ID: 1183987271

View in Genome Browser
Species Human (GRCh38)
Location 22:41576484-41576506
Sequence CACCACTAGCAGTCAGGATA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183987263_1183987271 7 Left 1183987263 22:41576454-41576476 CCCCTCCTGTGGGGAGGCCACCT 0: 1
1: 0
2: 5
3: 26
4: 242
Right 1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 75
1183987264_1183987271 6 Left 1183987264 22:41576455-41576477 CCCTCCTGTGGGGAGGCCACCTT 0: 1
1: 0
2: 7
3: 28
4: 189
Right 1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 75
1183987257_1183987271 17 Left 1183987257 22:41576444-41576466 CCCCAAGGCTCCCCTCCTGTGGG 0: 1
1: 0
2: 2
3: 19
4: 252
Right 1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 75
1183987268_1183987271 -10 Left 1183987268 22:41576471-41576493 CCACCTTTTAAGGCACCACTAGC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 75
1183987255_1183987271 18 Left 1183987255 22:41576443-41576465 CCCCCAAGGCTCCCCTCCTGTGG 0: 1
1: 0
2: 1
3: 39
4: 281
Right 1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 75
1183987259_1183987271 16 Left 1183987259 22:41576445-41576467 CCCAAGGCTCCCCTCCTGTGGGG 0: 1
1: 1
2: 2
3: 25
4: 226
Right 1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 75
1183987254_1183987271 26 Left 1183987254 22:41576435-41576457 CCTGGGGGCCCCCAAGGCTCCCC 0: 1
1: 0
2: 4
3: 38
4: 410
Right 1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 75
1183987265_1183987271 5 Left 1183987265 22:41576456-41576478 CCTCCTGTGGGGAGGCCACCTTT 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 75
1183987266_1183987271 2 Left 1183987266 22:41576459-41576481 CCTGTGGGGAGGCCACCTTTTAA 0: 1
1: 0
2: 0
3: 13
4: 111
Right 1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 75
1183987261_1183987271 15 Left 1183987261 22:41576446-41576468 CCAAGGCTCCCCTCCTGTGGGGA 0: 1
1: 1
2: 6
3: 32
4: 252
Right 1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183987271 Original CRISPR CACCACTAGCAGTCAGGATA TGG Exonic
900573962 1:3373897-3373919 CAACACCAGCAGCCAGGACAGGG - Intronic
902263093 1:15241702-15241724 TGACATTAGCAGTCAGGATAGGG + Intergenic
908961556 1:69702885-69702907 AATCAATAGCAGTCAGGAAAGGG + Intronic
909061203 1:70881385-70881407 CAGAACTAGCATTCAGAATACGG - Intronic
919413358 1:197275023-197275045 CACCACTAGAAGCCAGGAAAAGG - Intronic
922011683 1:221595235-221595257 AACCACTAGGAGTCAAAATAGGG - Intergenic
922660986 1:227430123-227430145 CACCACGAGAAGACAGCATAGGG + Intergenic
1063027276 10:2192915-2192937 GACCACTAGCAGCCAGCATCTGG + Intergenic
1068530558 10:58181099-58181121 CTCCACTAGCAGTGAGAATGAGG - Intergenic
1085702639 11:78758633-78758655 CACCACTAGCAAGGAGGATCGGG - Intronic
1100730552 12:97462826-97462848 CAGCACTAGCACTCTGGAGAAGG + Intergenic
1105833403 13:24186169-24186191 CACAACTACCAGTGAGGAAACGG + Intronic
1113415053 13:110122518-110122540 CACCACCAGAAGTCAGGAAAAGG - Intergenic
1116613082 14:47103023-47103045 CACCCCTATCAATCAAGATATGG + Intronic
1119910383 14:78344560-78344582 TACCACTGGCATTCAGGATGGGG + Intronic
1119933780 14:78571956-78571978 CACCACAAGGAGTGAGTATATGG - Intronic
1123833351 15:24164301-24164323 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1123840079 15:24239380-24239402 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1123853023 15:24379895-24379917 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1123868981 15:24552463-24552485 CCACACTAGCAGCCAGGCTAAGG - Intergenic
1124078255 15:26466746-26466768 CACCAATAACAGTCAGGTCAAGG + Intergenic
1128416161 15:67447902-67447924 CACCATAAGCAGTCATGATCTGG - Intronic
1131958828 15:97766750-97766772 CACCACAAGCACACAGGAAAGGG - Intergenic
1133666112 16:7969455-7969477 GACCAAGAGCAGTCAGGAAAAGG - Intergenic
1134359420 16:13517496-13517518 CACCACTACCCCTCAGGACAAGG - Intergenic
1143569149 17:7743768-7743790 CCCCACCAACAGTCAGGAAAGGG - Intronic
1144863308 17:18319182-18319204 CACCACTCGCTGTCTGGATTCGG + Intronic
1145304935 17:21668771-21668793 CACCTATTGCACTCAGGATAGGG + Intergenic
1146725149 17:35150202-35150224 CAACACCAGCATTCAGGAGAAGG + Exonic
1147167159 17:38599726-38599748 CACCCCCAGCAGACAGGATGAGG + Intronic
1147703047 17:42407912-42407934 CTCCAGTAGCAGGCAGGGTAAGG - Intronic
1152180424 17:78817368-78817390 CACCACTACCAGTGAGGAAACGG + Intronic
1159908146 18:74117170-74117192 CACTACTAGGAGTCAGCAGAGGG - Intronic
1163865425 19:19769713-19769735 GACCACTCGCAGTCAGGAGCTGG - Intergenic
925097926 2:1222652-1222674 CTCCACCAGCAGGCAGGACAGGG - Intronic
925097973 2:1222932-1222954 CTCCACCAGCAGGCAGGACAGGG - Intronic
939656991 2:144838149-144838171 CACCACTAGTGGCCAGGATTTGG + Intergenic
942503010 2:176611824-176611846 TACCACTCACAGTCAGGATCGGG - Intergenic
944538827 2:200737686-200737708 CACCACAATCAGTCAGGAGGAGG + Intergenic
944928255 2:204488006-204488028 TACAACTTGCAGTCAGGACACGG + Intergenic
945022542 2:205588624-205588646 CACCACTAGCATCAAGGTTACGG - Intronic
948838611 2:240638031-240638053 CCACACTGGCTGTCAGGATACGG + Intergenic
1170879754 20:20286247-20286269 CGCCACTATCAGGCAGGATGTGG - Intronic
1179895164 21:44357740-44357762 CACTCCTAGCAGTCAGGGGACGG + Intronic
1183457098 22:37928833-37928855 CACCACGCCCAGCCAGGATAGGG - Intronic
1183488447 22:38103398-38103420 CACCACTAGTATTCAGATTATGG + Intronic
1183987271 22:41576484-41576506 CACCACTAGCAGTCAGGATATGG + Exonic
952111673 3:30130870-30130892 CACAACTGGAAGTGAGGATAGGG - Intergenic
959771576 3:110105317-110105339 CACCACTAGCAGTCCCCATTGGG - Intergenic
959858641 3:111191354-111191376 CAGCACTCTCAGTCTGGATAAGG + Intronic
964599776 3:158486230-158486252 CAACACTAGAAGTCAGGTAAGGG - Intronic
965223128 3:165953385-165953407 CATCAGTAACAGTCAGCATATGG - Intergenic
970395171 4:15657935-15657957 CACCACAAGAAGTCTGAATAAGG + Intronic
976126118 4:81835414-81835436 CACCACCAGGAGCCAGGACAAGG + Intronic
978259543 4:106738171-106738193 CACCAGGAGCTGTCAGGAGAGGG + Intergenic
978931011 4:114312076-114312098 CACCACTACCTTTCAGTATAAGG - Intergenic
981278971 4:142935488-142935510 CCCCATTAGCACTCAGGAGATGG + Intergenic
981994716 4:150963406-150963428 GACCACTCGCAGTCAGGAGCTGG - Intronic
982392450 4:154879755-154879777 CACCTTTAGAAGTCATGATAGGG + Intergenic
983684466 4:170391524-170391546 CATGAGTAGGAGTCAGGATAAGG - Intergenic
986387538 5:7249145-7249167 CACCACTAGCAGCAAGGTGAAGG + Intergenic
991166068 5:63566339-63566361 CACCCCTCACAGTCATGATAAGG - Intergenic
1002557332 5:180053165-180053187 CAAAACTGGCAGACAGGATAGGG + Intronic
1003332736 6:5143226-5143248 CACCACTGTCATTCAGGGTACGG + Intronic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1021803813 7:24335252-24335274 TAGAACTAGCAGTCAGGATTGGG - Intergenic
1022317961 7:29263249-29263271 GACCACTCGCAGTCAGGAGCTGG - Intronic
1023139833 7:37090912-37090934 CACCTCTATGAGTCAGGATCAGG - Intronic
1028723343 7:94059017-94059039 CATCACCAGAAGGCAGGATAAGG + Intergenic
1032745061 7:134778138-134778160 CAGCAGTAGCAGTCAGGAAGAGG + Intronic
1037450354 8:19010712-19010734 CAACACAAGCTGTCAAGATATGG + Intronic
1049158778 8:141084283-141084305 AACCACTAGCAGTGGGGGTAAGG + Intergenic
1051024779 9:12595318-12595340 CAGCACAAGCAGTCAGGCAAAGG + Intergenic
1053170801 9:35880937-35880959 ACCCAGTATCAGTCAGGATATGG - Intergenic
1053564008 9:39228386-39228408 TACCACTGGCAGGCAGGAGAGGG - Intronic
1053829797 9:42066265-42066287 TACCACTGGCAGGCAGGAGAGGG - Intronic
1054133140 9:61390658-61390680 TACCACTGGCAGGCAGGAGAGGG + Intergenic
1054600762 9:67121189-67121211 TACCACTGGCAGGCAGGAGAGGG + Intergenic
1055914587 9:81387956-81387978 CACCTCTAGAAGTCACTATACGG - Intergenic
1201958152 Y:19648633-19648655 ACCCATTAGCAGTCAGGAAATGG + Intergenic