ID: 1183985932

View in Genome Browser
Species Human (GRCh38)
Location 22:41570429-41570451
Sequence GCCTGAACACCCTGCATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183985932_1183985936 11 Left 1183985932 22:41570429-41570451 CCTGCCATGCAGGGTGTTCAGGC No data
Right 1183985936 22:41570463-41570485 TGGACTCCAAGGAACCTTACAGG 0: 1
1: 0
2: 0
3: 3
4: 91
1183985932_1183985934 -9 Left 1183985932 22:41570429-41570451 CCTGCCATGCAGGGTGTTCAGGC No data
Right 1183985934 22:41570443-41570465 TGTTCAGGCTTTCTGAGCTCTGG 0: 1
1: 0
2: 3
3: 20
4: 309
1183985932_1183985938 21 Left 1183985932 22:41570429-41570451 CCTGCCATGCAGGGTGTTCAGGC No data
Right 1183985938 22:41570473-41570495 GGAACCTTACAGGAACCTTGTGG 0: 1
1: 0
2: 1
3: 8
4: 110
1183985932_1183985935 0 Left 1183985932 22:41570429-41570451 CCTGCCATGCAGGGTGTTCAGGC No data
Right 1183985935 22:41570452-41570474 TTTCTGAGCTCTGGACTCCAAGG 0: 1
1: 1
2: 1
3: 28
4: 273
1183985932_1183985939 22 Left 1183985932 22:41570429-41570451 CCTGCCATGCAGGGTGTTCAGGC No data
Right 1183985939 22:41570474-41570496 GAACCTTACAGGAACCTTGTGGG 0: 1
1: 0
2: 1
3: 12
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183985932 Original CRISPR GCCTGAACACCCTGCATGGC AGG (reversed) Intronic
No off target data available for this crispr