ID: 1183985637

View in Genome Browser
Species Human (GRCh38)
Location 22:41568771-41568793
Sequence CAGAGAGACCAGAGAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183985637_1183985639 -1 Left 1183985637 22:41568771-41568793 CCTTCTGCTCTCTGGTCTCTCTG No data
Right 1183985639 22:41568793-41568815 GCCACCTGAGAGCCCATCATGGG No data
1183985637_1183985646 19 Left 1183985637 22:41568771-41568793 CCTTCTGCTCTCTGGTCTCTCTG No data
Right 1183985646 22:41568813-41568835 GGGGAGGCTGCCCTCGACCCTGG 0: 1
1: 0
2: 0
3: 18
4: 281
1183985637_1183985643 3 Left 1183985637 22:41568771-41568793 CCTTCTGCTCTCTGGTCTCTCTG No data
Right 1183985643 22:41568797-41568819 CCTGAGAGCCCATCATGGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 181
1183985637_1183985641 0 Left 1183985637 22:41568771-41568793 CCTTCTGCTCTCTGGTCTCTCTG No data
Right 1183985641 22:41568794-41568816 CCACCTGAGAGCCCATCATGGGG 0: 1
1: 0
2: 1
3: 8
4: 135
1183985637_1183985638 -2 Left 1183985637 22:41568771-41568793 CCTTCTGCTCTCTGGTCTCTCTG No data
Right 1183985638 22:41568792-41568814 TGCCACCTGAGAGCCCATCATGG 0: 1
1: 0
2: 1
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183985637 Original CRISPR CAGAGAGACCAGAGAGCAGA AGG (reversed) Intronic
No off target data available for this crispr