ID: 1183985638

View in Genome Browser
Species Human (GRCh38)
Location 22:41568792-41568814
Sequence TGCCACCTGAGAGCCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183985635_1183985638 2 Left 1183985635 22:41568767-41568789 CCTCCCTTCTGCTCTCTGGTCTC 0: 1
1: 0
2: 2
3: 78
4: 638
Right 1183985638 22:41568792-41568814 TGCCACCTGAGAGCCCATCATGG 0: 1
1: 0
2: 1
3: 15
4: 175
1183985633_1183985638 26 Left 1183985633 22:41568743-41568765 CCTGTCTTTGCTGTGGCTCTTCT 0: 1
1: 0
2: 3
3: 38
4: 345
Right 1183985638 22:41568792-41568814 TGCCACCTGAGAGCCCATCATGG 0: 1
1: 0
2: 1
3: 15
4: 175
1183985637_1183985638 -2 Left 1183985637 22:41568771-41568793 CCTTCTGCTCTCTGGTCTCTCTG No data
Right 1183985638 22:41568792-41568814 TGCCACCTGAGAGCCCATCATGG 0: 1
1: 0
2: 1
3: 15
4: 175
1183985636_1183985638 -1 Left 1183985636 22:41568770-41568792 CCCTTCTGCTCTCTGGTCTCTCT 0: 1
1: 0
2: 12
3: 96
4: 824
Right 1183985638 22:41568792-41568814 TGCCACCTGAGAGCCCATCATGG 0: 1
1: 0
2: 1
3: 15
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183985638 Original CRISPR TGCCACCTGAGAGCCCATCA TGG Intronic
900506842 1:3033617-3033639 TGCCACATGAGAGCCCAGGAGGG + Intergenic
900915517 1:5635532-5635554 TGCCCCCTGAGATCCCAGCTGGG + Intergenic
901504036 1:9672993-9673015 GGCCATCTGAGAGCAGATCAGGG - Intronic
902545916 1:17190330-17190352 AGCCCCCTGAGTCCCCATCAGGG - Intergenic
905181667 1:36171121-36171143 TGGAACCAGAGAGCCCCTCAGGG + Exonic
905496607 1:38394005-38394027 TCCCATCTGACAGTCCATCAGGG - Intergenic
905505624 1:38476738-38476760 TGCAGCCTGAGAGCCCTCCACGG + Intergenic
906477822 1:46181650-46181672 TGCCACCCCAGCACCCATCATGG - Intronic
911019926 1:93375812-93375834 TGCCACCTGAGAACCAAGCCTGG - Intergenic
916666162 1:166969504-166969526 TGGCACATCAGAGCCCATCTGGG - Intronic
918234137 1:182562165-182562187 TGCCTCCTGAGGCCCCATCCTGG + Intergenic
920186029 1:204160025-204160047 TGGCACCTGAGAGGAAATCAGGG - Intronic
920674104 1:208027117-208027139 TGTCCCCTGAGACCCCATCCTGG - Exonic
922192147 1:223328790-223328812 TGGCACCTCAGAATCCATCAGGG + Intronic
924300742 1:242635303-242635325 TTCCCCCTGAGAGCCCAGCAAGG + Intergenic
924609033 1:245558535-245558557 TGCCCACTTAGAGCCCAGCATGG - Intronic
1063501900 10:6563035-6563057 TGGCAGCTGAGAGCCAACCAAGG - Intronic
1064128352 10:12684926-12684948 TGCCTCCTGAGAGTTCAACAAGG + Intronic
1065763708 10:29007484-29007506 AGCCACCTGAGAGCTCGGCATGG + Intergenic
1069586186 10:69604239-69604261 TGCCACAACAGAGCCCATCCTGG + Intergenic
1069990009 10:72309406-72309428 TGGCAACTGGGAGCCCATCATGG - Intergenic
1070774978 10:79104160-79104182 TCCCACCTGAGACCCCAGGATGG + Intronic
1076617435 10:131765250-131765272 TGCCACCAAAGAGCCAAGCAGGG + Intergenic
1077468310 11:2744320-2744342 TGCAGCCAGTGAGCCCATCAGGG - Intronic
1078619381 11:12893363-12893385 AGCCACCTGCGAGCCCCTCCCGG + Intronic
1078859508 11:15234225-15234247 TCCCAGCTCAGACCCCATCAGGG - Intronic
1079278038 11:19059936-19059958 TGCCAACTCACAGCCCTTCAGGG - Intronic
1082274763 11:50209348-50209370 ATCCACCTAAGTGCCCATCAAGG + Intergenic
1083739317 11:64700101-64700123 TGCCACCTCAGTCCCCTTCAGGG + Intronic
1083749725 11:64754421-64754443 GGCCCCCAGAGAGCCCAGCACGG + Intronic
1085449585 11:76623876-76623898 TGGACCCTGAGAGCCCATCGTGG + Intergenic
1086342196 11:85857839-85857861 GGCCACCTCATAGCCCTTCATGG - Intronic
1089847251 11:121468068-121468090 TGACATCTGAGAGCACCTCAAGG + Intronic
1093718733 12:22413658-22413680 GGCCACCTGAGAGTCCACCATGG + Intronic
1099467118 12:83001345-83001367 TTCCACCTTAGGGCCCAGCACGG + Intronic
1100177035 12:92042649-92042671 ACCCACCTGATATCCCATCAAGG - Intronic
1100254058 12:92863486-92863508 TGCCAGCTGGGAGCTCATCTGGG - Intronic
1105061123 12:133151939-133151961 TGGCACCTCACAGCCCATCTGGG - Intronic
1105825099 13:24115415-24115437 TGCCACCTGTCAGATCATCAGGG + Intronic
1108255883 13:48610967-48610989 TGGCACCTGTGAACCCATCCAGG - Intergenic
1110553059 13:76828769-76828791 TGCTACCTGAAATGCCATCATGG + Intergenic
1113434898 13:110283716-110283738 TGCCATCTGTGAGCTCATCTGGG + Intronic
1113755174 13:112806072-112806094 TGGCACCTGACTGCCCACCACGG - Intronic
1115156784 14:30349905-30349927 TACCACCTGAGAGCACTTCTTGG + Intergenic
1118478803 14:66143561-66143583 GGCCACCTGAGAGCCATACAGGG + Intergenic
1118720927 14:68593346-68593368 GCCCACCAGAGAGCCCATCATGG - Intronic
1121000793 14:90451007-90451029 TGCCCTCTGAGAGCCTATCTTGG + Intergenic
1122004307 14:98689237-98689259 TGGCCCCTGTGATCCCATCAAGG - Intergenic
1123937288 15:25200117-25200139 GGCCACCTGAGGGGCCAACAGGG + Intergenic
1124376100 15:29129772-29129794 TTCCACCTCAGAGGGCATCAGGG + Intronic
1124661040 15:31551198-31551220 AGCCTCCGGAGACCCCATCATGG + Intronic
1128158947 15:65410610-65410632 TGCCTCCTGAGAGCCCCCTAAGG + Intronic
1129869481 15:78931534-78931556 TGCCAGCTGAGAAGCCGTCAAGG + Intronic
1130889866 15:88124540-88124562 TTCCACCTGAGAAAACATCAGGG - Intronic
1131152241 15:90054370-90054392 TCACACCTGGGAGCCCCTCATGG - Intronic
1132142281 15:99405835-99405857 GGGGACCTGAGAGACCATCACGG - Intergenic
1133583871 16:7172725-7172747 TGCCACCTGAGCCCCCATGTAGG - Intronic
1135776764 16:25263342-25263364 TGCCTCCTGAAAGCTCCTCAGGG + Intergenic
1136743749 16:32564312-32564334 GGGCACTTGAGAGCCCATCAAGG + Intergenic
1137446409 16:48535152-48535174 AGGGACCTGAGAGCCCAGCAGGG - Intergenic
1139474472 16:67195969-67195991 TACCTCCTTTGAGCCCATCAAGG + Exonic
1141279186 16:82615169-82615191 TGACACCTGAGTGCTCACCAAGG + Intergenic
1142345504 16:89551366-89551388 TCACACCTGAGAACCAATCACGG - Intronic
1203025850 16_KI270728v1_random:510921-510943 GGGCACTTGAGAGCCCATCAAGG - Intergenic
1203045871 16_KI270728v1_random:823510-823532 GGGCACTTGAGAGCCCATCAAGG + Intergenic
1144210965 17:13015087-13015109 TGCCACCCTAAAGCCCTTCATGG - Intronic
1144515197 17:15912577-15912599 TGTCACCTGACAGCCCAAGAGGG - Intergenic
1144672107 17:17138700-17138722 AGGCAGCTGAGAACCCATCAGGG - Intronic
1145209691 17:21004025-21004047 TCCCACCTGAGCACCCATCGAGG + Intronic
1145927030 17:28655669-28655691 TTCCACCTGCTAGGCCATCATGG - Intronic
1149857913 17:60099572-60099594 TCCCACCTGATAGCACATCCAGG + Intergenic
1150808394 17:68337098-68337120 TCCCAGCAGAGAACCCATCAGGG - Intronic
1152566007 17:81100755-81100777 GGCCACCTGAGAGCCAGGCAGGG - Intronic
1155762777 18:29588373-29588395 TGCCACCTGAGAGCCACACAGGG + Intergenic
1157489263 18:48110882-48110904 TTCCACCTGAGAGCCCCTTCAGG - Intronic
1157507008 18:48233882-48233904 TGCCACCTCAGAGCCTCTCCAGG + Intronic
1160496877 18:79381031-79381053 TGGCACCTGCGAGGCCACCAGGG + Intergenic
1166932421 19:46309059-46309081 TGCGTCCTGAGGGCCCATCAGGG - Intronic
1168207960 19:54866185-54866207 TGCCAATTGAGAGCACTTCATGG + Intronic
925599060 2:5589471-5589493 GGCCACCTGAGTGCCCTCCACGG + Intergenic
927855462 2:26524921-26524943 GGGCACCTGAGAGCCCCTGAAGG - Intronic
928347243 2:30511612-30511634 AGCCATCTGAGAGCTCATCCAGG + Intronic
930005439 2:46892586-46892608 AGACACCTGAGACCCCCTCATGG + Intergenic
930306641 2:49683126-49683148 ATCAACCTGAGTGCCCATCAAGG + Intergenic
931215071 2:60234477-60234499 TGCCATTTGAGGGACCATCATGG + Intergenic
932560319 2:72862315-72862337 AGCCACCTGAGTGCCCCTCTTGG + Intergenic
934559793 2:95307122-95307144 TCCCACCTGTGAGCCCCACAAGG - Intronic
934791129 2:97061149-97061171 TGACAGCTGAAAGCCCAACATGG + Intergenic
934815317 2:97321381-97321403 TGACAGCTGAAAGCCCAACATGG - Intergenic
934822378 2:97387102-97387124 TGACAGCTGAAAGCCCAACATGG + Intergenic
935211996 2:100946291-100946313 TGTCACCTGATGTCCCATCAAGG + Intronic
936944567 2:117918778-117918800 TGCCACCTGCGAGCGCTTCTTGG - Exonic
938970276 2:136425145-136425167 AGCCACCTGTGAGGCCATCTGGG - Intergenic
939755286 2:146102238-146102260 TGGGACCTGAGCTCCCATCATGG + Intergenic
940304964 2:152215862-152215884 AGCCAACTGAGGGCCAATCAGGG - Intergenic
943513955 2:188862165-188862187 AGCCACCTGAGAGCCACACAGGG + Intergenic
948618945 2:239221299-239221321 TGCCACCTGACACCACATCAGGG + Intronic
1169050815 20:2576429-2576451 AACCACCTGACAGCCCCTCAAGG - Intronic
1170552629 20:17490552-17490574 TGCCGCCTGAGACCCCGGCAAGG - Intergenic
1170569669 20:17625660-17625682 TCCCACCTGAGGCCCCATCCAGG + Intronic
1170807600 20:19646690-19646712 TGGCCTCTGAGAGCCCCTCATGG + Intronic
1171344210 20:24453213-24453235 TGCCACCTGAAACCCCAGGATGG - Intergenic
1174103331 20:48144029-48144051 TGGAACCTGCGGGCCCATCATGG + Intergenic
1175751279 20:61499670-61499692 TGCCACCTGCCATCCCATGAGGG + Intronic
1177682270 21:24386854-24386876 AGCCACCTGAGAGACCAACTGGG - Intergenic
1179508062 21:41854919-41854941 TGCCACGTCAGAGGCCATAAGGG + Intronic
1179955673 21:44736957-44736979 TCCCTCCTGAGAGCCCTTCTGGG + Intergenic
1181084898 22:20435409-20435431 TGCCACCTGGCAGCCAATCCTGG + Intronic
1181614531 22:24044043-24044065 TGCCACCTCAGTGGGCATCAAGG - Intronic
1181788243 22:25243186-25243208 TGCCTCCTGTGAGCCTGTCATGG - Intergenic
1181819981 22:25468199-25468221 TGCCTCCTGTGAGCCTGTCATGG - Intergenic
1183772710 22:39940305-39940327 TGTCATCTGAGAGCCCAAAATGG + Intronic
1183985638 22:41568792-41568814 TGCCACCTGAGAGCCCATCATGG + Intronic
1184544214 22:45155217-45155239 TGCCACCTAAGATCATATCATGG + Intergenic
1184934954 22:47714383-47714405 TGCCACCTCAGGGCCCCTCAGGG + Intergenic
1185038111 22:48490030-48490052 TGCCTCCTGAGCGCGCATCTCGG - Intronic
1185086928 22:48745947-48745969 TGCCACCTGTGAGACCCGCAGGG + Intronic
1185337114 22:50275642-50275664 AGGTACCTGAGAGCCCCTCAGGG - Exonic
949645400 3:6087883-6087905 TGCCATCTAAGAGTCCTTCAGGG + Intergenic
950628742 3:14267362-14267384 TGCCCCATGAGAGGCCACCATGG - Intergenic
950652330 3:14415083-14415105 GGGCACATGAGAGGCCATCAAGG - Intronic
951745910 3:25977243-25977265 TTCCACCAGAGACCTCATCATGG + Intergenic
954196130 3:48998293-48998315 GGCCAGCTGCGAGCCCATCATGG - Intronic
954762944 3:52890198-52890220 TTCCAGCTGTGAGCCCCTCAAGG + Intronic
960480401 3:118180865-118180887 TGCTAGCAGAGATCCCATCATGG - Intergenic
960970241 3:123134447-123134469 TTCCTGCTGAGAGCCCAGCAGGG - Intronic
962267342 3:133953359-133953381 TGCCACCACAGCGCCCATCTTGG - Intronic
962710194 3:138079789-138079811 TGCCATCAAAGAGCTCATCATGG - Intronic
963762694 3:149300170-149300192 TTCGACCTGCTAGCCCATCATGG - Intergenic
965950978 3:174308043-174308065 TGGCTCCTGAGACCCCAGCAAGG + Intergenic
967435993 3:189446872-189446894 GGCCCCCTGTGTGCCCATCATGG - Intergenic
967848986 3:194068253-194068275 GGCAACCTAAGAGTCCATCATGG + Intergenic
968849894 4:3072169-3072191 TCCCACCTGAGAGCTCAGCCGGG + Intergenic
969411266 4:7029923-7029945 TGCCACCTGAGAAGGCCTCAAGG - Intronic
976379999 4:84388505-84388527 TGCCATCTGAGAGGCCATAGTGG - Intergenic
981175229 4:141674973-141674995 TGCCAGCTAAGAGCCCAGCCTGG - Intronic
989011332 5:36876391-36876413 GGCGACCTGAGAGCCCGTCCGGG + Intergenic
994956635 5:106541406-106541428 TGCCACCGCTGAGCCAATCATGG - Intergenic
995934072 5:117487000-117487022 GGTAACCTGAGAGCCCAGCAAGG - Intergenic
996339248 5:122417861-122417883 TCCCTCCTGAGAACCCCTCAAGG - Intronic
996820195 5:127618000-127618022 TGAAGCCTGAGACCCCATCACGG - Intergenic
997372825 5:133372919-133372941 TCCCACCTGTGAGAACATCATGG + Intronic
997615726 5:135244944-135244966 AGCCACCTGTTTGCCCATCAGGG - Intronic
998377704 5:141702293-141702315 TGCCGCTTGAGATGCCATCAGGG + Intergenic
999121337 5:149211805-149211827 TCCCACCTCAGGGCCCTTCAGGG - Intronic
999198601 5:149800254-149800276 TTCCACCTAACAGCCCATCTTGG + Intronic
1006388372 6:33744902-33744924 GGGCACTTGAGAGCCCATCTGGG + Intronic
1007266968 6:40603886-40603908 TCCCTCCTGGGAGCCCCTCATGG + Intergenic
1009997435 6:70911928-70911950 TCCAAGCTGAGAGCCAATCAAGG - Intronic
1011329569 6:86188540-86188562 TGCTACTTGAGAGGCCACCATGG - Intergenic
1016426467 6:143941468-143941490 TGCCAGCTGAGAACACATGAGGG + Exonic
1017274596 6:152551517-152551539 TGGTCCCTGAGAGTCCATCAGGG + Intronic
1021890429 7:25180924-25180946 CGCCACCTGCCACCCCATCAAGG + Intergenic
1023263733 7:38383453-38383475 TGCCAACGGAGAGCCCTTAAAGG - Intergenic
1023622236 7:42085731-42085753 TGCTGCCTGAGAGCTCCTCAGGG - Intronic
1025215843 7:57055504-57055526 ATCCACCTAAGTGCCCATCAAGG + Intergenic
1025655536 7:63515198-63515220 ATCCACCTAAGTGCCCATCAAGG - Intergenic
1026834241 7:73627537-73627559 TGCCACCTGAGAGCTGGCCACGG - Intergenic
1029041392 7:97580111-97580133 TCCCACATGTGAGCCCACCAGGG + Intergenic
1030687555 7:112502795-112502817 TGCCACCTGGGACCTCATCCAGG + Intergenic
1034416708 7:150969092-150969114 TGCCCCCAGAGAGCCCTTCTGGG - Intronic
1034919886 7:155071033-155071055 CGCCACCAGAAAGCCCAGCAAGG - Exonic
1035309847 7:157959924-157959946 AGCAAGCTGAGTGCCCATCAGGG + Intronic
1035534677 8:382005-382027 TGCCCCCTGAGAGGCCAGCGGGG + Intergenic
1035898946 8:3436157-3436179 TACCACCTGGGAGAACATCAAGG + Intronic
1037772535 8:21810943-21810965 AGCCACCTGACCTCCCATCAGGG + Intronic
1037823409 8:22146813-22146835 TGACACCTGAGAGCCGGTTATGG + Exonic
1039291757 8:36102908-36102930 TGCCACATGATAACCTATCAGGG + Intergenic
1049428862 8:142549997-142550019 TGCCAGCTGAGAGCCCTTCCAGG + Intergenic
1049674225 8:143882700-143882722 TGCCACCTGAGTGCCAGTCTTGG + Intergenic
1050583396 9:7084931-7084953 TGCCATGAGAGTGCCCATCAGGG + Intergenic
1054317385 9:63608147-63608169 TGCCAACTCAGGACCCATCAGGG + Intergenic
1054907267 9:70421845-70421867 TGGCAGCTGAGAGGCCATCCAGG - Intergenic
1056743647 9:89282044-89282066 TGCCACGTGAGAACGCAGCAAGG + Intergenic
1056806782 9:89735271-89735293 ATCCACCTGTGAGCCCAGCAGGG + Intergenic
1057233503 9:93339880-93339902 AGCCTCCTGAGAGCCAAGCATGG + Intronic
1057252288 9:93513765-93513787 GGCCTCCTGAGAGCCAAGCATGG - Intronic
1057306014 9:93912401-93912423 AGCCACCTCAGAGGCCAGCACGG + Intergenic
1058673056 9:107376994-107377016 ATCAACCTAAGAGCCCATCAAGG + Intergenic
1060009669 9:120032451-120032473 TGGCAACTGAGAGCCCAGCTGGG - Intergenic
1060523192 9:124305968-124305990 TGCCACCTGAAAACCCATAATGG - Intronic
1062166852 9:135112253-135112275 TCCCAACTGAGAGCCCCACAGGG - Intronic
1062387535 9:136318948-136318970 TGCCAACAGTGAGCCCAGCATGG + Intergenic
1062462634 9:136668281-136668303 CACCTCCTGAGAGCCCCTCATGG - Exonic
1203769794 EBV:43765-43787 TGCCATCTACGAGGCCATCAAGG - Intergenic
1185467156 X:361887-361909 AGGCACCTGAGAGCCCAGCCAGG + Intronic
1186635192 X:11396301-11396323 TGCCACCTAAGAGACCATCAGGG - Intronic
1191575816 X:62704330-62704352 TGACACCTCAGAGCCCATTGAGG - Intergenic
1197739903 X:129882361-129882383 TTCCAGATGAGAGCCCAGCATGG - Intergenic
1199133255 X:144219883-144219905 TGCCACCTAAGAGCCAAAAAGGG - Intergenic
1199709111 X:150455870-150455892 TGGCACTTGAGAGCTCATTAAGG + Intronic
1200178831 X:154137805-154137827 TCCCAGCTGAGAGTCCATCTGGG + Intergenic