ID: 1183971643

View in Genome Browser
Species Human (GRCh38)
Location 22:41482032-41482054
Sequence AAGGGAAGAAAGGATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 637
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 582}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183971643_1183971659 28 Left 1183971643 22:41482032-41482054 CCAGCAGCATCCTTTCTTCCCTT 0: 1
1: 0
2: 5
3: 49
4: 582
Right 1183971659 22:41482083-41482105 CCCCGGTGGGGGTCTGCTGTGGG 0: 1
1: 0
2: 1
3: 9
4: 148
1183971643_1183971652 14 Left 1183971643 22:41482032-41482054 CCAGCAGCATCCTTTCTTCCCTT 0: 1
1: 0
2: 5
3: 49
4: 582
Right 1183971652 22:41482069-41482091 TGTGGTGCCTGGCTCCCCGGTGG 0: 1
1: 0
2: 1
3: 32
4: 308
1183971643_1183971647 -4 Left 1183971643 22:41482032-41482054 CCAGCAGCATCCTTTCTTCCCTT 0: 1
1: 0
2: 5
3: 49
4: 582
Right 1183971647 22:41482051-41482073 CCTTGTCTTGCCTAGCCGTGTGG 0: 1
1: 0
2: 0
3: 1
4: 83
1183971643_1183971661 29 Left 1183971643 22:41482032-41482054 CCAGCAGCATCCTTTCTTCCCTT 0: 1
1: 0
2: 5
3: 49
4: 582
Right 1183971661 22:41482084-41482106 CCCGGTGGGGGTCTGCTGTGGGG 0: 1
1: 0
2: 1
3: 16
4: 167
1183971643_1183971653 15 Left 1183971643 22:41482032-41482054 CCAGCAGCATCCTTTCTTCCCTT 0: 1
1: 0
2: 5
3: 49
4: 582
Right 1183971653 22:41482070-41482092 GTGGTGCCTGGCTCCCCGGTGGG 0: 1
1: 0
2: 0
3: 13
4: 128
1183971643_1183971657 27 Left 1183971643 22:41482032-41482054 CCAGCAGCATCCTTTCTTCCCTT 0: 1
1: 0
2: 5
3: 49
4: 582
Right 1183971657 22:41482082-41482104 TCCCCGGTGGGGGTCTGCTGTGG 0: 1
1: 0
2: 0
3: 16
4: 198
1183971643_1183971648 3 Left 1183971643 22:41482032-41482054 CCAGCAGCATCCTTTCTTCCCTT 0: 1
1: 0
2: 5
3: 49
4: 582
Right 1183971648 22:41482058-41482080 TTGCCTAGCCGTGTGGTGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 78
1183971643_1183971655 17 Left 1183971643 22:41482032-41482054 CCAGCAGCATCCTTTCTTCCCTT 0: 1
1: 0
2: 5
3: 49
4: 582
Right 1183971655 22:41482072-41482094 GGTGCCTGGCTCCCCGGTGGGGG 0: 1
1: 0
2: 0
3: 19
4: 237
1183971643_1183971654 16 Left 1183971643 22:41482032-41482054 CCAGCAGCATCCTTTCTTCCCTT 0: 1
1: 0
2: 5
3: 49
4: 582
Right 1183971654 22:41482071-41482093 TGGTGCCTGGCTCCCCGGTGGGG 0: 1
1: 0
2: 1
3: 21
4: 190
1183971643_1183971651 11 Left 1183971643 22:41482032-41482054 CCAGCAGCATCCTTTCTTCCCTT 0: 1
1: 0
2: 5
3: 49
4: 582
Right 1183971651 22:41482066-41482088 CCGTGTGGTGCCTGGCTCCCCGG 0: 1
1: 0
2: 1
3: 22
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183971643 Original CRISPR AAGGGAAGAAAGGATGCTGC TGG (reversed) Intronic
900598946 1:3494900-3494922 AAGGAATGAGAGGATGCGGCTGG - Intronic
900704259 1:4069268-4069290 AAGGAAAGAAAAGATACTCCTGG - Intergenic
901421127 1:9151860-9151882 GAGGAAAGAAAGGATGCAGGAGG + Intergenic
901947365 1:12714629-12714651 AAAGAAAGAAAGAATGCTTCAGG + Intergenic
902517945 1:16999969-16999991 CAGGGGAGGAAGGAAGCTGCAGG + Intronic
902786182 1:18734175-18734197 AGGGTAAGAAAGCAGGCTGCGGG - Intronic
903705819 1:25284995-25285017 CAGGAAAGAAAGGATGCAGGAGG - Intronic
903721419 1:25408424-25408446 CAGGAAAGAAAGGATGCAGGAGG + Intronic
904374382 1:30070889-30070911 AAGGGAAGAGAGTCTTCTGCAGG - Intergenic
905370091 1:37478300-37478322 AACGGGAGAAACAATGCTGCTGG - Intronic
905935123 1:41817377-41817399 CAGGGAAAAAAGGATGGGGCCGG + Intronic
906460797 1:46034129-46034151 AAGGGAAGAAAGGCTGCGGCTGG - Exonic
906635852 1:47410003-47410025 CAGGGAAGAAAGGGCCCTGCTGG + Intergenic
906647233 1:47483886-47483908 AAGGGGAGAGAGGAAGCTGTGGG + Intergenic
906923431 1:50089232-50089254 AAAGGAAGCAAGGAGGCTACAGG + Intronic
907364526 1:53947076-53947098 AAGGGAAGAATAGATGGTGAAGG + Intronic
907750881 1:57262103-57262125 AAGGAAGAAAAGGATGCAGCTGG + Intronic
907933074 1:59018179-59018201 AAGGCAATAAAGGATGCAGATGG + Intergenic
908007712 1:59743825-59743847 ATGGACAGAAAGGAGGCTGCAGG - Intronic
910369762 1:86503404-86503426 AAGGCCAGAAAGGCTGATGCTGG - Intergenic
911524203 1:98964494-98964516 GAGGGAAAAAAGGACTCTGCTGG + Intronic
912065656 1:105738040-105738062 AAGGGAAGAAAACATACTGATGG - Intergenic
912534100 1:110350941-110350963 ATGGGAAGAGAAGATGGTGCTGG + Intergenic
912939278 1:114030743-114030765 AAGGGAAGAAATGATCGTGGTGG - Intergenic
913095335 1:115511018-115511040 AAGGGAAGAAATGATTGTGGTGG + Intergenic
913699884 1:121364289-121364311 AAGGAAAGAAAGGAGGAAGCAGG - Intronic
914137657 1:144915748-144915770 AAGGAAAGAAAGGAGGAAGCAGG + Intronic
915357354 1:155263277-155263299 GGGCGAAGAAAGGATGCTGAAGG + Exonic
915623405 1:157099585-157099607 AAGGGAAGGAAGGAGGCAGAGGG + Exonic
915679025 1:157561994-157562016 AAGGGAAGAAATGAGGTGGCAGG - Intergenic
916336650 1:163678564-163678586 AAAGGAAGAAAGGAAGGAGCTGG - Intergenic
916632887 1:166635936-166635958 GAGAGAAAAAAAGATGCTGCTGG - Intergenic
916993746 1:170273668-170273690 TAGGGATGAAAGAATGATGCAGG - Intergenic
917146286 1:171894882-171894904 AAGGGCAGAATGGATGAAGCTGG - Intronic
917194279 1:172449593-172449615 AAGGGAAACAAGGACGCGGCTGG + Intronic
917231941 1:172846835-172846857 AAGAGAAGAGAGGGTGTTGCGGG + Intergenic
917508112 1:175647502-175647524 AAGGGAAGAGGGGAAGCTGGAGG + Intronic
917643807 1:177009582-177009604 AAGGGAAGACAGTATGCACCTGG + Intronic
917682044 1:177377264-177377286 AAGGGAAAAAAGGAAAATGCTGG + Intergenic
917959656 1:180132198-180132220 GGGGGAAGAAAGCATGCTGGAGG + Intergenic
918350944 1:183655030-183655052 AAGAGAAGAAAGGAGTCTGTTGG - Intronic
918876729 1:190056118-190056140 TAGGGAGGAAAGGAAGCAGCGGG - Intergenic
919428006 1:197458102-197458124 AAGGGAAGAAAGGAAACTTAAGG + Intronic
919572702 1:199268672-199268694 AAAGGAAGAAAGGAGGCTACTGG - Intergenic
919845688 1:201640681-201640703 GAAGGGAGAAAAGATGCTGCTGG + Intronic
920105919 1:203553524-203553546 AAAGGCAGAAAGGATGCTTGGGG + Intergenic
920127031 1:203701492-203701514 AAGGGAAGAAGGAATGCTTAGGG - Intronic
920487298 1:206382998-206383020 AAGGAAAGAAAGGAGGAAGCAGG - Intronic
920764771 1:208821667-208821689 AAGGGAAGGCAGGCTGCTGCTGG + Intergenic
921048076 1:211491416-211491438 AAAGGCAGAAAGGAACCTGCTGG + Intronic
921222875 1:212985995-212986017 AAGGGAAGAATGGATGTTGAGGG + Intronic
921569823 1:216764829-216764851 AGGGGAACAACAGATGCTGCAGG + Intronic
922048716 1:221970268-221970290 AAGGGAAGAAAGGATTGCGGTGG - Intergenic
922061445 1:222096469-222096491 AAGGGAAGAGAAGATGGGGCGGG - Intergenic
922152888 1:223020533-223020555 GAGGGAAAAGAGGATGCTGGTGG - Intergenic
922621558 1:226992411-226992433 GAGGGAAGAAAGGATCCTGCTGG - Exonic
923036420 1:230287942-230287964 AAGGAAAGGAAGGAAGGTGCGGG + Intergenic
923101363 1:230820334-230820356 ATGGGAATACCGGATGCTGCAGG + Intergenic
923327559 1:232894219-232894241 AAGGGAAGAGTGGATACTGGAGG + Intergenic
924043449 1:240006117-240006139 AAGGGGAGAATGGATTTTGCTGG - Intergenic
924094485 1:240537109-240537131 AAGGGAGGCAAGGAGGCTACAGG - Intronic
924265302 1:242275742-242275764 TAGGGAAGAAAGAATGTTCCAGG + Intronic
924596082 1:245445862-245445884 AAGGGAGGGAAGGATGCTAATGG - Intronic
1063363507 10:5475650-5475672 AACGGAAGAAATGATGGTGGTGG - Intergenic
1064579346 10:16778371-16778393 AAGGGCAGAGAGGAAACTGCTGG - Intronic
1065638348 10:27753460-27753482 AAGGGAAGAAGGGAAGAAGCGGG - Intergenic
1065762897 10:28999551-28999573 AAGGGCAGAAAGCATCCAGCAGG + Intergenic
1066719519 10:38322748-38322770 TAGGGAAGAAAGAATGTTCCAGG - Intergenic
1067790878 10:49286837-49286859 AAAGGGAGAAAGGAGCCTGCAGG + Intergenic
1068036396 10:51765208-51765230 GAGGGAAAAAAGAATGCTGAGGG + Intronic
1069169025 10:65201687-65201709 GAGAGAAGAAAGGATACTCCTGG + Intergenic
1069400156 10:68035815-68035837 CAGGGAAGGAAGGCTCCTGCTGG - Intronic
1069943325 10:71969995-71970017 AAGAGATGACAGAATGCTGCTGG + Intronic
1069964287 10:72101382-72101404 AAGGAAACAAGGGATGCTGAGGG + Intronic
1070328042 10:75400598-75400620 GAGGGCAGGAAAGATGCTGCTGG - Intronic
1070627701 10:78062947-78062969 AAGGGAAGGAAAGATGATGAGGG - Intergenic
1071290387 10:84184824-84184846 AAGGGGAGACAGGAGGCTGCTGG - Exonic
1071381585 10:85068591-85068613 GAGGGAGGTGAGGATGCTGCAGG + Intergenic
1071829859 10:89360910-89360932 GAGGCAAGGAAGGATGCTGCGGG - Intronic
1072989668 10:100180013-100180035 TAGAGAAGAAAGGTTGCTGTTGG - Intronic
1073217527 10:101844535-101844557 AAGGGCAGAAAAGTTGCTGCAGG - Intergenic
1073291044 10:102413471-102413493 AAGGGAAGAAAGGGCCCTCCAGG + Intronic
1073439681 10:103545078-103545100 AAGGGAAGAAAGGAAGGCGGCGG + Intronic
1073608168 10:104916407-104916429 AAGGAAAGAAAGGCAGCTCCTGG + Intronic
1074003956 10:109400198-109400220 AAAGGAAGAGAGGATCCTGGAGG - Intergenic
1075007472 10:118841125-118841147 TCGGGAAGAAAGGGTGCTGGTGG + Intergenic
1075737929 10:124675446-124675468 AACAGAAGAAAGGCTGCAGCAGG + Intronic
1076529704 10:131136173-131136195 AAGGGAAGAGAGGACACTGGAGG + Intronic
1076851743 10:133096632-133096654 ACGGGAAGAGAGGAGGCTGGAGG + Intronic
1076907371 10:133369776-133369798 GAGGCAGGAAAGGAGGCTGCTGG + Intronic
1077580591 11:3414737-3414759 AAGGGAACAATGGACGCTGTCGG - Intergenic
1078805238 11:14693155-14693177 GAGAGAAGTAAGGAAGCTGCAGG + Intronic
1079088969 11:17467523-17467545 AAGGGAGGAAAGAGTGCTTCAGG - Intronic
1079331297 11:19535193-19535215 CAGGGAAAACAGGAAGCTGCTGG + Intronic
1079353500 11:19712824-19712846 AGGGGAGGACAGGCTGCTGCCGG - Intronic
1079814034 11:25032733-25032755 AAGCACAGAAAGGATGCTGTAGG + Intronic
1080432143 11:32209120-32209142 AAGGAAAGAATGGCTACTGCAGG - Intergenic
1081501324 11:43669601-43669623 GAGGCAAGGAAGGATGCTTCTGG - Intronic
1081568429 11:44275066-44275088 AGGGGCAGGAAGGCTGCTGCTGG - Intronic
1083300222 11:61736164-61736186 AAGGGAAAAATGGATGGGGCAGG + Intronic
1083315661 11:61813663-61813685 AAGGGAATAAAAGCTGCTCCCGG + Intronic
1083368983 11:62163499-62163521 GAGGGAAGAAAGGCTGCTATGGG - Intergenic
1084006605 11:66326616-66326638 ACAGGAAGAAAGGATGGGGCTGG - Intergenic
1084834888 11:71795262-71795284 AAGGGAACAATGGATGCTGTTGG + Intronic
1084952859 11:72676318-72676340 GAGGGCAGAAAGGAGGCTGAGGG - Intergenic
1085021768 11:73214505-73214527 AAGGGAAGGGAGGATGGTGCAGG + Intergenic
1085549005 11:77349414-77349436 AATGTGAGAATGGATGCTGCAGG - Intronic
1086141816 11:83507926-83507948 AAGGGCAGAAAGCATCCAGCAGG + Intronic
1086168596 11:83809049-83809071 AAGAGAAGAGAGGATGCAGCAGG - Intronic
1086210285 11:84310080-84310102 AAGGGAATCCAGGATTCTGCAGG + Intronic
1086329373 11:85738237-85738259 AAGAAAAGAAATGAGGCTGCAGG - Intronic
1086793068 11:91064998-91065020 CAGAGAGGAAAGGATTCTGCTGG - Intergenic
1087128126 11:94645933-94645955 AAGGGAAGAAATGACTGTGCTGG - Intergenic
1087552702 11:99672269-99672291 TAGGGAAGAAAGGAAGCAGAAGG + Intronic
1087663211 11:101011736-101011758 AAGGGAAGAATGGATGTGACCGG + Intergenic
1088609341 11:111562377-111562399 AAGGGAAGGGAAGATGCTGAGGG - Intergenic
1090039320 11:123276480-123276502 AAGGGAAGGGAGAAGGCTGCAGG - Intergenic
1090828368 11:130403823-130403845 ATGGGCAGAGAGGATGCTGTAGG - Intergenic
1091457705 12:620091-620113 AAGGGATGAAAGGACGCTTTAGG - Intronic
1091719105 12:2799666-2799688 AAGGGTATGAAGGATGCTGAGGG + Intronic
1091857039 12:3748425-3748447 AAGGGAAGAAAGTGTCCCGCTGG + Intronic
1091859350 12:3765448-3765470 GAGGAAAGCAAGGATGCTGCAGG + Intergenic
1092154622 12:6274245-6274267 ATGAGAACAATGGATGCTGCTGG + Intergenic
1092786691 12:12032986-12033008 GAAGGAAGAAAGGGCGCTGCTGG + Intergenic
1092831286 12:12447041-12447063 AGGGGAAGAGAGGAGGCTGGGGG - Intronic
1092929046 12:13298023-13298045 AGGCCAAGAAAGGATACTGCTGG + Intergenic
1093078176 12:14778593-14778615 AAGAGAGGAGAGGATGCAGCCGG + Intergenic
1093278537 12:17160112-17160134 AATTGAAGCAGGGATGCTGCAGG - Intergenic
1093636832 12:21480711-21480733 AAGGAAAGAAGTGCTGCTGCAGG - Intronic
1093822759 12:23642487-23642509 AAGGGAAGAAAGATTGTTCCAGG + Intronic
1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG + Intergenic
1094388404 12:29920742-29920764 AAGAGATGAAATGAAGCTGCTGG - Intergenic
1095599278 12:43996700-43996722 AACAGAAGAAAGGATCATGCTGG - Intronic
1095882838 12:47156667-47156689 AATGGAGGAAAGGATGCTTAAGG - Intronic
1095902832 12:47346128-47346150 AAGAAAATAATGGATGCTGCCGG - Intergenic
1096751508 12:53761721-53761743 AAAGGAGGGAAGGATGCTGGAGG - Intergenic
1096910784 12:54981786-54981808 AAAGGAAGAAAGCATGCATCTGG - Intronic
1097431936 12:59519742-59519764 AAGGGCAGGAAGCATGCAGCGGG + Intergenic
1097827392 12:64188226-64188248 AAGGTAAGAGAGGATGGGGCTGG + Intronic
1098529244 12:71521692-71521714 AAGGGGAGAATGGATACTGGGGG + Intronic
1098926179 12:76351200-76351222 ATGGGAAGAAAGGAGGGTGGGGG + Intergenic
1100106697 12:91183809-91183831 GAGGGAAGGAAGGAGGCTGGAGG - Intergenic
1101625284 12:106434778-106434800 GAAGGAGGAAAGGATGCTGGAGG - Intronic
1101807023 12:108072940-108072962 AAGGGTACAAAGGAAGCTTCTGG - Intergenic
1102248072 12:111367732-111367754 CTGGGAAGACAGGAAGCTGCAGG + Intronic
1102405614 12:112671608-112671630 AAGGGAAGAATGGATATTGAGGG + Intronic
1103170790 12:118817721-118817743 AAGGGGAGAATGGGTGCTGCTGG + Intergenic
1103256200 12:119543546-119543568 GAGGGAAGAAAGAATGTTCCAGG + Intergenic
1103331255 12:120155543-120155565 AAAGGAAGAGAGGATGCAGCAGG + Intronic
1103525146 12:121562633-121562655 AAGGGAAGAAAGCATGGAGGAGG + Intronic
1104378657 12:128288036-128288058 AAAGTAAGAGAGGATCCTGCAGG - Intronic
1104650345 12:130526916-130526938 AAGGGAAGAAAAGCCGCTGGTGG + Intronic
1104769877 12:131354765-131354787 AAGAGCAGAAAGGAGGCTGAGGG + Intergenic
1105588631 13:21769416-21769438 AAGGGAAGAAAGAGAGCTGAAGG - Intergenic
1107337020 13:39365990-39366012 AAGGGAAGAAAGGGTTTTGGGGG - Intronic
1107468653 13:40670782-40670804 AAGTGAAGAAAGGCTGTTTCAGG - Intergenic
1107832955 13:44390583-44390605 CAGGGCACAAAGGAGGCTGCAGG - Intronic
1108091374 13:46853400-46853422 AAGGGAAGAGAGCAACCTGCTGG - Intronic
1108483913 13:50905828-50905850 AAGGGAAGGAATGATGCTTGTGG + Intergenic
1108559688 13:51630500-51630522 AAAGAAAGAAAGAATGTTGCGGG - Intronic
1109226932 13:59708291-59708313 AAGGAAAGAGAGGATGAGGCTGG - Intronic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1110563892 13:76938498-76938520 AAAGGAAGAATGGATGCTGAGGG + Intergenic
1110752425 13:79130571-79130593 AAGGGGAGGAAGGATGTTCCAGG - Intergenic
1112422861 13:99268805-99268827 CAGGGAAACAAGGATGTTGCTGG + Intronic
1113057206 13:106281710-106281732 AAGAGAAGTGAGGAAGCTGCAGG + Intergenic
1113167881 13:107463427-107463449 GAGGAAGGAAAGGATGTTGCTGG + Intronic
1114454468 14:22846145-22846167 GAGAGAAGCAAGGAGGCTGCGGG - Exonic
1114583230 14:23784695-23784717 AAGGGCAAAAATGATGCTTCTGG + Intergenic
1114794711 14:25700465-25700487 AAGGGATGAAAAGATGAAGCCGG - Intergenic
1117186934 14:53249458-53249480 CAGGGAGGAATGGATGATGCTGG - Intergenic
1117523705 14:56576560-56576582 AAGGGGAGAATGGATACTGAGGG - Intronic
1117794741 14:59380788-59380810 AAGGCAAGGAAGAATGCTGTAGG - Intergenic
1117940305 14:60957418-60957440 AAGGCAAGAAAGCATGTGGCAGG + Intronic
1118030818 14:61816224-61816246 ATGGGGAGAAAGGAAACTGCAGG - Intergenic
1118070688 14:62244016-62244038 AAGAGAAGACACCATGCTGCTGG + Intergenic
1118278884 14:64410801-64410823 AAACTAAGCAAGGATGCTGCAGG - Intronic
1118686281 14:68294813-68294835 CAGGGAGGAAAGGCTCCTGCAGG - Intronic
1118798423 14:69166824-69166846 AAGGGAAGGTAGGATGAGGCTGG + Intergenic
1119032362 14:71202763-71202785 AAGGAAGGAAAGAATGCAGCAGG + Intergenic
1119527289 14:75332928-75332950 AAGTGAAGAAGGGATGGAGCAGG + Intergenic
1119586584 14:75841357-75841379 AAGGAAGGAAAGAATGCTGTGGG - Intronic
1120532268 14:85646470-85646492 AAGGGAGGAAAGGATGAAGTAGG + Exonic
1120759484 14:88272892-88272914 AAAGGAAGAAAGGAGGCGTCTGG + Intronic
1121171186 14:91855758-91855780 AAGGGACGATTGGATGGTGCGGG + Intronic
1121364545 14:93296134-93296156 AATGGATGAAAAGAGGCTGCTGG - Exonic
1121426194 14:93853851-93853873 AAGGGAAGAAGGGATAATGGGGG + Intergenic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1123432043 15:20226175-20226197 AAGGGAAGAAATGATGCCATTGG - Intergenic
1123480555 15:20627571-20627593 AAGAGAGGTAAGAATGCTGCTGG + Intergenic
1123637453 15:22372796-22372818 AAGAGAGGTAAGAATGCTGCTGG - Intergenic
1123774633 15:23566263-23566285 AAGGAAAGGGAGGATGCAGCCGG - Exonic
1123885650 15:24725418-24725440 AAGGGAGGGAAGGAAGCAGCTGG - Intergenic
1125199751 15:37092637-37092659 AAGAGAAGAAAGATTGCAGCTGG - Intronic
1125304861 15:38299812-38299834 AAGGGAAGGCAGGATGTTACCGG - Intronic
1125680426 15:41527089-41527111 AAGGGAGGAAGGGAGGCTGTGGG + Intronic
1125897252 15:43312921-43312943 AAGGGAGGACAGGAGGATGCTGG + Intergenic
1126177066 15:45745707-45745729 CAGGGAAGGTAGGTTGCTGCTGG + Intergenic
1126774113 15:52085047-52085069 AGGAGAAGAAAGGATCATGCTGG + Intergenic
1127658480 15:61077778-61077800 AAGGGAAGAAGAGATGCTTCTGG - Intronic
1127976427 15:64000642-64000664 AATGGAAGAAGGCATGATGCTGG + Intronic
1129171611 15:73811492-73811514 AGAGGAAGAAGGGATGTTGCAGG + Intergenic
1129193446 15:73951111-73951133 CAGGAAACAAAGGAGGCTGCTGG + Intronic
1129258141 15:74345922-74345944 AAGGGAACAAAGGATGTGGAAGG - Intronic
1129259800 15:74358708-74358730 AAGGGAAGAAATGATCGTGGTGG - Intronic
1129452796 15:75660096-75660118 AAGGGAGGAAACGAGGCAGCTGG - Exonic
1129836438 15:78710390-78710412 AAGGTAAGAAATCATGGTGCTGG + Intronic
1130016173 15:80188130-80188152 AAGGGGAGAATGGATACTGGGGG + Intergenic
1130102174 15:80902405-80902427 AAGGGAGGAGTGGATGCTGGTGG + Intronic
1130102325 15:80903419-80903441 AAGTGGAGAAAGCTTGCTGCAGG + Intronic
1130436577 15:83905493-83905515 AATGGCAGCAAGGATGCAGCTGG + Intronic
1130912094 15:88277741-88277763 AAGGGAGGAATGGAGGCTGCCGG - Intergenic
1130918808 15:88326971-88326993 AAGGGAAGAAGTGAGGCTGAAGG - Intergenic
1131123840 15:89841395-89841417 AAAAGAAGAAAGGATGCTACAGG + Intronic
1131951550 15:97686944-97686966 AAGGCAAGAAAGGAGTCTGATGG - Intergenic
1132590312 16:723645-723667 AAGAGAAGAGGGGCTGCTGCAGG - Intronic
1132664369 16:1074785-1074807 ATGGGAGGGATGGATGCTGCTGG + Intergenic
1132852963 16:2033097-2033119 AAAGGAAGGAAGGAAGCTGCTGG - Intronic
1133349140 16:5089990-5090012 AAGGGAACAATGGACGCTGTCGG - Intronic
1133438952 16:5804630-5804652 AGGGGAAGGGAGGATGCAGCAGG - Intergenic
1133903568 16:10000090-10000112 AAGGGAAGAAAGGAGGCAGGAGG - Intronic
1134818024 16:17222314-17222336 ACTGGAAGAAAGAATGCTACTGG + Intronic
1134818488 16:17226463-17226485 AACTAAAGAAAGGATGCTCCTGG - Intronic
1135152536 16:20021542-20021564 AAGGCAAGAAAAGATCCTCCTGG - Intergenic
1135630343 16:24031578-24031600 AAGGGAAGAATGGATATTGGTGG + Intronic
1136414992 16:30097417-30097439 AAGGTAAGAAAAGTTGCTACTGG + Intergenic
1136510246 16:30733570-30733592 AAGGGAAAAAAAGATGATACTGG - Intronic
1136563064 16:31052528-31052550 AAGGGTAGAATGGATACTGGGGG + Intergenic
1136922632 16:34345033-34345055 TAGGGAAGAAAAGATGGGGCTGG - Intergenic
1136981941 16:35066773-35066795 TAGGGAAGAAAAGATGGGGCTGG + Intergenic
1137701502 16:50501214-50501236 GAGGAAGGAAAGGATTCTGCAGG + Intergenic
1138342524 16:56299517-56299539 CAGGGAAGAAAGGAAGGTGGGGG - Intronic
1138548129 16:57731480-57731502 AAGAAGAGAAAGGCTGCTGCTGG - Intronic
1138599996 16:58048414-58048436 AAAGGAAAAAAGGATGCTGAGGG - Intergenic
1139054934 16:63171408-63171430 AAGGGAAGACAAGAAGCTGGGGG + Intergenic
1139127795 16:64101165-64101187 GAGGGGAAAAAGGATGATGCTGG + Intergenic
1139594863 16:67951604-67951626 TGGGGAAGACAGGCTGCTGCAGG + Intronic
1139619542 16:68126352-68126374 AAAGGAAGAAATGTTGGTGCTGG + Intronic
1139690809 16:68640921-68640943 AAGGGAAGCAGGGAGGCTGGTGG - Intronic
1140262402 16:73391663-73391685 AAGAGAAGAAAGGAACCTACAGG + Intergenic
1141234090 16:82199483-82199505 AAGATAAGAATGGATGCTGGTGG + Intergenic
1141321308 16:83011693-83011715 AAGGGAAGAAAGGAAAGGGCCGG - Intronic
1141396350 16:83708457-83708479 AAGAGAACAAAGCATGCTGAGGG - Intronic
1203114196 16_KI270728v1_random:1473432-1473454 AAGGGAAGAAATGATGCCATTGG + Intergenic
1142755648 17:2015070-2015092 AAGGCAAGACAGGAGGCTGCTGG + Intronic
1143187447 17:5019109-5019131 ATGGGGACAACGGATGCTGCTGG - Intronic
1143544359 17:7587892-7587914 AAGGGAAGCAGGGAGGCTGGAGG - Exonic
1143563051 17:7706352-7706374 AAGGGAAGGAAGGAGGGTTCAGG - Intronic
1143709907 17:8727001-8727023 AAGCGAGGAACGGATGCTGGAGG - Intergenic
1143940458 17:10535616-10535638 CAGGGTAGAAAGGATGGTGTTGG - Intronic
1144161424 17:12564169-12564191 GAGGGAAGAGAGGCTGGTGCTGG + Intergenic
1144282962 17:13745102-13745124 GAGGGAAGAAGGGATGGGGCTGG - Intergenic
1144374802 17:14628287-14628309 AAGGGAAGGAAGGATGGTGGCGG + Intergenic
1145996620 17:29108530-29108552 AAGGTCACAAAGGCTGCTGCTGG + Intronic
1146903684 17:36604146-36604168 AAGAGAAAAGTGGATGCTGCAGG - Intronic
1147938709 17:44029727-44029749 AGCGGAAGCAAGGAGGCTGCTGG - Intergenic
1148862905 17:50613861-50613883 AAGGGAGGACAGGAGGCTACGGG - Intronic
1148959085 17:51378129-51378151 AAGGGAAGAATGTGTGCTGGAGG + Intergenic
1149019165 17:51943594-51943616 AAAGTAAGGAAGGATGCTCCAGG - Intronic
1150805701 17:68317139-68317161 AAAGGAAGAAAGGAATCTGGGGG + Intronic
1150823976 17:68457892-68457914 GAGGGAAGAAGGAATGCGGCTGG + Intergenic
1152153738 17:78619148-78619170 ACGGGAAGAGAGCATGCTGGTGG - Intergenic
1152753745 17:82078318-82078340 GAGGGAAGAAAGGACGGTGGTGG + Exonic
1152771898 17:82175173-82175195 AAAGGAAGAAAGAATTCTCCTGG + Intronic
1153138044 18:1940584-1940606 AAAGGAAGAAAGGAAGATGAGGG + Intergenic
1153200605 18:2643694-2643716 ATGGGAAGAAAAGATCATGCAGG - Intergenic
1153815704 18:8788233-8788255 AAGGGAGCAAAGAAAGCTGCCGG - Intronic
1154410782 18:14141088-14141110 GAGGGGAGAGAGGATTCTGCTGG + Intergenic
1156492156 18:37502649-37502671 AAGGGAAGAAACCCTGCAGCTGG - Intronic
1157230290 18:45909403-45909425 AAGGGAAGAAATCATTCTGGAGG + Intronic
1157241434 18:46013659-46013681 AAATTAAGAAAGGATGCTGAGGG + Intronic
1158319655 18:56248922-56248944 CACAGAAGAAAGGATGCTTCTGG + Intergenic
1159078554 18:63709142-63709164 AAGAGAAGAAAAGATGATGCTGG - Intronic
1159163179 18:64670588-64670610 GAGGGAAGAATGGATACTGGAGG + Intergenic
1159553098 18:69917388-69917410 GAGGGAAGGAAAGATGGTGCTGG - Intronic
1159594802 18:70372321-70372343 CAAGGAAGAGAGGAGGCTGCAGG + Intergenic
1159986545 18:74848700-74848722 AAGCGAGAAAAAGATGCTGCTGG - Intronic
1160341764 18:78095334-78095356 TAAAGAAGAAAGGATGCTGCAGG - Intergenic
1161759476 19:6160797-6160819 AGGGGAAGAAAAGAGGCTGGAGG + Intronic
1162014071 19:7834446-7834468 TAGGTCAGAAAGGATTCTGCAGG + Intronic
1162084777 19:8241957-8241979 AAGGGAGGAAATGAGGCTGAGGG - Intronic
1162203011 19:9034874-9034896 AGGGGAAGAAAGGAGGCGGAGGG + Intergenic
1162271296 19:9618114-9618136 AAAGGTAGAAAGGATGGTGGAGG - Exonic
1162478556 19:10915208-10915230 ATGGGAAGCAAGGCTGCTCCAGG + Intronic
1163429432 19:17258264-17258286 AAAGGAAGCATGGAGGCTGCTGG - Exonic
1163622176 19:18367627-18367649 AAGGAAAGAAAGGAAGAAGCAGG + Exonic
1164287228 19:23828304-23828326 AAAGAAAGAAAGAATGCTGCAGG - Intergenic
1164705374 19:30315422-30315444 AAAGGAAGGAAGGATGATGGTGG + Intronic
1164767723 19:30784546-30784568 AAGGGGAGAACAGATGCTGATGG - Intergenic
1165492005 19:36129127-36129149 AATGAAGGAAAGAATGCTGCAGG + Intergenic
1166276501 19:41757662-41757684 CAGAGAAGAGAGGATGCTCCTGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167087453 19:47320100-47320122 GAGGGAGGGCAGGATGCTGCAGG - Exonic
1167656077 19:50765169-50765191 GAGGAAAGAAAGGGTGCTCCAGG + Intergenic
1168212631 19:54901614-54901636 GAGCGAAGAAAGGATGCTAGTGG + Intergenic
925439884 2:3876359-3876381 AAGGCAAGAAAGGATATGGCTGG + Intergenic
926223662 2:10952506-10952528 CTGGGAAGACAGGATTCTGCAGG - Intergenic
927070865 2:19528207-19528229 AAGAGAATAAAAGATACTGCAGG - Intergenic
927134530 2:20087082-20087104 AAGGGAAGAAATGATGGCGGTGG - Intergenic
927832532 2:26364659-26364681 GATGGAAGAAAGAATGCTGATGG + Intronic
928351782 2:30563562-30563584 AAGGGAAGACAGGCTGAAGCAGG + Intronic
928392859 2:30922563-30922585 AAGGGAAGAAAGGGTGGCCCAGG - Intronic
928946297 2:36774941-36774963 AAGGAAAGAAAGCAGCCTGCTGG + Intronic
929505571 2:42525502-42525524 AAGGGAAGAAAGGAAGGGGAAGG - Intronic
929730450 2:44485884-44485906 AAGGGAACAAGGGAAGCTTCAGG + Intronic
929745157 2:44649540-44649562 AAGGGAAGACAGGCATCTGCTGG + Intronic
929811369 2:45191718-45191740 AAGGGTAGGGAGGCTGCTGCAGG + Intergenic
930234279 2:48873997-48874019 AAGGTCAGAAAGGATGCTCAGGG - Intergenic
930265141 2:49190991-49191013 AAGGGAAGAAGGGAAGCTCTGGG - Intergenic
930306253 2:49678162-49678184 ATGGGAAGAACTGTTGCTGCTGG - Intergenic
931022241 2:58060486-58060508 AAGGCAATAATGGATGCAGCTGG + Intronic
931739491 2:65228704-65228726 AAGGGAAAAAAGGGGGCTGGGGG - Intronic
932733849 2:74240308-74240330 AAGGCAGGAAAGGAGGCTGCTGG - Intronic
932740573 2:74287732-74287754 GATGGAAGAAAGGATGTTGATGG - Intronic
932776643 2:74531805-74531827 CAGGGAAGGAAGGATGTAGCTGG + Intronic
933215910 2:79629717-79629739 GAGGGAGGAAAGGATGCTGAAGG + Intronic
933292406 2:80452635-80452657 GGGAGAAGAAAGGATGCTGGTGG + Intronic
933666595 2:84970432-84970454 GAGGGAAGCCAGGAGGCTGCCGG - Intergenic
933814294 2:86053219-86053241 AAGGGAAGAAAAAAAACTGCTGG - Intronic
934745424 2:96756475-96756497 GAGGGAAGAAGGGAGGCTGAGGG - Intergenic
934898771 2:98140712-98140734 AAGGGAAGACAAGCTGCTGGGGG - Intronic
935098531 2:99970298-99970320 AAGGGGAGAAAGGATGGTCAGGG - Intronic
935344434 2:102092766-102092788 AAGAGAAGAAAGGATGGGGGTGG + Intronic
935369827 2:102333490-102333512 AAGGGAGGCAAGGAGGCTGGAGG + Intronic
935545022 2:104391707-104391729 AAGGAAAGAAAGGTTGCTCCAGG + Intergenic
935816976 2:106855251-106855273 CAGGGAAGAAAGGGTGCTTAGGG + Intronic
937626223 2:124046844-124046866 AAGTGAAGAAAGGCTGAGGCTGG + Intronic
938067601 2:128289760-128289782 AGGGAAAGAGAGGAAGCTGCCGG + Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
939836055 2:147131028-147131050 AAGTGAAGAAAAGAGGCTTCAGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942374127 2:175318789-175318811 AATGTAGGAAATGATGCTGCAGG + Intergenic
943156830 2:184190357-184190379 AAATGAAGAAAGGATTCAGCGGG - Intergenic
943740374 2:191400690-191400712 AAGGCAGGAAAGGTTACTGCTGG - Intronic
944562801 2:200958084-200958106 AAAGGAAGACAAGATGCTGGAGG - Exonic
945466862 2:210180283-210180305 AAGGGAACAAAAAAGGCTGCTGG - Intergenic
946153692 2:217793300-217793322 GAGGGAAGAAAGGGTGTTTCAGG - Intergenic
946202802 2:218080743-218080765 GAGGGAGGGAAGGATGCTGATGG - Intronic
947522959 2:230862548-230862570 AAGGGGAGCCAGGAGGCTGCGGG - Intergenic
948338796 2:237232614-237232636 AAGGAAAGAGAGGATGCCCCAGG + Intergenic
948338992 2:237233930-237233952 AAGGGAAGCCAGGAAGGTGCAGG + Intergenic
948604480 2:239126264-239126286 AGGGGCAGAAGGGATGCTGCTGG - Intronic
948647174 2:239412722-239412744 TAGGTCAGAAAGGATTCTGCAGG - Intergenic
1168810877 20:703812-703834 CAGGGAACAGAGGATGCTCCTGG - Intergenic
1169532274 20:6498428-6498450 AAGGGCAAAAAGGAAGATGCTGG + Intergenic
1169605690 20:7316289-7316311 AAGAGTAGAAGGGATGCTACTGG - Intergenic
1169663669 20:8009073-8009095 AAAGGATGAAAGGATGCAGTAGG + Intronic
1170126608 20:12970753-12970775 AAGGGGAGAAAGGATGGGACAGG - Intergenic
1170498778 20:16953120-16953142 AAAGGAAGCTTGGATGCTGCTGG - Intergenic
1171134388 20:22683932-22683954 CAGGGAAGAAGCGATGGTGCTGG + Intergenic
1172972350 20:38882842-38882864 ATGGGAAGAAAGAAGGCTCCGGG + Intronic
1173112831 20:40209957-40209979 AAGGGAAGAAAGGAGGAGGCAGG + Intergenic
1173577591 20:44123171-44123193 AAGGGCTGATAGGATGCAGCGGG - Intronic
1173844698 20:46180478-46180500 AGGGGAAGAAAGGGGGCTGGAGG + Intronic
1173851302 20:46220106-46220128 AAGGGAAGAAAGGAAGGTAGGGG + Intronic
1174845063 20:53936021-53936043 AAGGGAAGAGGTGATGCTTCTGG - Intergenic
1175176004 20:57112516-57112538 AAGGGAGGACATGGTGCTGCTGG - Intergenic
1175439841 20:58982524-58982546 AAGGGAATAAAGGATGAAGTGGG + Intronic
1176862279 21:14017330-14017352 GAGGGGAGAGAGGATTCTGCCGG - Intergenic
1177419029 21:20831470-20831492 AAAGTAACAAAGGATGTTGCAGG - Intergenic
1178350518 21:31870058-31870080 AAGGGAAGGAAGGAAGCAGCTGG + Intergenic
1180676786 22:17591958-17591980 AAGGGTGGAAAGAATGCTCCTGG + Intergenic
1181874319 22:25928121-25928143 AAGGGCAGAGAGGATAGTGCTGG + Intronic
1182780070 22:32860572-32860594 TAGGGAAGAGAGGGTGCTGACGG - Exonic
1182919258 22:34064511-34064533 AAGGGAAAAAAGGATCCAGGGGG + Intergenic
1183701342 22:39453000-39453022 TAGGGAAGAAAGCCTGCTGACGG - Intergenic
1183831297 22:40419543-40419565 AATGAAAGAGAGGATGCTGTTGG - Intronic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
1184250337 22:43256624-43256646 AAAGCAAGAAAGGATGATTCAGG + Intronic
1184510097 22:44928388-44928410 ATGGGAAGAAGGGGTGCTGTGGG - Intronic
1184525315 22:45019292-45019314 GAGGGAAGCAAGGAGCCTGCAGG - Intergenic
1185064975 22:48627654-48627676 GAGCCAAGAAAGGAGGCTGCTGG - Intronic
1185131956 22:49044332-49044354 AGGGGCAGCAAGGCTGCTGCTGG + Intergenic
950221041 3:11196293-11196315 GAGGGAGGAAAGGGTGCTCCAGG - Intronic
950712857 3:14825674-14825696 CAGGGAACAAAGAATGCTTCAGG - Intronic
951069271 3:18307174-18307196 AAGGGGAGAAAGAATACTGGGGG + Intronic
952406893 3:33013159-33013181 AAGGGAAGAAAGCATGTTCCTGG - Intronic
953812820 3:46129283-46129305 AGGGGAAGGGAGGGTGCTGCCGG + Intergenic
954318440 3:49813906-49813928 AAGCGAATAAGGGACGCTGCTGG + Exonic
954756017 3:52840411-52840433 AGGGTAAGGAACGATGCTGCGGG + Exonic
954923917 3:54215784-54215806 AAGAGAAGTAAGGATAATGCAGG + Intronic
955415421 3:58686964-58686986 AAAGGAAGAAAGGATGGAGGAGG + Intergenic
956039904 3:65134890-65134912 AAGGGAGGAAAGGATAATGGGGG - Intergenic
956278483 3:67529588-67529610 AAGGGAAGACTGGATTATGCGGG + Intronic
956279942 3:67545703-67545725 AAAGGAAGAAAGCATGAGGCAGG - Intronic
957053466 3:75427333-75427355 AAGGGAACAATGGACGCTGTCGG - Intergenic
957368066 3:79252464-79252486 AAGGCAAGAAAAGATTCTTCTGG + Intronic
957426317 3:80044450-80044472 AAGGGAAGCAACTATGATGCAGG - Intergenic
957580422 3:82065463-82065485 AAGGTAAGAAAAGAAGCTGATGG + Intergenic
957927146 3:86828794-86828816 AAGGGAGGAAAGAAAGCTGGAGG + Intergenic
959021591 3:101193067-101193089 AAGGTAAAAATGGATGCTCCTGG - Intergenic
959517467 3:107285490-107285512 AAGGGAAGAAAGTAGCCAGCTGG - Intergenic
959614664 3:108333971-108333993 ATGGGAAGAAAAGATTCTTCTGG - Intronic
959977926 3:112482956-112482978 AAGGGAAGTTAGGAGGCTGAGGG - Intronic
960639911 3:119814764-119814786 AGGGGAGGAGAGGATGCTGCGGG + Intronic
960844501 3:121993789-121993811 CAGGGAGGACAGCATGCTGCAGG + Exonic
960893258 3:122473872-122473894 AAGGGAAAAAGGCATGCTGATGG + Intronic
960955836 3:123029886-123029908 AAGGGAAGAGAGGAGACTCCAGG + Intergenic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961010678 3:123433746-123433768 GAGGGAAGGGAGGAGGCTGCTGG - Intronic
961284659 3:125791458-125791480 ATGGGATGTGAGGATGCTGCAGG + Intergenic
961301367 3:125924212-125924234 AAGGGAACAATGGATGCTATCGG + Intergenic
961306628 3:125962364-125962386 AAGGGAGGAAAGGATGTTATTGG + Intergenic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
961887120 3:130103647-130103669 AAGGGAACAGTGGATGCTGTCGG - Intronic
962320788 3:134388775-134388797 AAGGGAAGAAAGGAAGAAGATGG + Intergenic
962443881 3:135448152-135448174 AAGCTAAGAAAGGAGGCTGAGGG + Intergenic
963209560 3:142673988-142674010 AAGGAAAGAAAGGATGTTTCAGG - Intronic
963225522 3:142858002-142858024 AAGGGAAGAAAGAATATTCCAGG - Intronic
963836298 3:150061328-150061350 GAGGGCAGAAAGGACACTGCTGG - Intergenic
964144929 3:153448119-153448141 AATGAAAGAAATGATGCTACTGG + Intergenic
964212668 3:154245722-154245744 AAGGAAAGGAAGGATGTAGCAGG - Intronic
964869095 3:161293461-161293483 AAGAGGAGAAAGGCTGCGGCAGG - Intergenic
966036354 3:175421759-175421781 AAGGGAATAAAGGATGTGCCTGG + Intronic
967025586 3:185561249-185561271 AAGGCCAGAAAGGCTGATGCTGG - Intergenic
967136412 3:186516262-186516284 AAGGGAAGATAAGATTGTGCAGG - Intergenic
967147374 3:186617486-186617508 AAGGGAAGAAAGCATCCTAAGGG + Intronic
967845149 3:194037062-194037084 AAGGGCAGGAAGGATCCTGGAGG + Intergenic
968267777 3:197376044-197376066 AAGGGAAGAATGGATGTTGGGGG - Intergenic
969119786 4:4899682-4899704 GAGGCATGCAAGGATGCTGCGGG + Intergenic
969133003 4:5005437-5005459 AAGGGAGGAGGGGATGGTGCTGG - Intergenic
969143482 4:5100356-5100378 AAGGCAAGAAAGGCAGCTGGGGG - Intronic
969303581 4:6311786-6311808 AAAGGAAGCAAAGATGTTGCCGG - Intergenic
969515712 4:7647095-7647117 GAGGGAAGTAGGGATGCTCCAGG + Intronic
969757722 4:9161042-9161064 AAGGGAACAATGGATGCTGTCGG + Intergenic
969817701 4:9698555-9698577 AAGGGAACAATGGACGCTGTCGG + Intergenic
969938021 4:10702257-10702279 AAGGGAAGAAAGGACGTTGCAGG + Intergenic
969966707 4:11003912-11003934 AAGGGAAGAAAGGAGGGAACTGG + Intergenic
970819417 4:20195824-20195846 AAGGGAAGAAATGATCCTGGTGG - Intergenic
971082844 4:23234838-23234860 AAAGGAAGAAAGGCTCATGCAGG + Intergenic
971143311 4:23948327-23948349 ATGGGAAGAAAGGAGGGAGCAGG + Intergenic
971417183 4:26442510-26442532 ATGGGAAGAGATGAAGCTGCAGG - Intergenic
971765692 4:30827949-30827971 AAGCTAATAAATGATGCTGCTGG - Intronic
972814832 4:42632674-42632696 AAGAAAACAAAGGATGCTGGTGG + Intronic
972865708 4:43229518-43229540 AAGGGATGAAATAATGCTGAAGG + Intergenic
975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG + Intergenic
975712942 4:77178679-77178701 AGGGAAAGAAAGGAAGCTGCAGG + Intronic
976025668 4:80685461-80685483 AAGGGAAGACATAATGCTGTTGG + Intronic
977505241 4:97893806-97893828 AAGGAAAGAATGGATGTTGAGGG + Intronic
977894986 4:102353182-102353204 AAGGGAAGAGAAGAGGCTGTAGG - Intronic
978029600 4:103924182-103924204 AAGGGGATAAAGGAAGCTACTGG - Intergenic
978256426 4:106697882-106697904 AGGAGAAGAAAGGATGTTGTAGG - Intergenic
978326490 4:107563023-107563045 AAGGGAAAAGATGATGCTGGAGG + Intergenic
978727989 4:111992936-111992958 AAGACAAGAAAGGATACTCCCGG + Intergenic
978810988 4:112849695-112849717 AAGGGAACAAAAGATGAAGCTGG - Intronic
979410847 4:120377125-120377147 AAGGGAAGGAAAGAAGCAGCTGG - Intergenic
980464627 4:133156300-133156322 AAGGGAAAAAAGGCTGCTCAAGG + Intronic
980606705 4:135100909-135100931 AATGGATGAAAGGATTGTGCAGG + Intergenic
981037858 4:140190934-140190956 GAGGGGAGAGAGGATGCTGAGGG + Intergenic
982328901 4:154159283-154159305 AGGGGAAGGAAGGAAGATGCAGG + Intergenic
982601486 4:157456377-157456399 AAGGTAAGAAAGGATTCTGAAGG - Intergenic
985040045 4:185881000-185881022 AAAGGAAGGAAGGATGATACAGG + Intronic
985680377 5:1252873-1252895 AAGGGCAGCAGGGATGCTGGGGG - Intergenic
985956707 5:3271107-3271129 AAGGGAGGGAAGGGGGCTGCTGG - Intergenic
985969556 5:3364274-3364296 AAGGGAGGGAAGGATGATGCAGG + Intergenic
986261108 5:6147174-6147196 AAGGGAAGAATGGATGCTCAAGG + Intergenic
986673620 5:10165069-10165091 AAGGGGAGAAAGAATGTTGGAGG - Intergenic
987170054 5:15245760-15245782 AAGGAAAAAAAAGATGCAGCAGG + Intergenic
987768978 5:22275302-22275324 AAAGGAAGAAAGGATGATCTGGG + Intronic
987974521 5:24995785-24995807 AAAGAAAGAAAGAAAGCTGCGGG + Intergenic
989255283 5:39359609-39359631 AAGGGAGGTATTGATGCTGCAGG + Intronic
989768197 5:45111307-45111329 AAGGGAAGAGAAGATGATGGAGG + Intergenic
990174048 5:53087362-53087384 AAAGGAAGAACTGGTGCTGCTGG - Intronic
990606177 5:57412329-57412351 AAGGTAAGAGATGATGCTGTTGG + Intergenic
990780701 5:59358767-59358789 AAGAGTAGAAGGGATGTTGCTGG + Intronic
990815694 5:59782702-59782724 TTTGGCAGAAAGGATGCTGCTGG - Intronic
991049289 5:62255191-62255213 AAGGGAAGAAATGATGCTATTGG - Intergenic
991250337 5:64553466-64553488 AAAGGAAGAAAGGAAGGGGCTGG - Intronic
992225669 5:74618042-74618064 AAGGGAAGAAAGAATCCCTCTGG + Intergenic
992912403 5:81409246-81409268 AAGGTAAAAATGTATGCTGCAGG - Intergenic
993016702 5:82542988-82543010 AAGGGAAGGAAGGATGAGACTGG - Intergenic
993731816 5:91431244-91431266 AAGGGAAGGAAGGATACTCATGG + Intergenic
994023936 5:95060263-95060285 AAGTGAAGAAAGGAAGCACCTGG + Intronic
994813833 5:104557745-104557767 AAGGGAACAAAGGAAGATGTGGG - Intergenic
995042577 5:107605775-107605797 AAGGGAAGAGAGGTTGGGGCAGG - Intronic
995478778 5:112574425-112574447 AATGGAAGAAAGAAATCTGCTGG + Intergenic
995478957 5:112576378-112576400 AAGGCAAGCCAGGAGGCTGCTGG + Intergenic
995555952 5:113328942-113328964 AAGGGAAGGAGGGATGCTGCAGG - Intronic
995584569 5:113634806-113634828 AAGGGAAGTAATGATGCTAGAGG - Intergenic
996614897 5:125429554-125429576 GAGAGAAGAAAGAATGCTGATGG + Intergenic
997360855 5:133293917-133293939 AAGAGAAGAAATGATGCAGGAGG - Intronic
997457825 5:134030577-134030599 AAAGAAAGAAAGAATGCTGAGGG - Intergenic
998196888 5:140081339-140081361 AATGGAATAAAGGAAGCTGTGGG + Intergenic
998810811 5:145964126-145964148 AAGGAAAGAAAGGAAGAGGCCGG - Intronic
998878021 5:146619857-146619879 TAAGGAAGAAAGGATGCAGTGGG - Intronic
998988418 5:147788356-147788378 AAGGAAAGAAAGGATGAAGAAGG + Intergenic
999154395 5:149448067-149448089 AAGGGGAGAACGGATGTTGAGGG - Intergenic
999535457 5:152511920-152511942 AATAGAAGAAAAGATACTGCTGG + Intergenic
999701272 5:154230734-154230756 ACAGGAGGAAAGGATGCTGTGGG - Intronic
999856256 5:155597645-155597667 AATGGAATAAAAGATTCTGCAGG + Intergenic
1000168816 5:158681567-158681589 AAGAAAAGAAAGGAAGTTGCCGG + Intergenic
1000216553 5:159162935-159162957 AAGAGAGGTAAGAATGCTGCTGG + Exonic
1000386023 5:160675478-160675500 GAGGGAGGAGAGGATGCTGAAGG + Intronic
1000451595 5:161395690-161395712 AAGGGAAGAAAATATACTGTAGG + Intronic
1001040077 5:168328316-168328338 AAGTGAAGAAAGGGTGCACCAGG - Intronic
1001238682 5:170051317-170051339 AAGGGAAGGAAGGATGGGGGTGG - Intronic
1001241951 5:170077913-170077935 AAAGGTAGAAGGGATGTTGCCGG - Intronic
1001298517 5:170516391-170516413 AAGGGAAGAAAGAAAGGTCCAGG - Intronic
1001688918 5:173617614-173617636 AAGGGAAGAGAGGATAATGGTGG - Intergenic
1002147656 5:177197930-177197952 CAGAGAAGGGAGGATGCTGCAGG + Intronic
1002210570 5:177596533-177596555 AAGGAGAGGAAGGATTCTGCTGG + Intergenic
1002837186 6:874828-874850 AAGGGAAAACAGGCTGCTGCTGG - Intergenic
1002948433 6:1784776-1784798 AAAGGAAGGAAGCTTGCTGCTGG - Intronic
1003475888 6:6482354-6482376 AAGGGAAGAGTAGATGCTGGTGG + Intergenic
1005144969 6:22679219-22679241 TAAGGAAGAAGGAATGCTGCTGG + Intergenic
1006932233 6:37695378-37695400 AAGGCAGGAAAGAATGCAGCAGG - Intronic
1008148736 6:47924077-47924099 CAGGGAATAAAGGATGTAGCCGG - Intronic
1008448281 6:51619141-51619163 AAGAGAAGAAAGCCTCCTGCGGG - Exonic
1008804769 6:55413888-55413910 AATGGAAGACAGGATCCTACTGG + Intergenic
1009464757 6:63955134-63955156 AAGGGAAGAAATGACTGTGCTGG - Intronic
1009743580 6:67782408-67782430 AAGGTGAGAATGGATGCTGAAGG - Intergenic
1010106849 6:72180367-72180389 AAGGGAAGGATGGGTGCTCCAGG + Intronic
1010772371 6:79846011-79846033 AAGGGAAGGAAGGATGGATCTGG + Intergenic
1010788207 6:80030313-80030335 AAGGGAAGGAATGATGGGGCTGG + Intronic
1011202068 6:84847591-84847613 AAGGGAAGATAAGAAGCTACAGG - Intergenic
1011788574 6:90873264-90873286 AAGGAAAGAAAAGAAGCTTCTGG + Intergenic
1013006641 6:106080419-106080441 AGGAGAAGGAAGGATGCTGGGGG - Intergenic
1013774448 6:113664076-113664098 AAGAGAAGAAATGTTGCAGCTGG + Intergenic
1013777330 6:113692987-113693009 TAGGGAAAAAAAGTTGCTGCTGG + Intergenic
1014161267 6:118171329-118171351 AAGTGAAAAAAGTAAGCTGCAGG - Intronic
1014213296 6:118729407-118729429 AAGAGGAAAAAGGATGCTGGAGG + Intergenic
1014872833 6:126617227-126617249 AAGTGAAGTAAGGATGCCTCTGG + Intergenic
1015152801 6:130057418-130057440 AAGGAAAGAAAGCGTGGTGCTGG + Exonic
1015953639 6:138578348-138578370 AAGGGGACAAAGGATGTCGCTGG + Intronic
1016315826 6:142785544-142785566 AAGGGAAGGGAGGTTGGTGCTGG - Intronic
1016485693 6:144535770-144535792 AAGGGAAGAAATAACTCTGCAGG - Intronic
1016700717 6:147050901-147050923 CAGAGGACAAAGGATGCTGCTGG + Intergenic
1017017437 6:150113206-150113228 GGGGGAAGAAAGGAGGCTGGGGG - Intergenic
1018013644 6:159693436-159693458 CACGGGAGAAAGGAGGCTGCAGG + Intronic
1018882300 6:167896481-167896503 AAGGGCAGCAAGAATACTGCAGG + Intronic
1019333450 7:471593-471615 TAGGGAAGAGAGGGTGGTGCGGG - Intergenic
1020055313 7:5113850-5113872 AAGGGAACAAAAGATGATGCAGG + Intergenic
1021199303 7:17710502-17710524 CAGGGATGAAAGGCTGTTGCTGG - Intergenic
1021529369 7:21626601-21626623 TAGGCAAAAATGGATGCTGCTGG - Intronic
1021729781 7:23585121-23585143 GGGAGAAGAAAGGATGCTGAAGG + Intergenic
1022473329 7:30694853-30694875 AAGGGAAGAAAGGAGGAAGGAGG + Intronic
1022556726 7:31305667-31305689 CAGGGAAGAAAGGGGGCTTCAGG + Intergenic
1022782580 7:33601331-33601353 AGGGGAAGAAAAGCTGCAGCTGG - Intronic
1023556628 7:41430140-41430162 AAGGGAAGGATTGCTGCTGCAGG - Intergenic
1024255189 7:47535628-47535650 AAGGGTAGAGAGCAGGCTGCTGG + Intronic
1024613632 7:51088591-51088613 GAGAGCAGAAAGGATGCTGGAGG - Intronic
1024993952 7:55256668-55256690 AAGGAAAGAAAGGATTTTGTGGG + Intergenic
1026668197 7:72362739-72362761 AAAGGAAGAAAGGCTGCAGGAGG - Intronic
1026716115 7:72790711-72790733 AAGAGAAGACAGGATTCTTCAGG - Intronic
1028280818 7:88925749-88925771 GAGAGTAGAAAGGATGGTGCAGG + Intronic
1029360656 7:100086277-100086299 AAGGGAAGAAAGCATGCAAGAGG + Intergenic
1029580449 7:101433645-101433667 AAGGGGAGAAAGGCTGGGGCAGG + Intronic
1030120016 7:106100876-106100898 AAGGGAAGAAAGGATCTTGCAGG - Intronic
1030445485 7:109643458-109643480 AAGGGAAGAAATGATTGTGGTGG + Intergenic
1031004013 7:116451869-116451891 GAGAGAAAAATGGATGCTGCAGG - Intronic
1034492380 7:151400320-151400342 AAGGGAAGAAAGCAGGATGTAGG + Intronic
1034706329 7:153148666-153148688 AAGTGAAGAAATGATTCTCCAGG - Intergenic
1035017889 7:155782344-155782366 AAGAAAAGAGAGGGTGCTGCAGG - Intergenic
1036589297 8:10153386-10153408 AAAGGAAGAAAGTATACAGCAGG - Intronic
1037568075 8:20134557-20134579 AAGGGATGGAAGGAGGCTTCTGG + Intergenic
1037604465 8:20425727-20425749 CTGGGAAGAAAGGAAGTTGCTGG + Intergenic
1037723802 8:21466921-21466943 AAGGAAAGACAGGAATCTGCTGG - Intergenic
1037837344 8:22221913-22221935 AAGGGAAGAGAAGATGTGGCTGG + Intronic
1038030514 8:23634541-23634563 AAGGGAAGAAAGGAAGGGGAGGG - Intergenic
1038046420 8:23769014-23769036 AAGGGCAAAAAGCAGGCTGCAGG + Intergenic
1038338570 8:26664735-26664757 AAGGGAAGACAGGAGGAAGCTGG - Intergenic
1039172540 8:34764299-34764321 GAGGGAAGGAAGGATTCTGGAGG + Intergenic
1039513156 8:38107560-38107582 AAGGAAAAAAAGGATGGTTCAGG - Intronic
1040434806 8:47380053-47380075 AAGGCAAGACAGGTTGCTTCTGG - Intronic
1040629516 8:49194080-49194102 GAGGGAAGAAAGGAGGCTAGAGG + Intergenic
1040939179 8:52815370-52815392 AAGGGAAGCCTGCATGCTGCAGG + Intergenic
1040996684 8:53409315-53409337 AAGGGAAGAAAGGAAGGAGAGGG + Intergenic
1041087613 8:54271328-54271350 AAGTGAAGACAGCATGCAGCAGG - Intergenic
1041091007 8:54300541-54300563 AAGGGAAAAAAGAATGTTCCAGG - Intergenic
1041142365 8:54836204-54836226 AAAGGGAGAAAAGATGTTGCAGG + Intergenic
1041394825 8:57379545-57379567 AAGGGAAGCAAGCTTCCTGCGGG - Intergenic
1042369570 8:67976141-67976163 AATCAAAGAAAGGGTGCTGCTGG - Intronic
1042500750 8:69506330-69506352 AAGGGATAAGAGGATGGTGCAGG - Intronic
1043599276 8:81918546-81918568 AAGGGAAGAAATGACGGTGGTGG - Intergenic
1044463772 8:92480069-92480091 AAGGGAAGAATGGATATTGGAGG - Intergenic
1044699441 8:94952561-94952583 AAGGGAAGAAAGGATCTGACTGG + Intronic
1044939401 8:97325222-97325244 ATGGAAAGAAATCATGCTGCTGG - Intergenic
1044982693 8:97732273-97732295 AAGGAAAGAAAAGATGGGGCCGG + Intergenic
1045217603 8:100163688-100163710 CAGGGAAGAAAGGAAGCTAAAGG - Intronic
1045487395 8:102642543-102642565 AAGTGAAGAAAGGATGACCCAGG - Intergenic
1045500546 8:102741160-102741182 AAGGGATGAAAGGATGTTTCTGG - Intergenic
1046099165 8:109594638-109594660 AAGGGAAGAAAGGAACCTGTGGG - Intronic
1046555561 8:115768716-115768738 AAGGGAAGAAAGGATGGGAAGGG - Intronic
1046911240 8:119630083-119630105 TAGGGAAGAAATGATGATGAAGG - Intronic
1046930540 8:119837452-119837474 AAGGAAAGAGAGGGTACTGCTGG + Intronic
1047056316 8:121168440-121168462 AAGGCAAGAATTGATGTTGCTGG - Intergenic
1047895810 8:129365229-129365251 AAAGGAAGAAAGGATGCCATGGG + Intergenic
1048246345 8:132806146-132806168 AAGGAAAAAAAGCATGATGCTGG - Intronic
1048417625 8:134243932-134243954 AAGGGAAGAAGGGAGGCGGAAGG + Intergenic
1048460407 8:134616625-134616647 AAAGGAAGAAAGGAAGCTGGAGG - Intronic
1048500081 8:134967559-134967581 ACGGGAAGAAAGCATGCTGGAGG + Intergenic
1048697959 8:137049797-137049819 AATGGAAGAAGGCTTGCTGCTGG - Intergenic
1048864044 8:138746258-138746280 AAGGGAAGAGACGAGGCTGACGG - Intronic
1049871076 8:144976986-144977008 AAGGGAAGAAAGCAAACTGAAGG + Intergenic
1050024406 9:1319281-1319303 AGGGGAGGAGAGGAGGCTGCAGG + Intergenic
1051612527 9:18975187-18975209 TGGGGAAGCAAGGAGGCTGCAGG + Intronic
1051733031 9:20167416-20167438 AAGGCAAGAAAGAATCCTGTGGG + Intergenic
1052045062 9:23784333-23784355 GAAGGAAAAAAGGATGCTGTGGG + Intronic
1052787576 9:32844064-32844086 AATGTAAAAAATGATGCTGCAGG - Intergenic
1052867322 9:33472356-33472378 AGGGGAAGAAAGCATCCTCCAGG - Exonic
1054822706 9:69539514-69539536 CAGGTAAGAAAAGATGCTGGTGG - Intronic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1057891890 9:98875846-98875868 GAGGAAAGAGAGGATGCTCCAGG + Intergenic
1058945959 9:109856425-109856447 AAGTGAAGAAAGTAAGCTGAAGG + Intronic
1059025835 9:110628225-110628247 AAGTGAACAAAGGATGGAGCAGG + Intergenic
1059541724 9:115137038-115137060 AAGGGAAGAAAGGAGGCAGTGGG + Intergenic
1059859879 9:118447936-118447958 AAGGCAAGAAGGGAAGCAGCAGG - Intergenic
1059889241 9:118782989-118783011 AAGGGCAGAAGGGAGGCTTCTGG + Intergenic
1059959309 9:119549884-119549906 CAGAGAAGAGAGGCTGCTGCTGG + Intergenic
1060309392 9:122445798-122445820 ATGGGAAGTTAGGATGGTGCTGG - Intergenic
1060995514 9:127873253-127873275 CAGGGAAGAGAGGGTGCTCCAGG + Intronic
1186731576 X:12416185-12416207 AAGGGAAGAAAGGAGGAGGAAGG - Intronic
1187356506 X:18577736-18577758 AAGGGAAGACTGGATACTGGAGG + Intronic
1187500019 X:19832130-19832152 TAGGGCAGAAAGGATGTAGCAGG - Intronic
1189275325 X:39781169-39781191 AAGGGAACATAGGAAGGTGCTGG + Intergenic
1189310820 X:40016035-40016057 AGAGGAAGAAAGGCTGCTCCAGG + Intergenic
1190264097 X:48817267-48817289 AAAGGAAGAAAGGAAGGTGAGGG + Intronic
1190496822 X:51034299-51034321 AAGGTAAGAAAGTTTTCTGCAGG + Intergenic
1190509147 X:51159638-51159660 AAGGTAAGAAAGTTTTCTGCAGG - Intergenic
1192507557 X:71698205-71698227 AAGGCCAGAAAGGCTGATGCTGG - Intergenic
1192519139 X:71783347-71783369 AAGGCCAGAAAGGCTGATGCTGG + Intergenic
1194381626 X:93198967-93198989 AAGAGAAGAAAAGATACTGATGG + Intergenic
1194633282 X:96312816-96312838 AAGGGAAGAAAAGAGACAGCAGG + Intergenic
1194744586 X:97614560-97614582 AAAGAAAGAAAGTATGCTGTGGG - Intergenic
1195599137 X:106726608-106726630 GAGGGAGGAAAGGACACTGCGGG - Intronic
1195701258 X:107707356-107707378 AAGGGAAGAAATAAGGCTGTAGG + Intergenic
1195746194 X:108121213-108121235 AGGGGATGAAAGCATGTTGCAGG + Intronic
1196480168 X:116139142-116139164 AGGGGAAGAAATGATGGTGGGGG + Intergenic
1198015958 X:132611202-132611224 AAGGCAACAAAGGAGGCTGAAGG + Intergenic
1198800209 X:140440052-140440074 ATGGGAAGCAAGCACGCTGCGGG + Intergenic
1199613889 X:149640024-149640046 AATGGAAGGAAGGACACTGCTGG - Intergenic
1200179059 X:154139342-154139364 AAAGGAAGACAGGAGGGTGCGGG - Intergenic
1200243309 X:154508819-154508841 GAGAAAAGAAAGGATGCTGAGGG + Intronic
1200373651 X:155756151-155756173 AAGGGAGGCCAGCATGCTGCAGG - Intergenic