ID: 1183985641

View in Genome Browser
Species Human (GRCh38)
Location 22:41568794-41568816
Sequence CCACCTGAGAGCCCATCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183985637_1183985641 0 Left 1183985637 22:41568771-41568793 CCTTCTGCTCTCTGGTCTCTCTG No data
Right 1183985641 22:41568794-41568816 CCACCTGAGAGCCCATCATGGGG 0: 1
1: 0
2: 1
3: 8
4: 135
1183985636_1183985641 1 Left 1183985636 22:41568770-41568792 CCCTTCTGCTCTCTGGTCTCTCT 0: 1
1: 0
2: 12
3: 96
4: 824
Right 1183985641 22:41568794-41568816 CCACCTGAGAGCCCATCATGGGG 0: 1
1: 0
2: 1
3: 8
4: 135
1183985633_1183985641 28 Left 1183985633 22:41568743-41568765 CCTGTCTTTGCTGTGGCTCTTCT 0: 1
1: 0
2: 3
3: 38
4: 345
Right 1183985641 22:41568794-41568816 CCACCTGAGAGCCCATCATGGGG 0: 1
1: 0
2: 1
3: 8
4: 135
1183985635_1183985641 4 Left 1183985635 22:41568767-41568789 CCTCCCTTCTGCTCTCTGGTCTC 0: 1
1: 0
2: 2
3: 78
4: 638
Right 1183985641 22:41568794-41568816 CCACCTGAGAGCCCATCATGGGG 0: 1
1: 0
2: 1
3: 8
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183985641 Original CRISPR CCACCTGAGAGCCCATCATG GGG Intronic
901744645 1:11364192-11364214 CCTGCCCAGAGCCCATCATGTGG + Intergenic
904266543 1:29321559-29321581 CCACTAAAGCGCCCATCATGGGG + Intronic
913485847 1:119332202-119332224 CCAGCTGAGAAACCATCCTGTGG - Intergenic
914345647 1:146796251-146796273 CCACCTGAGGGCCCAGCCTGTGG - Intergenic
916472399 1:165137216-165137238 CAACCTGAGTGCCCAGAATGAGG + Intergenic
917097566 1:171414259-171414281 TCACCTGAGAGCACAGCAGGAGG - Intergenic
919793549 1:201307694-201307716 CTACATGAGAGCCCCTCATCTGG + Intronic
920674102 1:208027115-208027137 TCCCCTGAGACCCCATCCTGGGG - Exonic
922807128 1:228396151-228396173 GGACCTGAGAGCCCAGCATAAGG + Intronic
924707883 1:246513175-246513197 CCATCTGTGACCCCACCATGTGG + Intergenic
924772699 1:247090421-247090443 CCATGTGTGAGGCCATCATGGGG - Intergenic
1062805340 10:415632-415654 CTACCTGGGTTCCCATCATGCGG + Intronic
1065965805 10:30769501-30769523 CCACGTGGGAGCCCACCATGAGG + Intergenic
1068191587 10:53659566-53659588 TCACCTGAGAGCACAGCAGGAGG + Intergenic
1070788858 10:79178000-79178022 CCTCCTAAGACCCCACCATGTGG - Intronic
1073609452 10:104928753-104928775 CCAGCTCAGACCCCAACATGTGG - Intronic
1076051976 10:127342361-127342383 CAACCTCAGAGCCCACAATGGGG - Intronic
1076736101 10:132459739-132459761 CCACCTGTGAGCCCACAGTGTGG + Intergenic
1079107447 11:17580539-17580561 CCTGCTGTGTGCCCATCATGGGG - Intronic
1083767494 11:64848869-64848891 GGACCTGAGAACCCAGCATGAGG + Intergenic
1085449587 11:76623878-76623900 GACCCTGAGAGCCCATCGTGGGG + Intergenic
1086552546 11:88069331-88069353 CCACGTGGGAGCCCACCCTGGGG - Intergenic
1088901027 11:114117416-114117438 CCACCTAGGAGCCCGTCAAGTGG + Intronic
1090224944 11:125064025-125064047 CCACCTTGCAGCCCAACATGTGG - Intronic
1094396250 12:30008936-30008958 CCTCCAGAGAGCCTATCTTGTGG + Intergenic
1095552447 12:43458984-43459006 TCACCTGAGAGCACAGCAGGAGG + Intronic
1101259916 12:103018635-103018657 CCATCTGAGACCTCATCATCTGG + Intergenic
1103702210 12:122853765-122853787 CCACCTGGGAGCCCAGGACGAGG - Intronic
1104191702 12:126487744-126487766 ACACCTGGTAGCCCAGCATGTGG - Intergenic
1106126380 13:26903198-26903220 CCACCTGTGAGGCGAGCATGGGG + Intergenic
1106644029 13:31613874-31613896 CCAGCTGAGCTCCCATCTTGTGG + Intergenic
1121264867 14:92594804-92594826 AGACATGAGACCCCATCATGTGG - Intronic
1122551109 14:102550490-102550512 CAACCTGAGCACCCATCACGGGG - Intergenic
1125254326 15:37745342-37745364 CCACCTGAGTTTCCATCATGAGG - Intergenic
1126412405 15:48385820-48385842 CAAGCTGAGAGCCCATCTTAGGG + Intergenic
1126457572 15:48880631-48880653 CCATCTGAAGGCCCATCTTGGGG + Intronic
1127544324 15:59976214-59976236 GATCCTGAGAGCCCTTCATGAGG - Intergenic
1130380634 15:83369332-83369354 CCACATGTGAGGCCATCATCTGG - Intergenic
1131268459 15:90932525-90932547 CCGCCTCAGAGCCCATCGCGCGG + Exonic
1132463652 16:67834-67856 CCAGCTGAGAGGTCATCTTGAGG - Intronic
1135510481 16:23078589-23078611 CCACCACAGAACCCATGATGTGG + Intronic
1137677235 16:50309738-50309760 ACCCCTGAGAGCACAGCATGTGG + Intronic
1139988339 16:70919016-70919038 CCACCTGAGGGCCCAGCCTGTGG + Intronic
1141811995 16:86382190-86382212 CCACCTGCCAGGCCATCAGGTGG + Intergenic
1147242581 17:39100191-39100213 CCACCTGCCACCCCATCACGGGG + Intronic
1151804609 17:76397703-76397725 AGACCTGAGAGCCCATCTTCTGG + Intronic
1152657581 17:81527211-81527233 TCTCCTGAGTGGCCATCATGGGG - Intergenic
1153402039 18:4691906-4691928 TCACCTGAGAGCACAACAGGAGG + Intergenic
1160383738 18:78480785-78480807 CCACCTCAAAGCCCAGCACGAGG + Intergenic
1161018920 19:1998727-1998749 CCCCCTGGGAGGCCATCGTGTGG - Intronic
1161568853 19:5018953-5018975 CCACATGAGCGCCCATCAGCAGG - Intronic
1161606234 19:5216330-5216352 CCACCTGAGAGCTGAACATCCGG - Intronic
1161714273 19:5866586-5866608 TCACCTGAGAGGCCGGCATGGGG - Exonic
1163324498 19:16594451-16594473 CAACCTGAGAGGCCATGATTTGG + Intronic
1163690733 19:18736914-18736936 CCACCTGCCAGCCCTTCCTGGGG - Intronic
1164651147 19:29891797-29891819 CCACCTGTGAGCCCATCTCAGGG - Intergenic
1164762073 19:30735708-30735730 CCACCTGCCAGCCCTTCCTGAGG - Intergenic
1166997499 19:46726730-46726752 TCAGCTGGGAGCCCATCTTGGGG - Intronic
1167564965 19:50250455-50250477 CCACCTGAGTGTCCAATATGTGG + Intronic
929850873 2:45589246-45589268 CCTCTTGAGAGGCCTTCATGAGG + Intronic
929922819 2:46184670-46184692 CCTCCTGAGGGCCCCCCATGGGG - Intronic
930456021 2:51608193-51608215 CCACGTGAGACTGCATCATGTGG - Intergenic
933174766 2:79163284-79163306 TCACCTGAGAGCACAGCGTGGGG - Intergenic
936240664 2:110786093-110786115 CCAGCAGAGAGTCCTTCATGGGG + Intronic
937320149 2:120956194-120956216 CCAGCTGGGAGCACATCCTGTGG - Intronic
937789397 2:125943006-125943028 CCACGCAAGAGCCCACCATGTGG + Intergenic
942232683 2:173874511-173874533 CCACCAGAGGGCCCATCCTGGGG + Intergenic
942786381 2:179707000-179707022 CCCACTGATAGCACATCATGGGG - Intronic
947434243 2:230059196-230059218 CCATCTGGGAGCCCATGATGAGG + Exonic
1170437872 20:16349255-16349277 CCACCTGCTAGCCCACCATCAGG + Intronic
1170550188 20:17469825-17469847 ATACCTGAGAGCCCACCGTGAGG - Intronic
1174186689 20:48711225-48711247 ACAACAGAGAGCCCAACATGGGG - Intronic
1175864601 20:62168518-62168540 CCACCTGTGATCCCAGCATCAGG + Intronic
1177447758 21:21219733-21219755 CCTCCTGAAAGACCAGCATGAGG - Intronic
1177549138 21:22598077-22598099 CCACGTGGGAGCCCATGGTGGGG - Intergenic
1177826792 21:26093276-26093298 ACACCTGAGAGTCCACCCTGAGG + Intronic
1178925502 21:36771578-36771600 CCACATGAAAGCCCATCATGTGG + Intronic
1180115919 21:45704954-45704976 CCTCCACAGAGCCCATCTTGGGG + Intronic
1183772712 22:39940307-39940329 TCATCTGAGAGCCCAAAATGGGG + Intronic
1183935709 22:41260995-41261017 TCACCTGAGAGCACGTCATTTGG + Intronic
1183985641 22:41568794-41568816 CCACCTGAGAGCCCATCATGGGG + Intronic
1184530680 22:45053518-45053540 CCAGCTGAGAGCCCCTGATCTGG - Intergenic
949738613 3:7203490-7203512 CAACCTAAGAGCCCATCAATGGG - Intronic
950117815 3:10462827-10462849 CCAGCTCAGAGCCAATCAGGTGG - Intronic
951107460 3:18761690-18761712 CCACAAGAGAGCCCTTCGTGTGG - Intergenic
952351826 3:32546682-32546704 CCACCTAAGGGCCAATCAAGGGG + Intronic
953616988 3:44499975-44499997 CCACCAGAGAACCCATACTGGGG - Exonic
953625878 3:44570562-44570584 CCACCAGAGAACCCATACTGGGG + Exonic
954228520 3:49199013-49199035 CCACCTGTGAGGACAGCATGTGG - Exonic
955069875 3:55563452-55563474 CCAGTTGGGAGCCCATCCTGGGG - Intronic
958773250 3:98451273-98451295 TCACTTAAGAGTCCATCATGGGG + Intergenic
962040571 3:131703334-131703356 GCACCTGTGACCCCATCATAGGG - Intronic
962478749 3:135780317-135780339 CTCCCTGTGAGCCCCTCATGAGG + Intergenic
962651349 3:137496531-137496553 CAACCTAAGTGCCCATCAAGTGG - Intergenic
962710191 3:138079787-138079809 CCATCAAAGAGCTCATCATGGGG - Intronic
964273063 3:154979166-154979188 TCACCTGAGAGCACAGCAGGAGG + Intergenic
969983631 4:11184609-11184631 CAACATGAGGACCCATCATGAGG + Intergenic
981740733 4:147999253-147999275 TCACCTGAGAGCACAGCAGGAGG + Intronic
982362955 4:154542626-154542648 CAACCTAAGTGTCCATCATGAGG + Intronic
985337287 4:188910405-188910427 CCACCACAGGGCCCATCTTGTGG + Intergenic
987316261 5:16727518-16727540 CCTCGTGAGAACCCTTCATGGGG - Intronic
992564683 5:77985784-77985806 CCACGGGGGACCCCATCATGGGG + Intergenic
995719365 5:115113954-115113976 TCACCTGAGAGCACAGCAGGAGG + Intergenic
997211316 5:132078679-132078701 CCCACTGAGAACCCATGATGGGG + Intergenic
997473220 5:134128295-134128317 CCTCAGGAGAGCCCTTCATGAGG - Intronic
998748008 5:145283776-145283798 CCAGCTGAGAGCCCATTAGCTGG + Intergenic
1001668828 5:173456907-173456929 TCAGCTGAGAGCCCCTCTTGTGG + Intergenic
1002499961 5:179642026-179642048 CCAGCAGAGAGCCCATTCTGGGG + Intronic
1002502009 5:179652735-179652757 CCAGCAGAGAGCCCATTCTGGGG - Intergenic
1002762822 6:214948-214970 CCACCTGAGACCCCATCCCTAGG - Intergenic
1007342149 6:41198121-41198143 CCAGCTGGAAGCCCATCAAGGGG + Exonic
1007348298 6:41249616-41249638 CCAGCTGGAAGCCCATCAAGGGG - Intergenic
1010270406 6:73910275-73910297 CCATGTGGGAGCCCACCATGGGG - Intergenic
1010380032 6:75213916-75213938 CCACATGTGAGGCCACCATGTGG + Intergenic
1013542179 6:111121940-111121962 GCTGCTGAGAGCCCATCCTGGGG - Intronic
1014544575 6:122718639-122718661 CCACCTGAGAGTCTAAAATGGGG - Intronic
1018704014 6:166450154-166450176 CCACCAGGGAGACCACCATGGGG + Intronic
1019496674 7:1343822-1343844 ACCCCTGAGAGCCCAGCAGGAGG + Intergenic
1019521403 7:1462044-1462066 CCATCTGAGTCCCCATCCTGGGG - Intergenic
1021484916 7:21157282-21157304 CCACTCCAGAGCCCATCCTGAGG + Intergenic
1022045918 7:26622339-26622361 CCACCTGAGTGGCAGTCATGGGG + Intergenic
1023742206 7:43290772-43290794 CCACATGAGTGCCCATGGTGGGG + Intronic
1028112876 7:86963876-86963898 GAACCTGAGAGCCCCTCAAGTGG - Intronic
1029170232 7:98625190-98625212 CCTCCCCAGAACCCATCATGTGG + Intronic
1029941269 7:104482993-104483015 CCACCTGTGTCCACATCATGAGG - Intronic
1030172325 7:106616014-106616036 CCACATGAGAGGTCAACATGAGG + Intergenic
1033959023 7:146889951-146889973 GCACCTGAGAGCTCCTAATGAGG - Intronic
1034516136 7:151581438-151581460 CCACGTGAGAGCCAAACAAGAGG + Intronic
1037823411 8:22146815-22146837 ACACCTGAGAGCCGGTTATGGGG + Exonic
1040917283 8:52575466-52575488 CCACATGAGAGCACATGGTGGGG + Intergenic
1041705155 8:60838832-60838854 CCACCTGAGAGCCCCTTCTGAGG + Intronic
1041903572 8:63008170-63008192 CGACCTCAGAGCCCCTCCTGTGG + Intergenic
1044833823 8:96276757-96276779 CCAACTAAGATCCCACCATGGGG - Intronic
1046542080 8:115598561-115598583 ACACCTGAAATCCCAGCATGTGG - Intronic
1047651294 8:126925509-126925531 CCATCTGTGAGAGCATCATGCGG - Intergenic
1048339770 8:133529562-133529584 CTACCCTAGAGCCCACCATGGGG - Intronic
1050162584 9:2733809-2733831 CCTCCTGAGATCCCACCATGAGG - Intronic
1050417741 9:5433825-5433847 CTGCCTGAGCGCCCATCATCTGG + Intronic
1050917928 9:11161323-11161345 CCATATGAGAGCTCATCATATGG - Intergenic
1059961179 9:119566037-119566059 TAACCTGAGAGCCATTCATGTGG - Intergenic
1060537317 9:124400525-124400547 CCACCAGAGAGTTCCTCATGGGG - Intronic
1060892199 9:127196000-127196022 CCACCTCAGAGGCCTGCATGGGG - Intronic
1061477003 9:130874673-130874695 CACCCTGAGATCCCAACATGGGG - Intronic
1061757885 9:132827864-132827886 CCAGCTCAGAGCCCAGCCTGTGG + Intronic
1185614507 X:1412713-1412735 CCAGGTGAGAGCCCATCGTCAGG - Exonic