ID: 1183966622

View in Genome Browser
Species Human (GRCh38)
Location 22:41446376-41446398
Sequence CACTCGGGTCTCCGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 83}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183966615_1183966622 -9 Left 1183966615 22:41446362-41446384 CCCCCCAACTCACTCACTCGGGT 0: 1
1: 0
2: 0
3: 17
4: 198
Right 1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 83
1183966607_1183966622 5 Left 1183966607 22:41446348-41446370 CCCCCGCCCGCACGCCCCCCAAC 0: 1
1: 0
2: 2
3: 41
4: 680
Right 1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 83
1183966611_1183966622 -1 Left 1183966611 22:41446354-41446376 CCCGCACGCCCCCCAACTCACTC 0: 1
1: 0
2: 1
3: 28
4: 231
Right 1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 83
1183966612_1183966622 -2 Left 1183966612 22:41446355-41446377 CCGCACGCCCCCCAACTCACTCA 0: 1
1: 1
2: 3
3: 33
4: 455
Right 1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 83
1183966606_1183966622 6 Left 1183966606 22:41446347-41446369 CCCCCCGCCCGCACGCCCCCCAA 0: 1
1: 0
2: 2
3: 61
4: 722
Right 1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 83
1183966605_1183966622 27 Left 1183966605 22:41446326-41446348 CCGGCTGGGTCTCGGGGCGGGCC 0: 1
1: 0
2: 1
3: 18
4: 203
Right 1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 83
1183966616_1183966622 -10 Left 1183966616 22:41446363-41446385 CCCCCAACTCACTCACTCGGGTC 0: 1
1: 0
2: 0
3: 10
4: 114
Right 1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 83
1183966608_1183966622 4 Left 1183966608 22:41446349-41446371 CCCCGCCCGCACGCCCCCCAACT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 83
1183966609_1183966622 3 Left 1183966609 22:41446350-41446372 CCCGCCCGCACGCCCCCCAACTC 0: 1
1: 0
2: 1
3: 34
4: 357
Right 1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 83
1183966610_1183966622 2 Left 1183966610 22:41446351-41446373 CCGCCCGCACGCCCCCCAACTCA 0: 1
1: 0
2: 2
3: 35
4: 429
Right 1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183966622 Original CRISPR CACTCGGGTCTCCGCGGCGG CGG Exonic
903907583 1:26697114-26697136 CACTCCGGGCTCCGGCGCGGCGG + Exonic
908473923 1:64470529-64470551 ATCGCGGGGCTCCGCGGCGGTGG - Intergenic
911622296 1:100078980-100079002 CACTTGAGTCTCAGAGGCGGAGG + Intronic
916691461 1:167194019-167194041 CACTCTGGTCTCCCAGGCTGAGG + Intergenic
921945046 1:220880303-220880325 CACTCGCGTCCCCGAGGCCGGGG - Exonic
922705637 1:227788719-227788741 GGCCCGGGACTCCGCGGCGGGGG - Intergenic
924944587 1:248838030-248838052 CTCCCGGGACTCCGCGGCTGGGG + Intergenic
1067474572 10:46557066-46557088 CATTGAGGTCTCCGCGCCGGCGG + Intergenic
1076854676 10:133110023-133110045 CACTCAGGACTCAGCAGCGGCGG + Intronic
1077144978 11:1040707-1040729 CACTCGGGGCTGCAGGGCGGGGG - Intergenic
1084526786 11:69703131-69703153 CACGCGGGTCTGGGCGGAGGAGG + Intronic
1085022516 11:73218335-73218357 CACGTGGGTCTCTGCGGCTGCGG + Exonic
1090832222 11:130427787-130427809 CACTCGGGTCCTCGCGGGAGGGG + Exonic
1091823261 12:3491763-3491785 CACTCGGCGCTGAGCGGCGGCGG - Intronic
1096156833 12:49345737-49345759 TACCCGGGTCTCCCCGGCGGGGG - Intergenic
1096435844 12:51590915-51590937 GACTCGCGTCTCCGCGCCGCCGG - Intronic
1097232857 12:57522855-57522877 CGCTCGGTGATCCGCGGCGGCGG + Exonic
1102520679 12:113476059-113476081 CGGCCGGGTCTGCGCGGCGGCGG + Intergenic
1104986927 12:132602696-132602718 CACTGGGCTCTGCGCGGCTGGGG - Intergenic
1111672758 13:91348974-91348996 CACTCGGGCCTCGGCGCCGCCGG + Intergenic
1115688340 14:35819802-35819824 CCCTCGGGTCTCCGCGAGGCCGG + Intergenic
1117920789 14:60723757-60723779 CAGCGGGGTCTGCGCGGCGGCGG + Exonic
1122552084 14:102555643-102555665 CCCTGGGGTCTCCGCGCTGGCGG - Intergenic
1126176859 15:45743842-45743864 CAATCTGATCTCAGCGGCGGTGG + Intergenic
1130967124 15:88705645-88705667 CACTCGGGCGCCCGCGGCGGTGG + Intergenic
1132398029 15:101488949-101488971 CACCCGGCTCTCCCCCGCGGGGG - Intronic
1133784564 16:8964034-8964056 CAGGCGGGCCTCGGCGGCGGCGG - Intronic
1134057776 16:11181178-11181200 CACCCAGGTCTCAGCGGCAGTGG + Exonic
1141694507 16:85613291-85613313 CACCCGGGGCTGCTCGGCGGCGG - Exonic
1143371660 17:6444332-6444354 CAATCGGATCCCCGGGGCGGTGG + Intergenic
1144408581 17:14976603-14976625 CAGTGGGGTCTCCACGGAGGTGG + Intergenic
1144753610 17:17666709-17666731 CACTCTGGTCTCTGCCTCGGTGG + Intergenic
1146285001 17:31568416-31568438 CACTGGGGTCTCCACCGGGGTGG + Intergenic
1151472259 17:74325848-74325870 CTCTGGGGTCTCCAGGGCGGCGG - Intergenic
1157419273 18:47531709-47531731 GACTCCGGTCTCCGCGCCGCTGG + Intergenic
1160905556 19:1450202-1450224 CTCCGGGGTCTCCGCGGCGCGGG - Intronic
1161388218 19:4007988-4008010 CACCCAGGTCTTCGCGCCGGGGG + Intronic
1164835347 19:31351911-31351933 AACTCGGGTCTCCGCGTAGCCGG + Intergenic
1165993979 19:39831953-39831975 CTCTCAGGTCTCAGCGGCGGTGG - Exonic
1167164671 19:47790522-47790544 CCCTTGGGTCTCCCCGGCGCTGG - Intergenic
1167683194 19:50938498-50938520 CGCTTGGTTCTCCTCGGCGGGGG - Intergenic
1168332629 19:55579061-55579083 CTCCCGGGGCTCCGCGGCGCTGG + Exonic
1168455906 19:56508070-56508092 TACTCGAGTCTGCGGGGCGGAGG + Intronic
932213249 2:69948834-69948856 CACTCAGGCCTCCCCCGCGGCGG + Intergenic
936968380 2:118149818-118149840 CACTCTGGTCTCCTTGGCTGGGG + Intergenic
938583539 2:132669138-132669160 CATTCGGGTCGCCGCGGGGACGG - Intronic
1174017621 20:47501759-47501781 CACCCTGGCTTCCGCGGCGGAGG - Intergenic
1176008329 20:62878826-62878848 CACACCGGCCTCCGGGGCGGCGG + Exonic
1179925878 21:44533792-44533814 CACTCGGGTCTGCCAGGCGCCGG + Exonic
1182298453 22:29324663-29324685 CACTTGGGTCTGGGAGGCGGAGG + Intergenic
1183353497 22:37346339-37346361 CACTCTGGACTCTGGGGCGGGGG - Intergenic
1183966622 22:41446376-41446398 CACTCGGGTCTCCGCGGCGGCGG + Exonic
1184642726 22:45880909-45880931 CGCTCGGGTCACCTCGGCTGGGG - Intergenic
961745394 3:129061083-129061105 CACTCGGGTCTCGGCAACCGTGG - Intronic
968985328 4:3871719-3871741 CACCCGGGGCTCCGCGGGGCTGG - Intergenic
977960283 4:103076795-103076817 TCCTCGGGACTCCGCGGCGCAGG + Intronic
982573299 4:157076493-157076515 CAGCCGGGTCCCCGCTGCGGTGG + Intronic
992597437 5:78360563-78360585 CACCCGGATCTGCTCGGCGGCGG + Exonic
994043614 5:95284653-95284675 CTCCCGGGTCCCCGCGGCGCTGG + Intergenic
1002185964 5:177454946-177454968 CACTCGGGGACCCGCGGCCGGGG - Exonic
1002896388 6:1382712-1382734 GCCTCGGGGCTGCGCGGCGGGGG - Intergenic
1005355184 6:24976387-24976409 CACACGGTTTTCCTCGGCGGCGG - Intronic
1006119456 6:31795334-31795356 GACTCGGGTGTCTGCGGCGAAGG - Intronic
1007327596 6:41073648-41073670 CACACGGGACCCCGCGGCCGCGG - Intronic
1013170686 6:107634542-107634564 CCCTGGCGACTCCGCGGCGGCGG + Exonic
1023555013 7:41412576-41412598 CACTCGGGTCTACTTGGTGGTGG - Intergenic
1031484618 7:122311882-122311904 CCCTCGGGTCACCGTGGCCGCGG - Intergenic
1032117000 7:129126300-129126322 CCCTCGGGCCTCGGCAGCGGCGG + Intergenic
1034347650 7:150397208-150397230 CACTCGGGGCGCCCCCGCGGCGG - Exonic
1037273834 8:17156864-17156886 CGCTGGGGGCGCCGCGGCGGGGG - Intronic
1037828925 8:22176971-22176993 TACGTGGGTCGCCGCGGCGGGGG + Exonic
1039903081 8:41767010-41767032 CCCTCGGGGCACCCCGGCGGCGG + Intronic
1043873981 8:85464278-85464300 CGCTCGCGGCTCCGCGGCGCCGG + Intronic
1044599706 8:93991549-93991571 CTCCCGGCTCCCCGCGGCGGGGG + Intergenic
1046716264 8:117571019-117571041 CACTGGGGCCTCCGGGGGGGTGG - Intergenic
1057596135 9:96417704-96417726 CACTCGGGGCTTCGTGGCCGGGG - Exonic
1061936167 9:133858828-133858850 CACTCGGGTCTCCTGTGGGGTGG + Intronic
1062414829 9:136443022-136443044 CACCCGGGTCTCCCCGGAGTGGG - Intronic
1203761069 EBV:13188-13210 CACTCGGGTCTCGGTGGGGCTGG - Intergenic
1203761998 EBV:16260-16282 CACTCGGGTCTCGGTGGGGCTGG - Intergenic
1203762927 EBV:19332-19354 CACTCGGGTCTCGGTGGGGCTGG - Intergenic
1203763856 EBV:22404-22426 CACTCGGGTCTCGGTGGGGCTGG - Intergenic
1203764785 EBV:25476-25498 CACTCGGGTCTCGGTGGGGCTGG - Intergenic
1203765714 EBV:28548-28570 CACTCGGGTCTCGGTGGGGCTGG - Intergenic
1203766643 EBV:31620-31642 CACTCGGGTCTCGGTGGGGCTGG - Intergenic
1203767572 EBV:34692-34714 CACTCGGGTCTCGGTGGGGCTGG - Intergenic
1192419534 X:71016919-71016941 CCCTCGGGTCTCCGCGAGGCTGG - Intergenic