ID: 1183981006

View in Genome Browser
Species Human (GRCh38)
Location 22:41540204-41540226
Sequence CGCTGCCTGTGGAGAGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 387}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183981006_1183981011 -6 Left 1183981006 22:41540204-41540226 CCGTCTGCTCTCCACAGGCAGCG 0: 1
1: 0
2: 3
3: 33
4: 387
Right 1183981011 22:41540221-41540243 GCAGCGGGAAGCCCGAGGAATGG 0: 1
1: 0
2: 0
3: 24
4: 204
1183981006_1183981015 6 Left 1183981006 22:41540204-41540226 CCGTCTGCTCTCCACAGGCAGCG 0: 1
1: 0
2: 3
3: 33
4: 387
Right 1183981015 22:41540233-41540255 CCGAGGAATGGACAAGGTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 114
1183981006_1183981016 7 Left 1183981006 22:41540204-41540226 CCGTCTGCTCTCCACAGGCAGCG 0: 1
1: 0
2: 3
3: 33
4: 387
Right 1183981016 22:41540234-41540256 CGAGGAATGGACAAGGTGCAGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1183981006_1183981012 0 Left 1183981006 22:41540204-41540226 CCGTCTGCTCTCCACAGGCAGCG 0: 1
1: 0
2: 3
3: 33
4: 387
Right 1183981012 22:41540227-41540249 GGAAGCCCGAGGAATGGACAAGG 0: 1
1: 0
2: 0
3: 19
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183981006 Original CRISPR CGCTGCCTGTGGAGAGCAGA CGG (reversed) Intronic
900101267 1:963092-963114 CGCCGCCTGGGGAGGGCAGGTGG - Exonic
900138916 1:1130910-1130932 AGCTGCCTGTGAAGGGCACAGGG + Intergenic
900182836 1:1319970-1319992 CACTGCCTCCGGAGAGGAGAAGG + Intronic
900185406 1:1331005-1331027 AGCAGGCTGTGGAGAGGAGAGGG - Intergenic
900200220 1:1401360-1401382 AGCTGCCTTTGGAGGGGAGACGG + Intronic
901026512 1:6281281-6281303 CGCAGCCTGTGGAGAAGGGAGGG + Exonic
901271528 1:7955529-7955551 CTCTGCCTGTGGAGGTCACAAGG - Intronic
901625864 1:10624702-10624724 CTCTGCCTGTGGAGATCTCATGG + Intronic
901816123 1:11794501-11794523 CCCTGCCTTTGGGGAGCTGAAGG - Exonic
901843018 1:11965518-11965540 AGCTGTCTAGGGAGAGCAGATGG - Exonic
902038642 1:13476056-13476078 CCCTGCCCATGGAGAGCAGGAGG - Exonic
902514907 1:16984940-16984962 AGCTGCCTCTCTAGAGCAGAGGG + Intergenic
902633473 1:17719701-17719723 AGCTGCCTGGGGGGACCAGAAGG + Intergenic
903046285 1:20566514-20566536 GGATGCCTGTGGACAGGAGAAGG - Intergenic
904075513 1:27839017-27839039 AACTGACTGTGGAGAGAAGAGGG + Intronic
905283546 1:36864599-36864621 TGCTGCCTCTGGAGACCAGAAGG - Intronic
905291463 1:36924476-36924498 GGCTGGCTGTGGAGAGGGGAGGG + Intronic
907045806 1:51299431-51299453 CGCTGCCTGCACAGAGCAGGTGG + Intronic
907578958 1:55554844-55554866 AGATGACTGTGCAGAGCAGATGG - Intergenic
908175646 1:61552754-61552776 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
908257533 1:62315295-62315317 CTCTGTCTTTGGAGATCAGACGG - Intronic
910349239 1:86277263-86277285 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
911303793 1:96208174-96208196 AGCTGCCTGTAGTGAGCAGTCGG - Intergenic
911967856 1:104390172-104390194 CTCTGCCTTTGGAAAGGAGAGGG + Intergenic
912099714 1:106190455-106190477 CTCTGCCCTTGGAAAGCAGAGGG + Intergenic
912152812 1:106880488-106880510 CTCTGCCTGTGGAAAGAGGAGGG + Intergenic
912242711 1:107927688-107927710 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
912628022 1:111222435-111222457 TGCTCCCTGGGGAGAGCAGTGGG - Intronic
912685036 1:111755672-111755694 CGCTGCCTGTGGCCTGCAGAGGG - Exonic
916248085 1:162708399-162708421 TGCTGCCTCTTGAGAGCACATGG - Intronic
918336559 1:183520952-183520974 CACTGCCTGTGGAATGCAGTCGG - Intronic
920096908 1:203492307-203492329 CCCAGGCTGTGGAGAGAAGATGG + Intergenic
920953597 1:210597566-210597588 CTCTGCTTGTGGAAAGGAGAAGG - Intronic
921277339 1:213532940-213532962 GGCTATCTGGGGAGAGCAGAGGG + Intergenic
921375013 1:214464675-214464697 CGCTGTCGGTGGAAAGCACAGGG - Exonic
922377199 1:224980390-224980412 CTCTGCCTGTGGAGAGAGGAAGG + Intronic
922588511 1:226754086-226754108 GGCTGCTGGTGGAGAACAGAGGG + Intergenic
924028987 1:239867833-239867855 GGCTGCCTTTGGAGGGGAGATGG - Intronic
924048051 1:240052543-240052565 GGCTGCCTGACAAGAGCAGATGG - Intronic
924435549 1:244037450-244037472 GGCTGGCTGTGGAGGGTAGAGGG + Intergenic
924611868 1:245580221-245580243 TCATGCCTGTGGAGTGCAGAAGG - Intronic
1064519586 10:16187219-16187241 CCCTGCCAGTTGAGAGCAAATGG + Intergenic
1066195568 10:33096272-33096294 GGCTGCCTGTGGAGCACAGCTGG - Intergenic
1070114757 10:73517508-73517530 CCTTGCCTGTGGAATGCAGAGGG + Exonic
1071572113 10:86703035-86703057 CTCTGGCTGCGGAGAGCAGCAGG + Intronic
1072518209 10:96207584-96207606 CGCTTCCTGTGGAGAGGGCAGGG + Intronic
1075690861 10:124393202-124393224 CTCTGCCAGTGAAGGGCAGAGGG + Intergenic
1077073203 11:687203-687225 CACTGCCTGTGGACAGCGGGTGG - Intronic
1077463020 11:2720402-2720424 CCCTGCCTGGGGACAGCTGAAGG + Intronic
1077970320 11:7182139-7182161 CCCTGCCTTTGGAAAGAAGAGGG + Intergenic
1078045587 11:7911678-7911700 CACTGTCTGTGGGGAACAGAGGG - Intergenic
1079571787 11:21952534-21952556 CTCTGCCTGAGGAAAGAAGAAGG + Intergenic
1080360779 11:31510353-31510375 AGCTGCCTGGAGAAAGCAGAAGG - Intronic
1080411872 11:32032732-32032754 CGCTGCTGCTGGAGAGCAGAAGG - Intronic
1080640544 11:34155899-34155921 CCCTGCATGGGGAGGGCAGAGGG - Intronic
1081489923 11:43559277-43559299 GGAGGACTGTGGAGAGCAGATGG - Intronic
1081491752 11:43574950-43574972 CTCTTCGGGTGGAGAGCAGAGGG + Intronic
1081631493 11:44692828-44692850 GGCTGCCTGTACAGAGCAGGAGG - Intergenic
1082000188 11:47389884-47389906 TGCTGCCCGTGGTGAGCAGAAGG - Intergenic
1083608095 11:63991067-63991089 GGGTGCCTGTGGAGAGATGAAGG + Intronic
1083728025 11:64638393-64638415 GGCTGCCTCCGGAGCGCAGAAGG + Intronic
1084008334 11:66334719-66334741 CGGTGCCAGTAGGGAGCAGAAGG + Exonic
1084019328 11:66408669-66408691 CGCAGGCTTTGGGGAGCAGAGGG + Intergenic
1084388276 11:68858142-68858164 CACAGACTGAGGAGAGCAGAGGG - Intergenic
1085223516 11:74896430-74896452 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1086033147 11:82384243-82384265 CTCTGCCTGTGGAAAGAAGAAGG + Intergenic
1086236292 11:84635128-84635150 CGCTGCCTGGGAAGAGCTAAAGG - Intronic
1086468132 11:87076269-87076291 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1087492317 11:98844527-98844549 CTCTGCCTGTGGAAAGGTGAGGG - Intergenic
1087598336 11:100282821-100282843 CTCTGCCTTTGGAAAGGAGAGGG - Intronic
1088154789 11:106790227-106790249 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1088375846 11:109140879-109140901 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
1089063651 11:115645955-115645977 CGCTGCGTGGGGAGTGCGGAGGG + Intergenic
1089119579 11:116124293-116124315 CCCTCCCTGTGAAGAGCAAAGGG - Intergenic
1089762149 11:120735768-120735790 CTCTGCCTGTGGAAAGGAGAGGG - Intronic
1089824648 11:121264423-121264445 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1089937141 11:122375877-122375899 CTCTGCCTTTGGAAAGAAGAAGG + Intergenic
1091231666 11:133991681-133991703 GGCTGTCTGCGGAGAGCAGTGGG + Intergenic
1093903247 12:24660839-24660861 CTCTGCCTGTGGAAAGGAGAGGG - Intergenic
1094380703 12:29840366-29840388 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1095181663 12:39153791-39153813 CGCTGCCTCAGGAAAGCGGAGGG - Intergenic
1095227463 12:39694845-39694867 CTCTGCTTGAGGAGAGGAGAAGG + Intronic
1098649907 12:72952109-72952131 CTCTGCCAGTGCAGTGCAGAAGG - Intergenic
1098705650 12:73685402-73685424 CTCTGCCATTGGAAAGCAGAGGG + Intergenic
1099564864 12:84230389-84230411 CTCTGCCTTTGGAAAGAAGAGGG - Intergenic
1099764105 12:86960561-86960583 CTTTGCCTGTGGAAAGGAGAGGG - Intergenic
1101287870 12:103334666-103334688 CGTGGCCTCTGGAGAACAGATGG - Intronic
1102794013 12:115672909-115672931 CTCTGCCTGGGGAGAGTCGATGG + Intergenic
1104362641 12:128148577-128148599 CGCAGCCTTAGGAGAGCAGAGGG - Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1105401482 13:20100050-20100072 TGCTGCCTTTGGAGAGCAACAGG + Intergenic
1106023975 13:25940198-25940220 CACTCTCTGTGGTGAGCAGAAGG - Intronic
1106101597 13:26698139-26698161 GGCTGGCTTTGGAGAGAAGAGGG - Intergenic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1110916746 13:81030608-81030630 CTCTGCCTGGGGAAAGGAGATGG - Intergenic
1113657245 13:112074687-112074709 CGTTGTTTGTGGAGAGCAGCAGG + Intergenic
1113949003 13:114060824-114060846 GGCTCCCTGTGAAGAGCAGGAGG + Intronic
1113968227 13:114166844-114166866 CGCAGCCCGTGGTGAGGAGAGGG - Intergenic
1114506330 14:23217269-23217291 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1115133965 14:30086738-30086760 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1115381623 14:32746213-32746235 TTCTGCTTGAGGAGAGCAGAGGG - Intronic
1116021582 14:39468618-39468640 CTCTGCCTGTGGAAAGTGGAGGG - Intergenic
1116407117 14:44579609-44579631 CTCTGCCTTTGGAAAGGAGAGGG + Intergenic
1116434107 14:44877495-44877517 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1116481131 14:45392406-45392428 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1116889190 14:50250399-50250421 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1117606135 14:57430992-57431014 TTCTGCCTGAGGAGAGGAGAGGG + Intergenic
1117994677 14:61467475-61467497 CGCTGGATGTGGGGAGGAGAAGG + Intronic
1118362626 14:65069196-65069218 CCCAACCTGTGCAGAGCAGATGG + Intronic
1118502950 14:66380356-66380378 CTCTGCCACTGGAGAGCAGGTGG + Intergenic
1118543602 14:66858913-66858935 CTCTGCCTGTGGAAAATAGAGGG + Intronic
1122627630 14:103092334-103092356 AGGTGCCTGTGGAGAGCAGATGG + Intergenic
1122718674 14:103709988-103710010 CGCTGTCTGTGGCGAGAAGCCGG - Intronic
1122724623 14:103742087-103742109 TGCTGCCTGTGGCGGGCAGCAGG + Exonic
1122786755 14:104167523-104167545 TGCCGCCTGTGGAGGGCACAGGG + Intronic
1123508587 15:20972089-20972111 CTCTGCCTGTGGAAGGAAGAGGG - Intergenic
1123565809 15:21545838-21545860 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1123602071 15:21983125-21983147 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1125363244 15:38886924-38886946 TGATGCCTGGGGAGAGAAGAGGG + Intergenic
1125755933 15:42065101-42065123 CACAGCCTGTGGTGAGCAGAGGG + Intergenic
1125775379 15:42208069-42208091 GGCTGCCTGGGGTGAGCCGAGGG - Exonic
1126183834 15:45811370-45811392 CTCTGCCTTTGGAAAGGAGAAGG + Intergenic
1127141495 15:55982563-55982585 GGCTGCCTATAGAGAGTAGACGG + Intronic
1129501120 15:76038521-76038543 CTCTGCCTGTGAAAAGGAGAGGG + Intronic
1130298730 15:82664823-82664845 CGCAGACAGTGGTGAGCAGATGG - Exonic
1130441098 15:83955253-83955275 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1130511854 15:84595884-84595906 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
1131023017 15:89115714-89115736 GGGAGCCTGTGGGGAGCAGATGG + Intronic
1131950120 15:97672980-97673002 CTCTGCCTTTGGAGAGAGGAGGG - Intergenic
1132398017 15:101488920-101488942 CGCCGCCCGTCGAGGGCAGAGGG + Intronic
1202974178 15_KI270727v1_random:272931-272953 CTCTGCCTGTGGAAAGAAGAGGG - Intergenic
1132784077 16:1644798-1644820 CGTTCCCTGTGGAGAAGAGATGG + Intronic
1132785916 16:1656918-1656940 CGCTGCTTGTGGAGGGCGGTGGG - Exonic
1133723099 16:8513270-8513292 GGCTGGCTGTGCAGAACAGAGGG + Intergenic
1137623278 16:49891072-49891094 CGGTGCCTGTGGGGAGGAGCTGG + Intergenic
1138638356 16:58362175-58362197 TTCTGCCTGAGGAGAGGAGAGGG - Intronic
1139654424 16:68378670-68378692 CCCTCCCTGTGGAGTGCAGCAGG - Intronic
1141706499 16:85668123-85668145 CGCTCCCTGTGGAGGGGACAGGG - Exonic
1143103244 17:4515352-4515374 GGCTGGCAGTGGAGAGCAGCCGG + Intronic
1144335978 17:14269288-14269310 CCCTGCCTGTGGGTGGCAGATGG - Intergenic
1144440581 17:15277514-15277536 AGCAGGCTGGGGAGAGCAGAAGG + Intergenic
1144519216 17:15943292-15943314 TTATGCCTGTGGAGGGCAGAGGG + Intergenic
1146818243 17:35962390-35962412 GGCTGCCTTTGGGGAGAAGATGG + Intergenic
1147188101 17:38723574-38723596 GGCTGCCTGTAGGGACCAGATGG + Intronic
1147188329 17:38724929-38724951 CTCAGCCTGTCGGGAGCAGAGGG + Exonic
1147923625 17:43933479-43933501 TGCTGACAGTGGAGAGCAGCTGG - Intergenic
1148177292 17:45578007-45578029 GGCTGCCAGGGGAGAGCAGGAGG + Intergenic
1148178534 17:45586932-45586954 GGCTGCCTGTGGAGAGAGAATGG - Intergenic
1148270621 17:46259523-46259545 GGCTGCCTGTGGAGAGAGAATGG + Intergenic
1148446614 17:47741733-47741755 AACTGCCTGTGGAGAGCTGGTGG + Intronic
1150197877 17:63319860-63319882 GGCTGCCTGTGGAGAGAAGATGG - Intronic
1150541439 17:66104222-66104244 CTCTGCCTGAAGAGAGGAGAGGG + Intronic
1150839706 17:68596366-68596388 CCTTGCCTGTCGAGACCAGAGGG + Intronic
1151338482 17:73455143-73455165 CGCAGCCTGGGTAGATCAGAAGG + Intronic
1151680714 17:75621328-75621350 CCCAGCCTGTGGGGGGCAGAGGG - Intergenic
1152258892 17:79255921-79255943 CGCTGCCTGCCGAGCACAGAGGG + Intronic
1152800914 17:82330257-82330279 AGCAGCCTGGGGAGAGCAGCAGG - Intronic
1152938125 17:83152413-83152435 CGCTGCCTGGGGGCAGGAGAGGG + Intergenic
1152938193 17:83152680-83152702 CGCTGCCTGGGGGCAGGAGAGGG + Intergenic
1153307507 18:3645628-3645650 CTCTGCCTGGGTAGATCAGAAGG - Intronic
1153356650 18:4144006-4144028 CTCTGCTTGAGGAGAGGAGAAGG - Intronic
1153688250 18:7567397-7567419 GGCTGCCTGTGGAGAGGCGGCGG + Exonic
1155597346 18:27502900-27502922 CTCTGCCTTTGGAAAGGAGAGGG + Intergenic
1156368578 18:36451994-36452016 TGCTGCTTGTGGAGGGCAAAGGG - Intronic
1156481253 18:37437729-37437751 CTCTGGCTGTGGAGATCAGGAGG - Intronic
1158655163 18:59324303-59324325 GGCTGACTGAGGAAAGCAGATGG + Intergenic
1159080685 18:63731842-63731864 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1159446252 18:68544926-68544948 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1160210343 18:76873443-76873465 AGCTGCCTGGAGAGAGCAGCAGG + Intronic
1160420899 18:78743219-78743241 TGCTGCATGTGGAGAGCACGTGG - Intergenic
1160793167 19:932401-932423 GGCTTCCTGGGGTGAGCAGAGGG - Exonic
1160831578 19:1107003-1107025 CCCTGCCTGTGCACAGCAGGTGG - Intergenic
1161406494 19:4094239-4094261 GGCTGGCTGCGGGGAGCAGAGGG - Intronic
1161720281 19:5898442-5898464 CTGTGCTTGTGGGGAGCAGATGG - Intronic
1162522131 19:11187507-11187529 CACTGACGGTGGAGAGCGGAGGG + Intronic
1162692965 19:12449198-12449220 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
1162778814 19:12996108-12996130 CGCTGCCCGTGGAGCGCAGGCGG + Intronic
1165645474 19:37431940-37431962 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1167566253 19:50259127-50259149 CCCGGCCTGGGGAGAGCGGACGG - Exonic
1168615383 19:57833280-57833302 CTCTGCCTGTGGAAAGGGGATGG - Intronic
1168621401 19:57882167-57882189 CTCTGCCTGTGGAAAGGGGATGG + Intronic
925071980 2:976884-976906 GGCTGCCTCTGGAGAGCTGCTGG - Intronic
925249612 2:2421420-2421442 CTCTGCCTTTGGAAAGCGGAGGG - Intergenic
926829771 2:16948863-16948885 CTCTGACTTTGGAGAGCATAAGG + Intergenic
928209564 2:29313426-29313448 CCCAGCCTGTGGAGAGACGAAGG + Intronic
928293601 2:30061540-30061562 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
929524970 2:42693474-42693496 CTCTGCCTGTGGAAAGGGGAAGG - Intronic
929847106 2:45541684-45541706 AGCTCCCAGTGGAGAGGAGATGG + Intronic
929964596 2:46524783-46524805 GTCTGCGTGTGGAGAGCAGGTGG + Intronic
930439619 2:51390166-51390188 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
931012226 2:57929962-57929984 CTCTGCTTGAGGAGAGGAGAGGG - Intronic
931321963 2:61180588-61180610 CGCTGCTGGAGGAGAGCAGCTGG - Intronic
931917083 2:66968114-66968136 TTCTCCCTGTGGAGAGGAGATGG + Intergenic
933387903 2:81634639-81634661 CTCTGCCTTTGGAAAGGAGAAGG + Intergenic
933461371 2:82591481-82591503 GTCTGCCTGTCAAGAGCAGATGG - Intergenic
933653189 2:84865500-84865522 CTTTGCATGTGGAAAGCAGAGGG + Intronic
933941723 2:87250700-87250722 GGTTTCCTGTGGAGAGCTGAGGG + Intergenic
935057343 2:99579061-99579083 GGCTGTCTGTGAAGACCAGAAGG + Intronic
935078559 2:99770218-99770240 TTCTGCCTGTGGAAAGGAGAGGG - Intronic
935232399 2:101110298-101110320 CACTGCCTGTGGTTAGCACAAGG - Intronic
935802894 2:106716334-106716356 GGGAGCCTGTGAAGAGCAGAAGG - Intergenic
936338502 2:111610869-111610891 GGTTTCCTGTGGAGAGCTGAGGG - Intergenic
936531516 2:113279462-113279484 CGCTATCTGTGTAGAACAGAGGG - Intergenic
936556475 2:113502070-113502092 GGCTGCCTGTGCAAAGAAGAGGG - Intergenic
936680088 2:114760097-114760119 GCCTGCCTGTGGAGACCAGCTGG - Intronic
939892868 2:147758097-147758119 CGATGCCTGGGGAGAGTAGTAGG - Intergenic
940315119 2:152320259-152320281 CTCTGCCTTTGGAAAGGAGAAGG - Intergenic
941296189 2:163741286-163741308 CTGTGCCTGTGGAAAGCAAAGGG - Intergenic
941672521 2:168310339-168310361 CTCTGCCTGTGGAAAGGGGAAGG - Intergenic
941678663 2:168371506-168371528 CTCTGCCTGTGAAAAGCAGAAGG + Intergenic
942601053 2:177641512-177641534 AGCTGGCTGTGGAGTCCAGATGG + Intronic
942972207 2:181970808-181970830 CTCTGCTTGTGGAAAGGAGATGG - Intronic
944096345 2:195973078-195973100 GGCTGCATGTGGAGAGAACATGG + Intronic
944990471 2:205229881-205229903 CTCTGCTTGTGGAAAGAAGAGGG - Intronic
945592377 2:211749474-211749496 TGTTGCCTATGGAGAGCTGAGGG + Intronic
946066738 2:216994386-216994408 AGCTGCCTGTGAAAAGCAGGAGG - Intergenic
946434914 2:219644952-219644974 CGCTTCCAGTCCAGAGCAGATGG - Intergenic
946850482 2:223901537-223901559 CCATGCCTGTGGGGAGCAGAGGG - Intronic
947082983 2:226419546-226419568 AGCTGCCTCTGGGGAGAAGAAGG + Intergenic
947312405 2:228818583-228818605 TTCTGCCTGAGGAGAGGAGAGGG - Intergenic
947632406 2:231662604-231662626 CGCTGCCCGCGGAGCGAAGATGG + Intergenic
947687068 2:232097477-232097499 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
949065704 2:241989283-241989305 CGGAGCCTGTGGAGAGGAAAGGG - Intergenic
1168959238 20:1857455-1857477 AGTTCCCTCTGGAGAGCAGAGGG + Intergenic
1170086902 20:12544209-12544231 CTCTGCCTTTGGAGAGGGGAAGG - Intergenic
1170634172 20:18090597-18090619 GGAGCCCTGTGGAGAGCAGAGGG + Intergenic
1170668455 20:18406965-18406987 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1170709311 20:18775736-18775758 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
1171191601 20:23163059-23163081 AGCTGTCTGAGGAGAGCAGGAGG + Intergenic
1171237482 20:23539338-23539360 AGCAGCCTGTGGAGGTCAGAGGG + Intergenic
1172418885 20:34797222-34797244 CTCTGCTTGAGGAGAGGAGAGGG + Intronic
1172605808 20:36212749-36212771 GGCTGCTTGAGGAGAGAAGAGGG + Intronic
1172783937 20:37453611-37453633 AGTTTCCTCTGGAGAGCAGAAGG - Intergenic
1173316356 20:41948213-41948235 CTCTTCCAGTGGAGAGCACAGGG - Intergenic
1173790410 20:45824401-45824423 CGCTGCCTGCGGGCAGCAGGTGG + Exonic
1174285679 20:49471313-49471335 TGCTGTGTGTGGAGACCAGACGG + Intronic
1174831800 20:53820344-53820366 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1175186935 20:57185056-57185078 GGCTGCCCCTGGAGAGCCGATGG + Intronic
1175641821 20:60636461-60636483 TGCTGCCTGTAGAGAGGATATGG + Intergenic
1177212896 21:18091860-18091882 CTCTGCCTGTGGAAAGGGGAAGG + Intronic
1177487945 21:21783269-21783291 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1177740568 21:25148414-25148436 CTCTGCCTATGGAAAGGAGACGG - Intergenic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1178338635 21:31766370-31766392 CTCTGCTTGGGGAGTGCAGAAGG + Intergenic
1178938992 21:36889320-36889342 CGCAGTGTGTGGTGAGCAGATGG - Intronic
1179248406 21:39652576-39652598 GGCTGCCTGCGGTTAGCAGAAGG + Intronic
1179546040 21:42112813-42112835 CTCTGGATGTGTAGAGCAGATGG - Intronic
1180134214 21:45850837-45850859 CACAGCATGTGGAGAGCATAAGG + Intronic
1180248248 21:46562659-46562681 GGCTGAGTGTGGGGAGCAGAAGG + Intronic
1181362765 22:22351371-22351393 CTCTGCCTGTTGGGAGAAGATGG - Intergenic
1181365526 22:22374153-22374175 CTCTGCCTGTTGGGAGAAGATGG - Intergenic
1182686020 22:32122248-32122270 CACTGCCTGTGGAGGGGAGTGGG + Intergenic
1183320127 22:37160221-37160243 AGCTCCCTGTGGGGAGCAGCGGG + Intronic
1183585072 22:38748686-38748708 GCCTGCATGGGGAGAGCAGAGGG - Intronic
1183700743 22:39449608-39449630 GGCTGCCTGGGGAAGGCAGAGGG + Intergenic
1183732713 22:39627708-39627730 CTCGGCTTGGGGAGAGCAGAAGG + Intronic
1183981006 22:41540204-41540226 CGCTGCCTGTGGAGAGCAGACGG - Intronic
1185052205 22:48559762-48559784 GCCTGCCTTTGGGGAGCAGAGGG + Intronic
1185323986 22:50216674-50216696 AGCTGCCTGTGGAGAGGCCAGGG - Exonic
1185338807 22:50282665-50282687 AGCTGGGTGTGGGGAGCAGAGGG + Intronic
951172092 3:19554470-19554492 CTCTGCCTGTGGAAAGGAGAGGG - Intergenic
951423176 3:22511167-22511189 CCCTGCCTATGGAAAGGAGAGGG + Intergenic
952050711 3:29381168-29381190 CAATGCCAGTGGAGAGCAGGGGG - Intronic
953830110 3:46289709-46289731 AGATGGGTGTGGAGAGCAGAGGG + Intergenic
954256606 3:49411808-49411830 CGTTGCCTGAGGTGAGCGGAAGG - Exonic
954413818 3:50383208-50383230 GGCAGCCTGTGGGGAGCAGGGGG + Intronic
955910245 3:63852484-63852506 CCCTGCCTGGGGTGAGAAGAAGG - Intronic
955960221 3:64332986-64333008 GGCAGCCTGAGGAGAGTAGACGG - Intronic
956476061 3:69621487-69621509 CACTGCTTGAGGAGAGGAGAGGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957965787 3:87321371-87321393 CTCTGCCTTAGGAGAGGAGAGGG + Intergenic
959336137 3:105067063-105067085 CTCTGCCTGTGGAAAGAGGAAGG + Intergenic
960870082 3:122239325-122239347 CTCTGCCTGTGGAAAGGTGAGGG + Intronic
961964372 3:130887565-130887587 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
963056262 3:141188598-141188620 TGCTGCCTGCGGGGAGCAGACGG - Intergenic
963310147 3:143700574-143700596 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
964339043 3:155688805-155688827 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
964804143 3:160588092-160588114 CTCTGCCTATGGAAAGCAGAGGG + Intergenic
965145045 3:164890263-164890285 CTCTGCTTGAGGAGAGGAGATGG - Intergenic
966931620 3:184679122-184679144 AGCTTCCTGTCGAGAGCTGAGGG - Intronic
968018081 3:195357228-195357250 CACTGCCTGGGGAGAGGAAAGGG + Intronic
968151299 3:196338630-196338652 TGCTGCCTGGGGAGAGCGGAGGG - Intergenic
968317439 3:197736651-197736673 GCCTGCCTGAGGAGAGCAGGTGG - Exonic
968334539 3:197901637-197901659 CTCCGCATGTGGAAAGCAGATGG + Intronic
968896908 4:3409656-3409678 TGCTGCCGGTGGAGGGGAGATGG - Intronic
969484471 4:7464428-7464450 CGCAGCCTGTGGAGGGCTGGTGG + Intronic
970179946 4:13381159-13381181 TGCTGCCTGTGGCTAGGAGATGG - Intronic
971095613 4:23399070-23399092 CTCTGCCTGTGGAAAGGGGACGG - Intergenic
971105220 4:23517355-23517377 TTCTGCCTGTGGAAAGGAGAAGG - Intergenic
974295536 4:59994320-59994342 CTCTGCTGGTGGAGGGCAGAGGG + Intergenic
975592349 4:76012436-76012458 CCCTGCGTGGGGAGAGGAGAGGG - Intronic
977307407 4:95342258-95342280 CTCTGCTTGAGGAGAGGAGAGGG + Intronic
978212611 4:106156605-106156627 TTCTGCCTATGGAAAGCAGAGGG - Intronic
978654314 4:111048611-111048633 CTCTGCTTGAGGAGAGAAGAAGG + Intergenic
979100202 4:116603543-116603565 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
979573050 4:122252561-122252583 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
982719803 4:158847907-158847929 CTCTGCCTGGGGACAGGAGAGGG + Intronic
983282179 4:165694900-165694922 CTCAGCCTGTGGAGGGCATATGG + Intergenic
983456330 4:167969036-167969058 CTCTGCCTTTGAAGAGGAGAGGG + Intergenic
984022150 4:174498505-174498527 GGTTGCCTGTGGGGAGGAGAGGG - Intronic
985528807 5:421743-421765 CACAGCCTCAGGAGAGCAGAAGG - Intronic
985722220 5:1495387-1495409 GGCTTCCTGTGGAGATGAGATGG - Intronic
986107331 5:4672360-4672382 CACTGCCTGGGGTAAGCAGAGGG + Intergenic
988340174 5:29960537-29960559 CTCTGCCTGTGGAAAGGGGAAGG + Intergenic
989032235 5:37131312-37131334 AGCTGACTGTGAAGACCAGAGGG - Intronic
989432464 5:41371797-41371819 CCCTGCCTGCATAGAGCAGAAGG + Intronic
989671765 5:43925390-43925412 CTCTGCTTGAGGAGAGGAGAGGG - Intergenic
990774266 5:59287322-59287344 CTCTGCTTGTGGAAAGGAGAAGG + Intronic
991395246 5:66198268-66198290 CTCTGCCTGGGGAAAGGAGAGGG - Intergenic
991594515 5:68288852-68288874 CGCTGCCTGGGGAGGACAGATGG + Intronic
991639833 5:68741167-68741189 CTCTCCCTGTGGAGAGGCGAAGG + Intergenic
993207001 5:84894952-84894974 TTCTGCCTGTGGAAAGGAGAGGG - Intergenic
993278813 5:85898410-85898432 CTCTGCCTTTGGAAAGCAGATGG - Intergenic
993981315 5:94546126-94546148 CTCTGCCTGTGGAAAGGGGAAGG + Intronic
994028620 5:95114562-95114584 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
994706265 5:103210293-103210315 CTCAGCCTGTGGAAAGCATATGG - Intronic
996666619 5:126066989-126067011 CTCTGCCTGTGGAAAGAGGAAGG + Intergenic
997713687 5:136027213-136027235 ACTTGGCTGTGGAGAGCAGATGG - Intergenic
998291140 5:140916028-140916050 CTCTGCCTGTGGAAAGGGGAGGG - Intronic
998830420 5:146152177-146152199 TGGTTCCTGTGGAGAGTAGAAGG - Intronic
999868563 5:155728033-155728055 CGCTCCCTTTGCAGAGCGGAGGG - Intergenic
1000610139 5:163365095-163365117 CTCTGCCAGTGAAGGGCAGAGGG - Intergenic
1001317052 5:170651072-170651094 CTCTGCCTCTGAAGGGCAGAGGG + Intronic
1002254319 5:177948058-177948080 AGGTGCCTGTGGAAAGCAGATGG - Intergenic
1002483678 5:179519754-179519776 AGATGCCTGTGGAAAGCAGATGG + Intergenic
1003438009 6:6111803-6111825 CTCTGCTTGAGGAGAGGAGAAGG - Intergenic
1005140485 6:22626234-22626256 CGCTGCCTATGGACTGCAGACGG + Intergenic
1005277405 6:24234526-24234548 TGCTGCCTGTGGAGAAAAAAAGG + Intronic
1007428894 6:41764962-41764984 AGTTGCCTGTGGAGAGGAGTTGG - Intergenic
1007980936 6:46157625-46157647 TCCTGCCTGAGGAAAGCAGAAGG + Intergenic
1009893841 6:69721968-69721990 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1010474840 6:76274653-76274675 CGCTGCCTGAGGAAAGGGGAGGG - Intergenic
1010502252 6:76615318-76615340 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1010676716 6:78753950-78753972 CTCTGCCTGTGGAAAGGGGATGG + Intergenic
1011271030 6:85580086-85580108 CTCTGCTTGAGGAGAGGAGAGGG + Intronic
1011333284 6:86233958-86233980 CTCTGCCTGATGAGAGGAGAGGG - Intergenic
1012224552 6:96689053-96689075 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1013533987 6:111046795-111046817 CCCAGGCTGTGGAGAGCAGCTGG - Intergenic
1013687510 6:112601941-112601963 CTCTGCCTGTGGAAAGAGGAGGG + Intergenic
1014234174 6:118936553-118936575 GGCTGCCTGTGCAGATCACATGG + Intergenic
1014234684 6:118940694-118940716 CTTTGCCTGTGGAAAGGAGAGGG + Intergenic
1018118885 6:160616115-160616137 CGCTGCCTGTGCACAGGAAATGG - Intronic
1018119489 6:160621661-160621683 CGCTGCCTGTGCACAGGAAATGG - Intronic
1018120089 6:160627207-160627229 CGCTGCCTGTGCACAGGAAATGG - Intronic
1018120693 6:160632753-160632775 CGCTGCCTGTGCACAGGAAATGG - Intronic
1018121287 6:160638300-160638322 CGCTGCCTGTGCACAGGAAATGG - Intronic
1018121889 6:160643845-160643867 CGCTGCCTGTGCACAGGAAATGG - Intronic
1019734465 7:2644013-2644035 CTCTGCAAGTGGAGAGCAGAGGG + Intronic
1020812711 7:12865185-12865207 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1021842724 7:24733687-24733709 CTCTGCCTGGGGAAAGGAGAGGG + Intronic
1024037854 7:45523917-45523939 CACTGCCTCTGGCAAGCAGATGG - Intergenic
1024891730 7:54211270-54211292 CTCTGCCTTTGGAAAGCGGAGGG + Intergenic
1027520379 7:79199251-79199273 GGCTGCATTTGGAGGGCAGAAGG + Intronic
1028032439 7:85933036-85933058 CTCTGCTAGTGCAGAGCAGAAGG + Intergenic
1028521948 7:91741996-91742018 CTCTGCCTGTGGAAAGGAGAGGG - Intronic
1031085545 7:117298634-117298656 CGAGGCCTGTGGAGAGGAGAGGG + Intronic
1031306211 7:120130725-120130747 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1032851684 7:135800712-135800734 TACTGGCTGTGGAGAGCTGACGG + Intergenic
1033471158 7:141650456-141650478 CACTTCCTGTAGAGAACAGAAGG - Intronic
1034182199 7:149147635-149147657 CGCCGCCTGTGGAGAGGACCCGG + Exonic
1034227975 7:149497614-149497636 CGCCGCCTGCGGAGAGCACCGGG - Exonic
1034243122 7:149624640-149624662 CGCCGCCTGCGGAGAGCACCGGG - Intergenic
1034772303 7:153791971-153791993 CACTGTTTGTGGAGAGCACATGG - Intergenic
1034847858 7:154463855-154463877 CTCTGCTTGAGGAGAGGAGAGGG - Intronic
1038180189 8:25220553-25220575 CGGTACCTGTGGAGAGCTGGGGG - Intronic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1039823508 8:41154373-41154395 CACAGCCTCTGGTGAGCAGATGG + Intergenic
1041416952 8:57621169-57621191 AGCTGCCTGTGTAAAGAAGAAGG - Intergenic
1041852294 8:62405157-62405179 CTCTGCTTGAGGAGAGGAGAGGG - Intronic
1042316814 8:67434769-67434791 CTCAGCCTGTCGGGAGCAGACGG + Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1042898431 8:73695778-73695800 CTCTGCCTGTGGAAAGGGGAGGG + Intronic
1043077022 8:75715440-75715462 CTCTGCCAGCGGAGGGCAGAGGG - Intergenic
1043998067 8:86843454-86843476 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1045733377 8:105267227-105267249 CTTTGCCTGTGGAAAGAAGAGGG - Intronic
1045800601 8:106096785-106096807 CTCTGCCTAAGGAGAGGAGAAGG + Intergenic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049896547 9:115269-115291 GGCTGCCTGTGCAAAGAAGAGGG + Intergenic
1050355928 9:4782457-4782479 CTCTGCCTGTGGAAAGTACAGGG + Intergenic
1051921814 9:22275329-22275351 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1054927936 9:70606925-70606947 TACTACCTCTGGAGAGCAGAGGG + Intronic
1055692244 9:78845644-78845666 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1056350173 9:85741712-85741734 CGCGGCCCGGGGAGAGCAGAGGG + Intronic
1056516715 9:87359180-87359202 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1056942926 9:90970764-90970786 GGCTGCCTGTGGACATCAGCAGG - Intergenic
1057179145 9:93020467-93020489 GGCTACCTGTGGAGAGCAGAAGG + Intronic
1057644488 9:96860030-96860052 CCCTGCCTGGGGAGAGGGGAGGG + Intronic
1059329610 9:113526588-113526610 CGCTGTCTGAGGCAAGCAGAAGG - Intronic
1059449585 9:114362113-114362135 CACAGCCTGTGGATGGCAGAGGG - Intronic
1060209244 9:121699903-121699925 CGCTGCCCGTGGTGAGGGGAAGG + Intronic
1061032177 9:128091972-128091994 CCCTGCCTGGAGAGACCAGATGG + Intronic
1061397103 9:130349218-130349240 CTTTGCCTGCGGAGAGCAGGGGG + Intronic
1061856458 9:133444320-133444342 CTCTGCCTCTGGAGAGTAGGAGG + Intronic
1061915531 9:133751256-133751278 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1186872006 X:13782572-13782594 AAATGCCTGTGGAAAGCAGAGGG - Intronic
1186911620 X:14173928-14173950 CTCTGCCTGTGGAAAGGAGAGGG - Intergenic
1189593904 X:42543877-42543899 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1190015179 X:46820272-46820294 CTCTGCCTGTGGAAAGGGGAGGG + Intergenic
1190190328 X:48271672-48271694 CGGTGCATGGGGAGAGGAGAGGG + Intronic
1190614585 X:52217394-52217416 TTCTGCCTGTGAAAAGCAGAGGG + Intergenic
1190659064 X:52638164-52638186 CGGTGCATGGGGAGAGGAGAGGG + Intergenic
1191826979 X:65376201-65376223 TGCTTCCTGTGGAGAGGATAGGG + Intronic
1192667294 X:73101443-73101465 CTCTGCCTTTGGAAAGGAGAAGG - Intergenic
1193915530 X:87357721-87357743 CCATGCCTTTGGAAAGCAGAGGG + Intergenic
1194265004 X:91743102-91743124 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1194327652 X:92540294-92540316 CTCTGCCTGTGGAAAGAGGAGGG - Intronic
1194338652 X:92682049-92682071 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic
1196232669 X:113242074-113242096 TTCTGACTGTGGAGAACAGATGG + Intergenic
1198676551 X:139137439-139137461 AGCTGCCTCTGGAGAGTGGATGG - Intronic
1198697180 X:139354682-139354704 CTCTGCCTGTGGAAATTAGAAGG - Intergenic
1198788237 X:140314141-140314163 CTCTGCCTTTGGAAAGGAGAAGG + Intergenic
1199005780 X:142694127-142694149 CTCTGCCTATGGAAAGGAGAGGG + Intergenic
1199334376 X:146600976-146600998 CCCTGCTTGAGGAGAGGAGAGGG - Intergenic
1199685262 X:150259796-150259818 CTCTGCATGAGGATAGCAGAAGG - Intergenic
1200073094 X:153538549-153538571 AACTGCCTGTGGAGCCCAGAGGG - Intronic
1200088521 X:153623628-153623650 CTCTGGCTCTGGAGAGCTGAGGG - Intergenic
1200116398 X:153771554-153771576 GGCTGCCTGTGGTGTGCTGACGG + Exonic
1200215237 X:154365367-154365389 CGCTGGCAGTGGGGAGCTGAAGG - Exonic
1200364222 X:155644577-155644599 CTCTGCCTATGGAAAGGAGAGGG - Intronic
1200427232 Y:3034904-3034926 CTCTGCCTATGGAAAGCACAGGG - Intergenic
1200582154 Y:4963548-4963570 CTCTGCCTTTGGAAAGGAGAGGG - Intergenic
1200592000 Y:5087136-5087158 CTCTGCCTTTGGAAAGTAGAGGG - Intronic
1200636363 Y:5659512-5659534 CTCTGCCTGTGGAAAGAGGAGGG - Intronic
1200647043 Y:5798831-5798853 CTCTGCCTGTGGAAAGGGGAGGG - Intergenic