAGCATCTTGG + Exonic
1153547202 18:6219948-6219970 CTCCAGCTTCCTGAGTAGCTGGG - Intronic
1153587775 18:6641080-6641102 CTCCACTTTCCCCAGGAGCTCGG - Intergenic
1154463606 18:14621044-14621066 CTCCATCTTAAACAGGAGCTAGG - Intergenic
1155286828 18:24297907-24297929 CTCCATCTTAAACAGGAGCTGGG + Intronic
1155452321 18:25976052-25976074 CTCCATCTTAAACAGGAGCTGGG + Intergenic
1156313619 18:35947724-35947746 GTCCAGGTTCCTGATGAGCTAGG + Intergenic
1156927982 18:42606157-42606179 ATCCTTCTTCCTCAGTAGCTGGG - Intergenic
1158448637 18:57543346-57543368 TCCCTTGATCCTCAGGAGCTAGG - Intergenic
1160598441 18:79994082-79994104 CTTTATGTTCCTCAGCTGCTGGG - Intronic
1161870507 19:6866078-6866100 CTCCATCTTGAACAGGAGCTGGG - Intergenic
1162347762 19:10130415-10130437 CTTCATGCTCCTGAGTAGCTGGG + Intergenic
1162422582 19:10574385-10574407 CCCCATTGTCCCCAGGAGCTGGG + Intronic
1163030860 19:14543246-14543268 ATGAATGTTTCTCAGGAGCTGGG + Intronic
1163164479 19:15486000-15486022 CTCCATCTTGAACAGGAGCTGGG - Intronic
1163579862 19:18131921-18131943 GCCCATGTTCTTCAGGAGCGTGG - Exonic
1164454826 19:28398351-28398373 CTCCATGTCTCTGAGGAGCAAGG - Intergenic
1164837495 19:31366734-31366756 TTCCATGTGCATCAGGGGCTCGG + Intergenic
1165169212 19:33879470-33879492 CTCCAGCTTCCTGAGTAGCTGGG - Intergenic
1165213053 19:34250830-34250852 CTCCAGCTTCCTAAGTAGCTGGG + Intergenic
1165218677 19:34296609-34296631 GTGCATGTTCCTCAGGAACCTGG + Intronic
1165437758 19:35805933-35805955 CTCCATGTTACCCAGGGGCTTGG - Intronic
1165987755 19:39785621-39785643 CCTCATGTTCCTCAGGAATTCGG - Intronic
1166696837 19:44856690-44856712 CTCCAGATTCCCCAGGTGCTGGG - Intronic
1167091194 19:47345137-47345159 CTCCATCTTGAACAGGAGCTGGG - Intergenic
1167686402 19:50959571-50959593 CTCTATGTTCCTCTGCATCTTGG - Intronic
1168385724 19:55961684-55961706 CTTCATCTGCCTGAGGAGCTGGG - Intronic
1168723018 19:58565034-58565056 CTTCATCTTCCTGAGTAGCTGGG + Intronic
926245949 2:11122616-11122638 CTCCATCTTGCGTAGGAGCTGGG - Intergenic
926959728 2:18343040-18343062 CTCCATCTTAAACAGGAGCTGGG + Intronic
927129859 2:20049924-20049946 CTCCATTTTGCTGAGGGGCTGGG - Intronic
928439728 2:31282245-31282267 CTCCATGTTAAATAGGAGCTGGG + Intergenic
928483570 2:31707490-31707512 CTCCAGCTTCCTGAGTAGCTGGG - Intergenic
929148745 2:38729408-38729430 CTGCATGTTTCCCAGGATCTGGG + Intronic
932143360 2:69298408-69298430 CTCCATGTGGCTTAGGAGCCTGG + Intergenic
935242172 2:101188445-101188467 CTTCAGCTTCCTCAGTAGCTGGG + Intronic
935292606 2:101622707-101622729 CTCCAGTGTCCTCAGGCGCTAGG - Intergenic
935316420 2:101839163-101839185 GGCCATGGTCCTCATGAGCTGGG + Intronic
938407615 2:131041123-131041145 CTACATTTCCTTCAGGAGCTGGG - Intronic
940863370 2:158792393-158792415 CTCCATGTTGCCCAGGAGGCTGG + Intergenic
940896127 2:159083059-159083081 CTTCATCTTCCTGAGTAGCTGGG + Intronic
940982871 2:160023183-160023205 CTCCATCTTGTTTAGGAGCTGGG + Intronic
941255973 2:163231318-163231340 CTCCCTGTTCCTCAGTAACCTGG - Intergenic
941284765 2:163596531-163596553 CACCATGTTCCTCTTGAGTTAGG - Intronic
942403177 2:175624896-175624918 CTCCATGTGCCTCAGAAACTAGG + Intergenic
942521609 2:176809743-176809765 GTGCATGTTCCTCAGGAACTTGG + Intergenic
942774045 2:179559266-179559288 CTCCATGTTTCTCAGGAAAAGGG - Intronic
943467068 2:188240953-188240975 ATCCATCTTCCTGAGGAGTTTGG + Intergenic
945472082 2:210238878-210238900 CTTCATCCTCCTGAGGAGCTGGG + Intergenic
945863922 2:215155492-215155514 CCCCAGGTTCCTGAGTAGCTGGG - Intergenic
946189373 2:217999983-218000005 CTCACTGGTCCTCAGGAACTGGG - Intronic
946950590 2:224870543-224870565 CTTCATGTTCCTCAGCTTCTTGG + Intronic
947947795 2:234121317-234121339 CCCCATGTTCCTTAGGAGGTTGG + Intergenic
948094345 2:235321579-235321601 CTCCATCTTGAACAGGAGCTGGG + Intergenic
948932075 2:241138287-241138309 CTTCTTGTTCTTCAGGAGCCTGG + Intronic
1170415511 20:16134636-16134658 CTGCATGTTGAACAGGAGCTAGG - Intergenic
1171294227 20:24003639-24003661 CTCCATAATCCTCAGTAGGTAGG - Intergenic
1171542809 20:25977414-25977436 TTCCATGTTCCTCATGAACCTGG + Intergenic
1171845842 20:30274063-30274085 TTCCATGTTCCTCATGAACCTGG + Intergenic
1172062564 20:32196551-32196573 CTCAAGATTCCCCAGGAGCTGGG - Exonic
1172171419 20:32936146-32936168 CTCCAACTTCCTGAGTAGCTGGG + Intronic
1172813034 20:37664023-37664045 CTCCATCTTAAACAGGAGCTGGG - Intergenic
1173271197 20:41536847-41536869 CTCTCTATTCCTCAGGAGCTTGG - Intronic
1173906847 20:46635652-46635674 CTCCATCTTGAACAGGAGCTGGG + Intronic
1174041286 20:47701596-47701618 CTCTATGCTCACCAGGAGCTAGG + Intronic
1174297395 20:49558639-49558661 CTCCATGTTGAATAGGAGCTGGG + Intronic
1174602326 20:51734716-51734738 GTGCATGTTCCTCAGGAACTTGG - Intronic
1175097343 20:56552050-56552072 CTCCATCTTAAACAGGAGCTGGG + Intergenic
1175106183 20:56616724-56616746 CTCCATTGTCCACAGGAACTGGG - Intergenic
1175144385 20:56884786-56884808 CTCCGTGTTGAACAGGAGCTGGG - Intergenic
1175144714 20:56886761-56886783 CTCCATGTTGAATAGGAGCTGGG + Intergenic
1175865754 20:62175462-62175484 CTCCTGGTGCCTCAGGACCTTGG - Intronic
1176230943 20:64032637-64032659 GTCCATGCTCCTCAGGAGGTGGG + Intronic
1176377932 21:6095969-6095991 GACCATGTGGCTCAGGAGCTGGG + Intergenic
1176810918 21:13537328-13537350 CTCCATCTTAAACAGGAGCTAGG + Intergenic
1177656956 21:24029647-24029669 CATCATCTTCCTCAGTAGCTGGG + Intergenic
1178194302 21:30325830-30325852 CTCCATGGTTCTCAGGCCCTTGG - Intergenic
1179434305 21:41349857-41349879 CTTCATGTTCCTCTAGAGCCAGG + Intronic
1179745542 21:43442279-43442301 GACCATGTGGCTCAGGAGCTGGG - Intergenic
1179788596 21:43743162-43743184 CCCCATAGTGCTCAGGAGCTGGG - Intronic
1180542022 22:16458306-16458328 CTTCATGCTCCTGAGTAGCTGGG + Intergenic
1180578355 22:16803426-16803448 CTCCATCTTAAACAGGAGCTAGG + Intronic
1181142243 22:20814630-20814652 CTCCAGCTTCCTGAGTAGCTGGG - Intronic
1182433366 22:30314253-30314275 CTCCAAGCTCCTCAGGAGCAAGG - Intronic
1182693307 22:32178366-32178388 ATGCATGTTCCTCCAGAGCTGGG + Intergenic
1183247881 22:36708036-36708058 CTCCATGGTCTCCAGGTGCTTGG - Intergenic
1183459048 22:37938732-37938754 CTTCAGCTTCCTCAGTAGCTGGG + Intronic
1183966186 22:41444384-41444406 CTCCATGTTCCTCAGGAGCTAGG + Intronic
1184151108 22:42639206-42639228 CTCCAGCTTCCTGAGTAGCTGGG - Intronic
1184726671 22:46351250-46351272 CTCGATCCTCCTGAGGAGCTGGG - Intronic
1185069837 22:48649936-48649958 CTCCTGGTGCCTCAGGAGCCGGG + Intronic
950003152 3:9673031-9673053 CTCAAGTTTTCTCAGGAGCTTGG + Intronic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950590777 3:13934672-13934694 CTCCTTGGTCCTCAGGAGTGAGG - Intergenic
952772711 3:37016856-37016878 GTGCATGTTCCTCAGGAACTTGG + Intronic
952976754 3:38703054-38703076 CCCCATGTACCTCAGGGGTTAGG + Intronic
953351809 3:42221625-42221647 CTGCATGGTCCCTAGGAGCTGGG - Intronic
954388811 3:50258390-50258412 CCCCATCTTCCTCAGGGGTTGGG - Exonic
954620760 3:51994097-51994119 GCGCATGTTCCTCAGGAACTTGG + Exonic
954938020 3:54344754-54344776 CTCCATCTTAATTAGGAGCTGGG + Intronic
955416498 3:58696755-58696777 CTCCATCTTAAGCAGGAGCTGGG + Intergenic
955424667 3:58775941-58775963 CTCCATGTTGGTCAGGCTCTTGG + Intronic
955834863 3:63043808-63043830 CTCCCTCTTCAACAGGAGCTTGG + Intergenic
958038683 3:88200171-88200193 CTCCATGTTCCAGTGGAACTGGG - Intergenic
958682528 3:97350257-97350279 CACCATGTTTCTCAGGGCCTAGG - Intronic
959381900 3:105651332-105651354 CTCCATTTTCCTCAGGAAAATGG - Intergenic
960613099 3:119572699-119572721 CCCCAGCTTCCTCAGTAGCTAGG + Intergenic
961625095 3:128256002-128256024 CTCCATCTTCCTCAGACCCTAGG - Intronic
962738053 3:138343462-138343484 CTCCAGCTTCATTAGGAGCTAGG - Intergenic
964037274 3:152214840-152214862 CTTCATCTTCCTGAGTAGCTGGG - Intergenic
966898141 3:184461208-184461230 CTCAGTCTTCCTCAGTAGCTGGG + Intronic
967183001 3:186922622-186922644 GCACATGTTCCTCAGGAACTTGG + Intergenic
968927132 4:3555445-3555467 CTCCATCTTGAACAGGAGCTGGG - Intergenic
969204504 4:5633257-5633279 CTGCATTCTCCTCTGGAGCTTGG - Intronic
969850754 4:9954568-9954590 CTCCCTCTTCCTCTGGATCTGGG + Intronic
971913898 4:32842020-32842042 CTTCATCTTCCTGAGTAGCTGGG + Intergenic
972302391 4:37797330-37797352 CTCACAGTTCCTTAGGAGCTGGG + Intergenic
972405421 4:38741886-38741908 CTTCAGGCTCCTCAGTAGCTGGG - Intergenic
972773344 4:42218868-42218890 CTGCTTGTTCTTCAGGAGCAGGG + Intergenic
974920914 4:68237899-68237921 CTTCAGCTTCCTCAGTAGCTGGG - Intronic
975059591 4:69980781-69980803 CTCCATCTTGAACAGGAGCTGGG + Intergenic
976192518 4:82501641-82501663 CTCCATGTTTCTCATGTTCTGGG + Intronic
976782202 4:88773523-88773545 CTCCATGTTGCACTGGAGATCGG + Intronic
977055199 4:92182730-92182752 CTCCAGGTTCATCATGAGCATGG + Intergenic
979279806 4:118853136-118853158 CTCTAGGTTCCTCAGGAGAATGG - Intronic
980566449 4:134549164-134549186 CTCCACCTTCCTGAGTAGCTGGG - Intergenic
980579451 4:134731217-134731239 CTCCCTGCTCCTCATGAGTTAGG + Intergenic
980957291 4:139442671-139442693 CTCCAAGTTCTTCAGGAACTCGG + Intergenic
980988198 4:139715932-139715954 CTCCATGTTAAATAGGAGCTGGG - Intronic
981922995 4:150107490-150107512 CTTCAAGTTCCTGAGTAGCTGGG + Intronic
982901268 4:161005738-161005760 CTCCAGTCTCCTCAGGAGCCGGG + Intergenic
983640565 4:169940912-169940934 CTTCATGTCACACAGGAGCTGGG + Intergenic
984363005 4:178761572-178761594 CACCATGTTCCTCAGGCTCCAGG - Intergenic
984935544 4:184886887-184886909 CCCACTGTCCCTCAGGAGCTTGG - Intergenic
985101036 4:186458862-186458884 CTCCATCTTGAACAGGAGCTGGG - Intronic
985846458 5:2353404-2353426 CTCCCTGTTCCTCAAGCACTTGG + Intergenic
985943348 5:3156464-3156486 CAGCAGGGTCCTCAGGAGCTAGG - Intergenic
986998844 5:13638248-13638270 GTGCATGTTGCTCAGGAACTTGG + Intergenic
989649044 5:43667101-43667123 GTGCATGTTCCTCAGGAACTTGG + Intronic
992061215 5:73049418-73049440 CTCCCTGTTCCTCAAGGACTAGG - Intronic
992715809 5:79510543-79510565 CTGCATGTTCCTCAGGAACTTGG - Intronic
993226227 5:85169269-85169291 CTTCATCTTCCTGAGTAGCTGGG + Intergenic
995448752 5:112277133-112277155 CTCCATGTTCCTGAGCAGATGGG + Intronic
995794905 5:115930798-115930820 CTCCATCTTAAACAGGAGCTGGG - Intergenic
997348122 5:133208784-133208806 CTCCTTGCTCCTGAGTAGCTGGG + Intronic
998494748 5:142578369-142578391 CCCCATATTCCTAAGTAGCTGGG - Intergenic
998814891 5:146003037-146003059 TTCCATGCTCCTCAGGAATTAGG - Intronic
999165476 5:149545712-149545734 GTGCATGTTCCTCAGGAACCTGG + Intronic
1000275120 5:159727390-159727412 CTTCCTGTCACTCAGGAGCTAGG + Intergenic
1000388629 5:160700182-160700204 CTGGATGTTCCTTAGGATCTGGG + Intronic
1001041190 5:168336610-168336632 CTCCATCCTCCTCAGGACCCCGG + Intronic
1003123823 6:3339452-3339474 CTCCATCTTAAACAGGAGCTGGG + Intronic
1003195413 6:3909839-3909861 CTCAATGTGGCTCAGGAGCGAGG - Intergenic
1005749517 6:28870013-28870035 CACCATCTGCCTCAGGAGCATGG + Intergenic
1007578271 6:42939734-42939756 CACCATGTTCCTCAGGGCCAAGG + Intergenic
1008590470 6:52988896-52988918 CTCCATCTTGAACAGGAGCTGGG + Intronic
1013249037 6:108315929-108315951 CTCCATTCTCCTGAGTAGCTGGG - Intronic
1013524600 6:110962718-110962740 ATCCCTGTTGCTCAGGAGCCTGG - Intronic
1014146015 6:117999084-117999106 GCGCATGTTCCTCAGGAACTTGG - Intronic
1014200313 6:118601998-118602020 CTCCATCTTAAACAGGAGCTGGG - Intronic
1014220586 6:118795166-118795188 TGCCTTGTTCTTCAGGAGCTGGG - Intergenic
1015159119 6:130132000-130132022 CTCCATCTTGAGCAGGAGCTGGG - Intronic
1015294392 6:131574219-131574241 CTCCAGGTTTCTCAGGATCTGGG + Intronic
1015333019 6:132003527-132003549 CTCCATCTTGAACAGGAGCTGGG + Intergenic
1017063582 6:150508250-150508272 CTCCTTATTCTTCAGGAGTTGGG + Intergenic
1017646802 6:156546855-156546877 CTCCATGTTCACCAGCAGCAGGG - Intergenic
1018272342 6:162093783-162093805 ATCCATGCTTCTCAGCAGCTAGG + Intronic
1018537693 6:164838808-164838830 CTCCAAGCTTCTGAGGAGCTGGG + Intergenic
1018664356 6:166120985-166121007 CCTCATGTTCCTGAGTAGCTGGG - Intergenic
1018791392 6:167150808-167150830 CTCCAAGAGGCTCAGGAGCTTGG - Intronic
1020131774 7:5562870-5562892 CTCCGCGGTCCGCAGGAGCTGGG - Intronic
1020158923 7:5752881-5752903 CTTCATGCTGCTGAGGAGCTGGG + Exonic
1021532548 7:21664572-21664594 CCTCATGTTCCTGAGTAGCTAGG + Intronic
1022852169 7:34275122-34275144 CTGCAGGTTCCTCAGAAGCAGGG - Intergenic
1023080141 7:36519159-36519181 CCCCATGTCCCTCAGGATCAAGG + Intronic
1024093923 7:45969495-45969517 CTCTCTGTCCCTCGGGAGCTTGG - Intergenic
1024172696 7:46806831-46806853 CTCCATATCCCTTAGCAGCTTGG + Intergenic
1025294186 7:57762522-57762544 TTCCATGTTCCTCATGAACCTGG + Intergenic
1026274425 7:68864221-68864243 CTCCATGTTGAACAGGGGCTGGG - Intergenic
1026940820 7:74287034-74287056 CCACATGTGCCTCAGGAGGTAGG - Intergenic
1030031211 7:105371286-105371308 CACCATGTTCCCGAGTAGCTGGG - Intronic
1030123121 7:106130048-106130070 CTCCATCTTCAATAGGAGCTGGG + Intergenic
1034871085 7:154684336-154684358 GTGCTTGTTCCTAAGGAGCTTGG - Intronic
1035127698 7:156620365-156620387 CTCCATCTTAAACAGGAGCTGGG - Intergenic
1035277991 7:157759337-157759359 AGCGATGTTCCTGAGGAGCTGGG + Intronic
1036851040 8:12201700-12201722 CTTCATCCTCCTCAGTAGCTGGG - Intergenic
1036872404 8:12443981-12444003 CTTCATCCTCCTCAGTAGCTGGG - Intergenic
1037684391 8:21126212-21126234 CTCCCTTTGCCCCAGGAGCTGGG + Intergenic
1038413555 8:27376474-27376496 CTCCATCTTAAACAGGAGCTAGG + Intronic
1038439634 8:27562383-27562405 CTCCATTTTGAACAGGAGCTGGG - Intergenic
1038463670 8:27739983-27740005 TTTCATGTTCCTTAGGACCTGGG - Intronic
1039344246 8:36686423-36686445 CTCCTTCCTCCTGAGGAGCTGGG - Intergenic
1039696899 8:39922539-39922561 GTCCATGTTCCTGAGGAAATTGG - Exonic
1039819886 8:41126140-41126162 CTCCATCTTAAACAGGAGCTAGG - Intergenic
1041139659 8:54803397-54803419 TTTCATGTTCTTCAGGAGATAGG - Intergenic
1042898108 8:73693043-73693065 CTTCAGCTTCCTCAGTAGCTGGG - Intronic
1045266654 8:100624197-100624219 CTTCAGCTTCCCCAGGAGCTGGG - Intronic
1045337877 8:101224547-101224569 CTCCATGTCCCTCATGAGACGGG + Intergenic
1046502369 8:115095460-115095482 CTCCATATTAAACAGGAGCTGGG + Intergenic
1047535862 8:125719091-125719113 GTCCATGTTCCACAGCAGTTGGG - Intergenic
1048875229 8:138831867-138831889 CTCCATCTTAAACAGGAGCTGGG + Intronic
1049235676 8:141511053-141511075 TTTCATGGTCCTCAGGGGCTGGG + Intergenic
1049913186 9:290185-290207 CTCCATGTTGCCCACGGGCTAGG - Intronic
1050260344 9:3835033-3835055 ATCCATGTTCCTCAACAGTTGGG - Intronic
1052831421 9:33218991-33219013 CTTCAGCTTCCTGAGGAGCTGGG - Intronic
1052890824 9:33698113-33698135 CTGCATTTTCATCAGGAGATTGG + Intergenic
1053247060 9:36543169-36543191 TTCCAGCTTCCTGAGGAGCTAGG - Intergenic
1053802051 9:41770833-41770855 CTCCATCTTGAACAGGAGCTGGG - Intergenic
1054143216 9:61544456-61544478 CTCCATCTTGAACAGGAGCTGGG + Intergenic
1054190430 9:61982528-61982550 CTCCATCTTGAACAGGAGCTGGG - Intergenic
1054462926 9:65475337-65475359 CTCCATCTTGAACAGGAGCTGGG + Intergenic
1054648035 9:67605598-67605620 CTCCATCTTGAACAGGAGCTGGG + Intergenic
1056054859 9:82811030-82811052 CTCCATCTTGATTAGGAGCTGGG + Intergenic
1056656498 9:88513965-88513987 CTCCATCTTAAACAGGAGCTGGG + Intergenic
1056796285 9:89660907-89660929 CTCCATGCTCTTGAGGTGCTGGG + Intergenic
1056920949 9:90788911-90788933 GCCCATGTTCCTCAGGTCCTTGG + Intergenic
1056994673 9:91445080-91445102 CTCCATGGGCCTCAGCTGCTAGG - Intergenic
1057248530 9:93480433-93480455 CTCCCTGTTCTGCAGGACCTGGG - Intronic
1057366516 9:94426949-94426971 CTTCAGCTTCCTCAGTAGCTAGG + Intronic
1057656819 9:96961116-96961138 CTTCAGCTTCCTCAGTAGCTAGG - Intronic
1057690512 9:97279555-97279577 CAGCATGTTCCTAAAGAGCTGGG + Intergenic
1057870267 9:98711334-98711356 ATGCATGTTCCTCCAGAGCTGGG + Intergenic
1058829991 9:108807693-108807715 CTGCATTTTTCTTAGGAGCTTGG - Intergenic
1059731108 9:117058097-117058119 CTCCACGTTCCTCAGGGGCATGG + Intronic
1060822529 9:126669811-126669833 CCCAAAGTTCCTCAGGATCTGGG + Intronic
1060936119 9:127517199-127517221 CACCAGGTTGCTCAGGATCTAGG + Exonic
1062214856 9:135383738-135383760 CTCCATGTGCCCCTGGAGTTGGG + Intergenic
1062307841 9:135919726-135919748 CTGCAATTTCCCCAGGAGCTGGG - Intergenic
1186670809 X:11765452-11765474 CTCCATCTTCCCTAGGAGCCAGG + Exonic
1187448371 X:19376559-19376581 CTTCAGGTTCCTGAGTAGCTGGG + Intronic
1187711607 X:22060037-22060059 CTCCAACTTCCTGAGTAGCTGGG - Intronic
1187983086 X:24780118-24780140 ATCTATGTTCATCAGGAGTTCGG + Intronic
1190375475 X:49784615-49784637 CTCCAGATTCCACAGGTGCTTGG - Intergenic
1190452423 X:50595141-50595163 CTCCCTGTTCCTCACTAACTGGG - Exonic
1192385982 X:70670410-70670432 AGCCATGTTCCTCTGCAGCTTGG + Exonic
1193640177 X:84002844-84002866 CTTTATGTTCCTCAGCTGCTGGG - Intergenic
1193681159 X:84519968-84519990 CTCCATTTTCCTGAGGGGCAAGG - Intergenic
1196144184 X:112298566-112298588 TTCCTTATTCCTCAGGAACTTGG + Intergenic
1196434857 X:115665419-115665441 GTCCATGTTCCACAGGTTCTTGG - Intergenic
1197777255 X:130126530-130126552 CCCCAGGATCCTCAGGGGCTTGG + Intergenic
1199813800 X:151378270-151378292 CTTCATCTTCCTGAGTAGCTGGG - Intergenic
1200148620 X:153940516-153940538 CTCCATCTTAAACAGGAGCTGGG + Intronic
1200694089 Y:6341807-6341829 ATCCAGGTTCCTCAGAATCTAGG + Intergenic
1200704448 Y:6429716-6429738 TTCCATGTTCCTCATGGCCTAGG - Intergenic
1200813645 Y:7509407-7509429 CTTCAGCTTCCTCAGTAGCTTGG - Intergenic
1200825675 Y:7637409-7637431 CTCCAGCCTCCTCAGTAGCTGGG - Intergenic
1201029663 Y:9734992-9735014 TTCCATGTTCCTCATGGCCTAGG + Intergenic
1201041188 Y:9832912-9832934 ATCCAGGTTCCTCAGAATCTAGG - Intergenic
1201340565 Y:12928337-12928359 CTCCATCTTGATCAGGGGCTGGG - Intergenic
1201912352 Y:19145676-19145698 CTCCATCTTGAACAGGAGCTGGG + Intergenic
1202198358 Y:22320370-22320392 GTCCTAGTTTCTCAGGAGCTTGG - Intronic
1202234380 Y:22693679-22693701 CTCCAGCCTCCTCAGTAGCTGGG + Intergenic
1202308779 Y:23502487-23502509 CTCCAGCCTCCTCAGTAGCTGGG - Intergenic
1202562022 Y:26168101-26168123 CTCCAGCCTCCTCAGTAGCTGGG + Intergenic