ID: 1183985639

View in Genome Browser
Species Human (GRCh38)
Location 22:41568793-41568815
Sequence GCCACCTGAGAGCCCATCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183985636_1183985639 0 Left 1183985636 22:41568770-41568792 CCCTTCTGCTCTCTGGTCTCTCT 0: 1
1: 0
2: 12
3: 96
4: 824
Right 1183985639 22:41568793-41568815 GCCACCTGAGAGCCCATCATGGG No data
1183985637_1183985639 -1 Left 1183985637 22:41568771-41568793 CCTTCTGCTCTCTGGTCTCTCTG No data
Right 1183985639 22:41568793-41568815 GCCACCTGAGAGCCCATCATGGG No data
1183985633_1183985639 27 Left 1183985633 22:41568743-41568765 CCTGTCTTTGCTGTGGCTCTTCT 0: 1
1: 0
2: 3
3: 38
4: 345
Right 1183985639 22:41568793-41568815 GCCACCTGAGAGCCCATCATGGG No data
1183985635_1183985639 3 Left 1183985635 22:41568767-41568789 CCTCCCTTCTGCTCTCTGGTCTC 0: 1
1: 0
2: 2
3: 78
4: 638
Right 1183985639 22:41568793-41568815 GCCACCTGAGAGCCCATCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183985639 Original CRISPR GCCACCTGAGAGCCCATCAT GGG Intronic
No off target data available for this crispr