ID: 1183985646

View in Genome Browser
Species Human (GRCh38)
Location 22:41568813-41568835
Sequence GGGGAGGCTGCCCTCGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 281}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183985636_1183985646 20 Left 1183985636 22:41568770-41568792 CCCTTCTGCTCTCTGGTCTCTCT 0: 1
1: 0
2: 12
3: 96
4: 824
Right 1183985646 22:41568813-41568835 GGGGAGGCTGCCCTCGACCCTGG 0: 1
1: 0
2: 0
3: 18
4: 281
1183985637_1183985646 19 Left 1183985637 22:41568771-41568793 CCTTCTGCTCTCTGGTCTCTCTG No data
Right 1183985646 22:41568813-41568835 GGGGAGGCTGCCCTCGACCCTGG 0: 1
1: 0
2: 0
3: 18
4: 281
1183985642_1183985646 -7 Left 1183985642 22:41568797-41568819 CCTGAGAGCCCATCATGGGGAGG 0: 1
1: 0
2: 1
3: 27
4: 192
Right 1183985646 22:41568813-41568835 GGGGAGGCTGCCCTCGACCCTGG 0: 1
1: 0
2: 0
3: 18
4: 281
1183985640_1183985646 -4 Left 1183985640 22:41568794-41568816 CCACCTGAGAGCCCATCATGGGG 0: 1
1: 0
2: 1
3: 13
4: 185
Right 1183985646 22:41568813-41568835 GGGGAGGCTGCCCTCGACCCTGG 0: 1
1: 0
2: 0
3: 18
4: 281
1183985635_1183985646 23 Left 1183985635 22:41568767-41568789 CCTCCCTTCTGCTCTCTGGTCTC 0: 1
1: 0
2: 2
3: 78
4: 638
Right 1183985646 22:41568813-41568835 GGGGAGGCTGCCCTCGACCCTGG 0: 1
1: 0
2: 0
3: 18
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183985646 Original CRISPR GGGGAGGCTGCCCTCGACCC TGG Intronic
900525975 1:3128880-3128902 GGGGAGCCTGCCCTGGCCCCAGG + Intronic
900610394 1:3542192-3542214 GGGAAGGCAGCCCTCGGGCCTGG + Intronic
900626093 1:3609306-3609328 GGGGACCCTGCGCTGGACCCTGG - Intronic
900868338 1:5284330-5284352 TGGGAGGATCACCTCGACCCAGG + Intergenic
901084676 1:6603137-6603159 GGCGAGGCCGCCCTCGGACCTGG - Intronic
903350119 1:22711821-22711843 GGGGAGAGGGCCCGCGACCCTGG - Intronic
904495180 1:30882492-30882514 GGGGAGGCTCCCCTGGGCCAGGG + Intronic
905767072 1:40610171-40610193 GGGGCGGCTGCCCTCCGCCAGGG - Intergenic
906805684 1:48776940-48776962 GGGGCGGCTCCCCAGGACCCAGG + Intronic
907305031 1:53508576-53508598 GGGGAGGGTGCCCGCAGCCCAGG - Intronic
907665272 1:56428960-56428982 GTGGAGGCTGCACTCCAGCCTGG - Intergenic
911333093 1:96548101-96548123 GGTGAGGGTGTCCTCCACCCTGG + Intergenic
912957348 1:114164856-114164878 GGAGAGGCTGGCCTTGACCTGGG + Intergenic
913144463 1:115976334-115976356 GGGCTGGATGCCCTGGACCCGGG - Intergenic
916604036 1:166323643-166323665 GGTGAGGCTGCACTGGACCTGGG + Intergenic
917028678 1:170666913-170666935 TGGGAGGCTGCCCTGGACTGGGG + Intronic
919824394 1:201493227-201493249 GGGGAGAATGACCTCCACCCTGG - Intronic
920310671 1:205046479-205046501 AGGAAGGCTGCCCTCCAGCCAGG - Intronic
1064380767 10:14839027-14839049 GGGGAGGCTGCAGTCGAGCTGGG + Intronic
1065637639 10:27746464-27746486 GGTGAGGCTGCCCTCGCCGCTGG + Intergenic
1066623810 10:37385533-37385555 GGGGAACCTCCCCACGACCCTGG + Intergenic
1066707882 10:38201190-38201212 GTGGAGGCTGCACTCCAGCCTGG + Intergenic
1067694257 10:48523864-48523886 GGGGAGGCTCCCCTTCACTCGGG - Intronic
1069483841 10:68808125-68808147 TGGGAGGATGCCCTGTACCCAGG - Intergenic
1072898507 10:99387731-99387753 AGCGAGGCTGCCCCCGAGCCTGG + Intronic
1073469733 10:103715102-103715124 GGGGTGGCTGCTCTGTACCCAGG + Intronic
1076140031 10:128071258-128071280 GGGGAGGCGGGCCTCTGCCCAGG - Intronic
1076701596 10:132275953-132275975 GTGGTGGCTGCCTTCCACCCTGG + Intronic
1077014530 11:393822-393844 GGGGAGGGTGCCCCAGTCCCTGG - Intronic
1077028107 11:450664-450686 GGCGAGGGTGCCCTCGACCTGGG + Intronic
1077106301 11:843970-843992 GGGGAAGCTGCCCAGGGCCCTGG - Intronic
1077263169 11:1634064-1634086 GGGGAGGCTGGGCTGGAACCGGG + Intergenic
1077339136 11:2018235-2018257 GGGGAGGCTGCACCCGCCTCAGG + Intergenic
1082811898 11:57483276-57483298 GGGGAGGCTGAGCGCGAGCCAGG - Intergenic
1082962011 11:58927503-58927525 GGGGAGGCTGGGGTCCACCCTGG - Intronic
1083408004 11:62472017-62472039 CAGGAGGCTGCCCATGACCCGGG + Intronic
1084062799 11:66687032-66687054 GGCGACGCTGCCCTGGGCCCTGG + Exonic
1084117327 11:67049886-67049908 GGGGTGGGTGCCCCCGACACCGG + Exonic
1084146254 11:67266817-67266839 GGAGAAGCTGCCCGCGGCCCCGG + Intronic
1084324025 11:68388708-68388730 TGTGAGGCTGCCCCAGACCCTGG + Intronic
1084419845 11:69054848-69054870 GGGGAGGCTGGCCCCCACCTGGG + Intronic
1085655345 11:78309562-78309584 TGGGAGGATCCCCTCAACCCTGG - Intronic
1090362501 11:126183352-126183374 GTGGAGGCTGCACTCTAACCTGG - Intergenic
1090636470 11:128693229-128693251 GGGGCGGCGCGCCTCGACCCTGG - Intronic
1090744433 11:129695080-129695102 GGGAAGTCTGCCCTCGTGCCTGG + Intergenic
1202822120 11_KI270721v1_random:73417-73439 GGGGAGGCTGCACCCGCCTCAGG + Intergenic
1091390945 12:125766-125788 GGGGAGGCAGCCCCTGCCCCCGG - Exonic
1097200505 12:57274264-57274286 GGGCAGGCTGGTCTCGACTCAGG - Intronic
1098213148 12:68187163-68187185 GGTGAGGCTGCACTCCAGCCTGG + Intergenic
1101997940 12:109538444-109538466 AGGGAGGCTGCCCTCCACGTGGG - Intergenic
1102787475 12:115616567-115616589 AGGGCTGCTGCCCTAGACCCAGG - Intergenic
1103318902 12:120078976-120078998 GGGGAGGCTGGGCTCTGCCCTGG + Intronic
1103414793 12:120736926-120736948 GGGGAGGGTGGGCTCGCCCCCGG + Intronic
1103537804 12:121645344-121645366 GTTGAGGCTGCCCTCTAGCCTGG - Intergenic
1104704678 12:130934201-130934223 AGGGTTGCTGCCCTCCACCCCGG + Intergenic
1104990031 12:132619704-132619726 GGAGTGGGTGGCCTCGACCCTGG - Exonic
1106098007 13:26666823-26666845 CGGGAGGCTGCACTCCAGCCTGG + Intronic
1108774534 13:53749457-53749479 GGGGAGGCTGTCCTGTACACTGG - Intergenic
1113481635 13:110625992-110626014 GGAGAGGCCGGGCTCGACCCAGG - Intronic
1113886253 13:113660094-113660116 GGGGAAACTGCCCTCTACCAAGG - Intergenic
1113938068 13:114005664-114005686 GAGGAGGCTGCCCCCGACTAGGG + Intronic
1115162855 14:30415216-30415238 GGAGAGGCTGCACACGAGCCTGG - Intergenic
1117409830 14:55440567-55440589 GGCGGGGCGGCCCTCGGCCCAGG + Exonic
1117530876 14:56659461-56659483 GGGTAGGTAGCTCTCGACCCTGG + Intronic
1118753847 14:68824225-68824247 GGGCAGGCTGGACTGGACCCAGG + Intergenic
1119718466 14:76875080-76875102 GGTGAGGCTGCCCCAGGCCCGGG + Intergenic
1121127653 14:91418089-91418111 GGGGAGGCTGCGCTCGGCGAGGG - Intergenic
1121685442 14:95832034-95832056 CGAGAGGCTGCCCTGGCCCCTGG + Intergenic
1121719804 14:96101351-96101373 GGGCAGGCTCCCCTCTTCCCTGG - Intergenic
1122154382 14:99741660-99741682 GTGGACGCTGCCCTGGTCCCTGG - Intronic
1122821190 14:104345992-104346014 AAGGAGGCAGCCCTGGACCCTGG - Intergenic
1123042385 14:105495719-105495741 GGAGAGGCTGCCCTGGCCCCAGG + Intronic
1125602572 15:40923581-40923603 GCGGAGGCTGCCCTAAACCCTGG + Intergenic
1128003283 15:64214704-64214726 GCTGAGGCTGCACTCCACCCTGG - Intronic
1129108656 15:73324933-73324955 GGTGAGGCAGCCCTGGGCCCTGG - Exonic
1129387904 15:75206122-75206144 GGGCAGGCTGTGCTCGAGCCCGG - Exonic
1129412009 15:75355477-75355499 GAGGGGGCAGCCCTGGACCCTGG - Exonic
1129540870 15:76346362-76346384 GGAGAGGCTGCCCAAGGCCCGGG - Intergenic
1130383941 15:83394932-83394954 GGGGAGGCTGCCTACAACACTGG + Intergenic
1130543730 15:84840111-84840133 GGGGAGGCTGCCCCCGAGAATGG + Exonic
1131254825 15:90855148-90855170 GGGGAGTTTGCCCTGGACACAGG + Intergenic
1131837997 15:96409462-96409484 GTGGCGGCTTCCCCCGACCCCGG + Intergenic
1132560363 16:590657-590679 GGGGACGGTGCCATGGACCCGGG + Intronic
1132607735 16:800548-800570 GGGGCAGCTGCCCTCGCCCCGGG + Intronic
1132728266 16:1348187-1348209 GGGGAGGCGGCCCTCGGCCTAGG + Exonic
1132760163 16:1505157-1505179 GATGAGGCTGCGCTCGGCCCTGG + Intronic
1133269338 16:4602804-4602826 GGGGAGGCTGGCCTTGGCCTGGG + Intergenic
1136288920 16:29260075-29260097 GGTGGGGCTGCCCTTGACCTTGG + Intergenic
1136989434 16:35143041-35143063 GGGGGGGCTGCACACGAGCCAGG - Intergenic
1137580629 16:49631568-49631590 GGGGAGGCAGCCCTGGCCACAGG - Intronic
1139529975 16:67538054-67538076 GGGGAGGCTGCCCCGCCCCCGGG + Intronic
1140480790 16:75261807-75261829 GAGGAGGCTGGGCTGGACCCAGG - Intronic
1141503914 16:84462474-84462496 GGGGAGCCTGGACTTGACCCTGG + Intronic
1141640139 16:85336068-85336090 GTGGAGGCTGCCCCTGCCCCGGG + Intergenic
1142094648 16:88232982-88233004 GGTGGGGCTGCCCTTGACCTTGG + Intergenic
1142291304 16:89194733-89194755 GGGGAAGCTGCCCACGTCCGGGG - Intronic
1142318492 16:89365430-89365452 TGGGAGGCTCCCCTGCACCCTGG - Intronic
1142805330 17:2368380-2368402 GGGGAAGCTCCCCTCGTCTCTGG - Intronic
1142854968 17:2724310-2724332 GGGGCGGCTGCCCTCCGACCCGG + Intergenic
1143057572 17:4173727-4173749 GGGGAGGCTGCCCAAGGCCTGGG + Intronic
1143513510 17:7408161-7408183 AGGGAGGCCCCCCTCGCCCCAGG - Exonic
1144292722 17:13841921-13841943 GGGGAGGTTGCACTCCAGCCTGG + Intergenic
1145817725 17:27807671-27807693 AGGGCGGCTGCCCACGCCCCTGG + Intronic
1147123768 17:38352134-38352156 GGAGAGGCGGCCCCCGAGCCAGG + Intergenic
1147952403 17:44114446-44114468 GGGGCTGCTGCCCTCCATCCTGG + Intronic
1149714004 17:58769521-58769543 TGGGAGGCTGCCCTGAGCCCGGG + Intronic
1149875519 17:60228729-60228751 TGGGAGGATGGCCTCAACCCAGG + Intronic
1150462346 17:65363153-65363175 GGGGAGGCTTCCCTCCAACGTGG - Intergenic
1151713000 17:75817428-75817450 GGGGAGTCTGGCCTGGCCCCTGG + Exonic
1151724138 17:75874961-75874983 GGCGAGGGTGCCCTGGACCGAGG - Exonic
1151849641 17:76682843-76682865 GAGGAGTCTTCCCTCGTCCCAGG + Intronic
1151932558 17:77241748-77241770 GGGGAGGCTGCCCCCGAGTTAGG + Intergenic
1152496338 17:80675399-80675421 GGGATGGCTGGCCTTGACCCGGG - Intronic
1152559028 17:81068668-81068690 GGGGAGGGTGCCCCCAAGCCTGG + Intronic
1154344462 18:13530779-13530801 TGGAAGCCTGCCCTCGAGCCAGG + Intronic
1157622133 18:49022811-49022833 GTGGAGGCTGCCCTGGCCCCTGG + Intergenic
1158599934 18:58848187-58848209 GCGGAGGTTGCCCTCCAGCCTGG - Intergenic
1160499824 18:79396120-79396142 GGGAAGACAGCCCTCGCCCCGGG - Intronic
1160708068 19:539156-539178 GGGCAGGCTGCCGTGGAGCCCGG + Intronic
1160840953 19:1146847-1146869 TGGGAGCCTCCCCGCGACCCTGG + Intronic
1160938791 19:1610352-1610374 GGGGAGGCTGGCCAGGCCCCTGG + Exonic
1161091725 19:2363607-2363629 GGGGAGGCAGGACTGGACCCTGG + Intergenic
1161388699 19:4010206-4010228 GAGGAGCCTGCCCTTGACACTGG - Intronic
1161540935 19:4851069-4851091 TGGGAGGCTCGCCTCAACCCAGG + Intronic
1162367508 19:10258363-10258385 GGTGGGGCTGCTCTGGACCCAGG + Intronic
1162479646 19:10920980-10921002 CGGGAGGCCGCCCTCGCCGCAGG + Intronic
1163540025 19:17902959-17902981 GGGGAGGCTGAAGGCGACCCGGG + Intergenic
1164223575 19:23220857-23220879 GCGGAGGCTGCACTCCAACCTGG + Intergenic
1166391141 19:42409597-42409619 GGGGAGACTGCCCTGCACCAAGG + Intronic
1168103978 19:54155578-54155600 GAGGGGGCAGCCCTCGCCCCCGG - Exonic
925417147 2:3678344-3678366 GCAGAGGCTCCCCTAGACCCCGG + Intronic
925778496 2:7357605-7357627 GAGGAGGCAGCCCTTGAGCCTGG - Intergenic
925905892 2:8539589-8539611 CAGGAGACTGCCCTGGACCCAGG + Intergenic
927710948 2:25325570-25325592 GGGGATGCTGACCTCGTCCTCGG + Intronic
927916123 2:26937804-26937826 TGGGAGGCTGCACTCCAGCCTGG - Intronic
932551360 2:72772678-72772700 GGGTAGGCTGGCCTGGTCCCTGG - Intronic
935590878 2:104844710-104844732 CGGTGGGCAGCCCTCGACCCGGG + Intergenic
936272141 2:111057101-111057123 GGGGAGTCTTCCCTAAACCCAGG - Intronic
937232382 2:120405731-120405753 GAGGAGGCTGCCCTCCAGCAGGG + Intergenic
941111242 2:161420579-161420601 GGGGAGGCTGCCCTGGTTCTCGG + Intronic
942454783 2:176130251-176130273 GGGGCGGCTGCTCTCGCCGCCGG - Exonic
943319715 2:186432397-186432419 GCAGAGGTTGCCCTAGACCCTGG - Intergenic
946410545 2:219513247-219513269 GGGGAGGAAGCCCTTGTCCCCGG - Intergenic
947636045 2:231681176-231681198 CCGGACGCTGCCCCCGACCCCGG + Intergenic
948131991 2:235607731-235607753 CAGGAGGCTGCCCTCGAGGCTGG - Intronic
948145249 2:235703601-235703623 GGGAAGGCTGCACTCCAGCCTGG - Intronic
948269185 2:236661169-236661191 GGGGAGGGTGCCCTAGACTCTGG + Intergenic
948404165 2:237705005-237705027 CGGGGGTCTGCCCTCCACCCAGG - Intronic
949057242 2:241934765-241934787 AGGGAAGCTGGCCTCCACCCGGG + Intergenic
1169145039 20:3246911-3246933 GGGGAGGATGACCTGAACCCAGG + Intergenic
1170408826 20:16066925-16066947 TGGGATGATGCCCTGGACCCTGG + Intergenic
1171245916 20:23609226-23609248 GGGGGTGCTGCCCTGGGCCCAGG + Intergenic
1171300017 20:24052028-24052050 GGGGAGGCTGCCACTCACCCTGG + Intergenic
1171369094 20:24649117-24649139 GGGGAGGCTTCCTTGGCCCCTGG - Intronic
1171994713 20:31722858-31722880 GGAGCGGCCGCCCTCGATCCGGG - Exonic
1172213496 20:33217378-33217400 GGAGGGGCTGCACTGGACCCTGG - Exonic
1172482070 20:35277220-35277242 GGGGGGGCTGCTCTCCATCCTGG - Intergenic
1174483332 20:50845882-50845904 GGGCAGGCTGCCCGCTGCCCAGG + Intronic
1175315537 20:58044226-58044248 TGGAAGGCTGCCCCCAACCCAGG - Intergenic
1176038193 20:63050455-63050477 GGGGAGACTGCCCTCGATAGAGG - Intergenic
1176038223 20:63050555-63050577 GGGGAGACTGCCCTCGATAGAGG - Intergenic
1176100294 20:63361519-63361541 GGGGAGGCTGCGCTGGGCCCCGG + Intronic
1177037019 21:16056888-16056910 GGGGATGCTGCCCACAACCGCGG + Intergenic
1179489884 21:41734369-41734391 GGGGAGGCTGCCCTTGCTCCAGG - Intergenic
1179545435 21:42110034-42110056 GGGAAGGAATCCCTCGACCCCGG - Intronic
1179779379 21:43689656-43689678 GGGAAAGCTTCCCTTGACCCTGG - Intronic
1179924775 21:44528430-44528452 GGTGAGGCAGCCCTGCACCCGGG - Exonic
1179977259 21:44875090-44875112 TGGGAGGCTGCCAGAGACCCCGG - Intergenic
1180594281 22:16963316-16963338 CGGGAGGCTTTCCTGGACCCAGG + Intronic
1181125417 22:20699020-20699042 GGAGAGAGTGACCTCGACCCTGG + Intergenic
1181498670 22:23302779-23302801 GTGGCGGCTGCCCTGGTCCCTGG - Intronic
1181510573 22:23387010-23387032 GGGGAGGCTGCCCGGCACTCGGG + Intergenic
1181529765 22:23510751-23510773 GGGGAGGCTGCCCTGACTCCCGG - Intergenic
1181802685 22:25357874-25357896 TGTGAGGCTGCCCTAGACCCTGG - Intronic
1181844930 22:25699383-25699405 GGGGCGCCTGTCCTCAACCCTGG + Intronic
1182430478 22:30295923-30295945 GGGGAGGGGGCCCTCCACCAGGG + Intronic
1183074063 22:35415639-35415661 GGGGATGCTGCCCTGGGCCTCGG - Intronic
1183380601 22:37488834-37488856 AGGGAGGCTGCCCTTCCCCCAGG + Intergenic
1183477499 22:38043502-38043524 GGGGAGAGTTCCCCCGACCCTGG + Intergenic
1183985646 22:41568813-41568835 GGGGAGGCTGCCCTCGACCCTGG + Intronic
1184252891 22:43270973-43270995 CGGGAGGCTGCCCCTCACCCAGG - Intronic
1184523056 22:45007319-45007341 GGGGCGGCTGCCGGTGACCCTGG - Intronic
1184602491 22:45551935-45551957 GGGGAGGCTGCCCTGCACAGGGG + Intronic
1184732375 22:46377931-46377953 GGGGAGGCTACCCAGGCCCCTGG + Intronic
1184762389 22:46551888-46551910 GGGAGGACTGCCCTCGATCCAGG - Intergenic
1185210546 22:49568448-49568470 TGGGAGTCTGCCCTGGGCCCAGG - Intronic
1185343174 22:50300476-50300498 GGTGAGTCTGGCCTTGACCCTGG - Intronic
950169845 3:10830867-10830889 GGGGAGGCTGCCTTATCCCCAGG - Intronic
952965722 3:38620119-38620141 GTTGAGGCTGCACTCCACCCTGG - Intronic
954100558 3:48369422-48369444 GTGGAGGCTGCACTCCAGCCTGG - Intergenic
954313790 3:49789875-49789897 GGGGAGGATGGCTTGGACCCAGG + Intergenic
954682191 3:52351740-52351762 AGGGAGGCTGCCCTGCCCCCTGG - Intronic
955075395 3:55608583-55608605 GAGGAGGCTGGCCTTGGCCCTGG - Intronic
956349921 3:68323174-68323196 GGGCTGTCTGCCCTAGACCCAGG + Intronic
960981365 3:123230093-123230115 AGGTAGGCTGCCCTCCAGCCTGG + Intronic
961591677 3:127985998-127986020 GTGGAGGCCGTCCTCAACCCTGG - Exonic
961629174 3:128283760-128283782 TGTGAGGCTGCCCTCACCCCTGG + Intronic
961650740 3:128415621-128415643 GGTGATGCTGCCCTCGCCGCCGG + Intergenic
961871471 3:129991653-129991675 GTGGAGGCTGCACTCCAGCCTGG + Intergenic
962259166 3:133892284-133892306 GGGGAGGGTGCTGTGGACCCAGG - Intronic
962847693 3:139286201-139286223 GGGGAGGCCGCCTTGGACTCTGG - Intronic
963131323 3:141860883-141860905 GGTGTGCCTGCCCTCAACCCGGG + Intergenic
968039528 3:195577141-195577163 GGTGATGCTGCACTCCACCCTGG + Intronic
968501076 4:950322-950344 GGGGGGGCTGGCCTCGGCCCAGG - Intronic
968556413 4:1248402-1248424 GGGGAGGCCGCCGGCGACCGTGG - Intronic
968582434 4:1401347-1401369 GGAGAGGCTGCCCTGCCCCCGGG + Intergenic
968757407 4:2423906-2423928 CGGGAGCCTGCCCTGGGCCCCGG - Intronic
968874494 4:3258169-3258191 GGGAAGGGTGCCCGCGGCCCTGG + Intronic
968880282 4:3295028-3295050 AGGGAGCCAGCCCTTGACCCTGG - Intronic
969573976 4:8025716-8025738 GGTGAGCCTGCCCTCGGCTCTGG + Intronic
969640743 4:8397068-8397090 GGGGAGCCTGTCCTCGGGCCGGG - Exonic
974485152 4:62494671-62494693 GGGCAGGCTGCCCAAGACCATGG + Intergenic
975917252 4:79340356-79340378 GTGGAGGCAGCCCTCCACCAAGG - Intergenic
976398636 4:84583421-84583443 GGGGAAGCTGCCCCGGCCCCAGG + Exonic
981014141 4:139955902-139955924 GGGGAGGCTGTGCTCCACCTAGG - Intronic
985005824 4:185535029-185535051 GGGGAGGAGGCACTCGAGCCTGG + Intronic
985495334 5:201097-201119 GGGGCAGCTGCCCTAGACACTGG - Exonic
985529166 5:423857-423879 GGGGAGGCTGCTCAGGGCCCAGG + Exonic
986334645 5:6744929-6744951 GTGGAGGAGGCCCTGGACCCAGG - Intronic
986858827 5:11903773-11903795 GAGGAGGCTGCGCCCGGCCCCGG + Intronic
987708975 5:21485674-21485696 GGCGGGGCTGCCCAAGACCCTGG - Intergenic
988750639 5:34188472-34188494 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
989067735 5:37481083-37481105 GGCGGGGCTGCCCAAGACCCTGG - Intronic
991735780 5:69630397-69630419 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991738908 5:69651685-69651707 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991759290 5:69904746-69904768 GGCGGGGCTGCCCAAGACCCTGG - Intergenic
991788046 5:70213376-70213398 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991790483 5:70231426-70231448 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991812274 5:70486036-70486058 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991815233 5:70506513-70506535 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991818369 5:70527802-70527824 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991838519 5:70779812-70779834 GGCGGGGCTGCCCAAGACCCTGG - Intergenic
991880493 5:71213740-71213762 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
991882930 5:71231761-71231783 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
992098417 5:73382502-73382524 GCAGAGGCTGCCCGCGTCCCTGG + Intergenic
994119920 5:96102098-96102120 GGGGTGGCTGCCCTCCTCCAGGG + Intergenic
994421096 5:99527019-99527041 GGCGGGGCTGCCCAAGACCCTGG - Intergenic
994485945 5:100387295-100387317 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
1001543731 5:172557181-172557203 GGGGAGACAGCCCTGGCCCCAGG - Intergenic
1002330309 5:178436314-178436336 GAGGAGGCTGCCCCCATCCCAGG + Intronic
1002523494 5:179803823-179803845 GGGGAGGCTGCCCAGGGCCAGGG - Intronic
1003409735 6:5851611-5851633 GGTGAGGCTGCCCTGGAGGCAGG - Intergenic
1005548711 6:26894777-26894799 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
1005830968 6:29670846-29670868 GAGGAGTCTTCCCTCCACCCAGG - Intronic
1007133799 6:39501203-39501225 TGGGAGTCTGCTCTAGACCCTGG - Intronic
1007399917 6:41597785-41597807 GGGGAAGCTGCTCTCGGCCAGGG - Exonic
1009019465 6:57935889-57935911 GGCGGGGCTGCCCAAGACCCTGG + Intergenic
1010770038 6:79817478-79817500 GGGGCCGCTGCCCTCCAGCCTGG + Intergenic
1011633907 6:89352845-89352867 GAGGAGGCTGACCTCCAGCCCGG - Exonic
1012401449 6:98845362-98845384 GGGGAGGCCGCCCTTTATCCCGG + Intergenic
1018247959 6:161840349-161840371 GGGCAGGCTGCCCCCTAACCAGG - Intronic
1018617733 6:165703819-165703841 GGGGAGGCGGCTGTCGGCCCTGG - Intronic
1018734201 6:166675259-166675281 GGGGAGGCCGGCCTCCTCCCAGG - Intronic
1019291836 7:254287-254309 GGGGAGCCTGCCCTGCAGCCAGG + Intronic
1022528340 7:31052406-31052428 GGGGGCGCTGCGCTCGGCCCCGG + Intergenic
1023967861 7:44972504-44972526 GGAGACATTGCCCTCGACCCAGG + Intronic
1025611393 7:63078054-63078076 GGGTAGGCTGGCCTCTACCATGG - Intergenic
1025990626 7:66494058-66494080 GGGGACGCTGCCGGCGTCCCCGG - Intergenic
1027187670 7:75981649-75981671 AGGGTGGCTGCCCTCGGCACAGG - Intronic
1029252874 7:99249621-99249643 GTGGAGGCTGCACTCCAGCCCGG - Intergenic
1034258780 7:149740860-149740882 GGCCAGGCTGCTCTCGATCCTGG - Intergenic
1034344670 7:150379125-150379147 GGGAGGGCTGACCTCGCCCCCGG - Intronic
1034498594 7:151436098-151436120 TGGGAGGCTGCCCGCCACACAGG - Intronic
1038130350 8:24723580-24723602 GGGGAGGCTCCCTTGAACCCAGG + Intergenic
1038478609 8:27886239-27886261 GGGCAGGCGGCCCTCCACCATGG - Intronic
1039921418 8:41896666-41896688 GGGGCGGCTGCCCGCGGCCCGGG + Exonic
1044935999 8:97293836-97293858 GCGGAGGCTGCCCAGGAACCTGG - Intergenic
1047200128 8:122758334-122758356 GGGGAGGATGACCTCAGCCCCGG - Intergenic
1049071442 8:140358805-140358827 GGGGAGGCAGCACTCTCCCCTGG - Intronic
1049255719 8:141612557-141612579 AGGGAGGCTGTCCTGAACCCTGG - Intergenic
1049635244 8:143684662-143684684 GGGGAGGCTGCCCGTGCCCTCGG + Intronic
1049685570 8:143937995-143938017 GGGCAGGCTGGCCTCGTCCCTGG - Intronic
1050266742 9:3898707-3898729 TGGGACGCTCCCCTGGACCCGGG - Exonic
1051059649 9:13031221-13031243 CGGGAGGCTGCACTCCAGCCTGG + Intergenic
1052892687 9:33719097-33719119 GGGAAGTCTGCCCTCGTGCCTGG + Intergenic
1052966702 9:34345826-34345848 GGGGTGGCTGTTCTTGACCCTGG - Intergenic
1053142817 9:35691483-35691505 GGAGAGGCTGCCTTCTACCAAGG + Intergenic
1056458877 9:86790220-86790242 GGGGAGTCTGCCTTCCACCCAGG - Intergenic
1057039640 9:91838614-91838636 GGGGTGGCTGCCTGCGAGCCTGG - Intronic
1057234287 9:93346369-93346391 GGGGAGGCGGCCGGCGGCCCGGG + Exonic
1057708030 9:97412028-97412050 GGCCAGGCTGCCCTCGAAGCGGG + Exonic
1059416920 9:114168114-114168136 AGGGACCCTGCACTCGACCCTGG + Exonic
1059433295 9:114262496-114262518 GGGGAGGCTGCCCCCTCCCCTGG + Intronic
1060644855 9:125269531-125269553 CGGGAGGCTGCACTCCAGCCTGG - Intronic
1061041389 9:128142775-128142797 GGCGGGGCTGCCCATGACCCGGG + Intergenic
1061885940 9:133591177-133591199 GAAGAGGCTGCCCTGGCCCCAGG - Intergenic
1061923050 9:133792748-133792770 GGGGAGGCCGCCCTCGAGACAGG + Intronic
1062230384 9:135479243-135479265 GCGGGGGCCGCCCCCGACCCCGG + Intronic
1062352130 9:136144373-136144395 GGAGACTCTGCCCTGGACCCTGG - Intergenic
1062534817 9:137016758-137016780 GGGGAGGCTGACCTAGGGCCTGG + Intronic
1062725141 9:138068810-138068832 GGGGAGGTTTCCCTAGAGCCCGG - Intronic
1186700361 X:12083689-12083711 GGGGCGGCTGCCCAAGACCATGG + Intergenic
1189228731 X:39435411-39435433 GGGGGAGCTGCCCACGACCATGG - Intergenic
1189336047 X:40171596-40171618 AGGCACGCAGCCCTCGACCCCGG + Intronic
1190061952 X:47217470-47217492 GGGGAGGCTGCCTTGGAACAGGG + Intergenic
1191249812 X:58254933-58254955 GGGGAAGCTGGCCTACACCCTGG - Intergenic
1192148490 X:68697544-68697566 TGGGAGGCTGCTCTCCACCTAGG + Intronic
1194881111 X:99253376-99253398 GGGGAAGCTGCCCAAGACCTTGG - Intergenic
1198016371 X:132615442-132615464 TGGGAGGCTGCCCAAGACCAGGG + Intergenic
1200097980 X:153673123-153673145 GAGGAAGCTGCCCTTGCCCCCGG - Intronic