ID: 1183987933

View in Genome Browser
Species Human (GRCh38)
Location 22:41579512-41579534
Sequence GAGCAGCTATGCCCAGTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 297}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183987925_1183987933 10 Left 1183987925 22:41579479-41579501 CCCAGGATCTCCATCTCAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 175
Right 1183987933 22:41579512-41579534 GAGCAGCTATGCCCAGTCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 297
1183987921_1183987933 16 Left 1183987921 22:41579473-41579495 CCAGCCCCCAGGATCTCCATCTC 0: 1
1: 0
2: 4
3: 63
4: 439
Right 1183987933 22:41579512-41579534 GAGCAGCTATGCCCAGTCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 297
1183987922_1183987933 12 Left 1183987922 22:41579477-41579499 CCCCCAGGATCTCCATCTCAGAG 0: 1
1: 0
2: 3
3: 67
4: 410
Right 1183987933 22:41579512-41579534 GAGCAGCTATGCCCAGTCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 297
1183987919_1183987933 20 Left 1183987919 22:41579469-41579491 CCCGCCAGCCCCCAGGATCTCCA 0: 1
1: 0
2: 2
3: 61
4: 423
Right 1183987933 22:41579512-41579534 GAGCAGCTATGCCCAGTCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 297
1183987923_1183987933 11 Left 1183987923 22:41579478-41579500 CCCCAGGATCTCCATCTCAGAGG 0: 1
1: 0
2: 0
3: 22
4: 222
Right 1183987933 22:41579512-41579534 GAGCAGCTATGCCCAGTCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 297
1183987927_1183987933 9 Left 1183987927 22:41579480-41579502 CCAGGATCTCCATCTCAGAGGGC 0: 1
1: 0
2: 1
3: 25
4: 192
Right 1183987933 22:41579512-41579534 GAGCAGCTATGCCCAGTCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 297
1183987929_1183987933 0 Left 1183987929 22:41579489-41579511 CCATCTCAGAGGGCCACAAAGGG 0: 1
1: 0
2: 3
3: 11
4: 154
Right 1183987933 22:41579512-41579534 GAGCAGCTATGCCCAGTCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 297
1183987918_1183987933 21 Left 1183987918 22:41579468-41579490 CCCCGCCAGCCCCCAGGATCTCC 0: 1
1: 0
2: 5
3: 56
4: 431
Right 1183987933 22:41579512-41579534 GAGCAGCTATGCCCAGTCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 297
1183987920_1183987933 19 Left 1183987920 22:41579470-41579492 CCGCCAGCCCCCAGGATCTCCAT 0: 1
1: 0
2: 0
3: 42
4: 465
Right 1183987933 22:41579512-41579534 GAGCAGCTATGCCCAGTCTGAGG 0: 1
1: 0
2: 1
3: 17
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183987933 Original CRISPR GAGCAGCTATGCCCAGTCTG AGG Intronic
900537348 1:3185456-3185478 GTGCAGGGATGCCCAGGCTGCGG + Intronic
900806231 1:4769890-4769912 GAGCAGCTATGACCATGATGAGG - Exonic
901126929 1:6936100-6936122 GAGCAGCAGTGCCCTGACTGAGG + Intronic
901714947 1:11145786-11145808 GAGCCACTGTGCCCAGCCTGGGG + Intronic
904330532 1:29755443-29755465 GAGCAGCTGTGCAGTGTCTGGGG + Intergenic
904416145 1:30362151-30362173 GAGCAGCTGTGCAGTGTCTGGGG - Intergenic
905676361 1:39828173-39828195 GAGCCACCATGCCCAGCCTGAGG - Intergenic
905733120 1:40310035-40310057 GGGGAGCCATGCCCACTCTGTGG + Intronic
906465545 1:46075329-46075351 GAGCCACTGTGCCCAGCCTGAGG - Intronic
906961477 1:50421731-50421753 GAGCAGCCATGGCCAGACTGGGG - Intronic
909547367 1:76862801-76862823 GAGCTGCTATTTCCAGTATGGGG - Intergenic
911802280 1:102157410-102157432 GAGCCACCATGCCCAGCCTGAGG - Intergenic
912191593 1:107347227-107347249 GAGCCACCATGCCCAGCCTGAGG - Intronic
913011544 1:114688410-114688432 GAGCCACTGTGCCCAGTCTTAGG + Intronic
915733781 1:158071969-158071991 GATCAGCCATGCCCTGTCCGAGG + Intronic
915733952 1:158072847-158072869 GATCAGCCATGCCCTGTCCGAGG - Intronic
917805089 1:178606155-178606177 GAGCAGCTGTGCCTAGTGGGTGG - Intergenic
920288073 1:204896049-204896071 GAACAGCTTTGCCCACTCTCTGG + Intronic
920734063 1:208515201-208515223 GAGCTGCTCTGCCTATTCTGTGG - Intergenic
920917703 1:210271318-210271340 GAGCCGCCATGTCCAGCCTGTGG - Intergenic
921423309 1:214973961-214973983 CAACCGCTATGCCCAGTCTAGGG + Intergenic
922728968 1:227940235-227940257 GACCAGCCATGCCCCTTCTGGGG - Intronic
924607837 1:245550575-245550597 GAGCAGCTCAGGCCAGCCTGGGG + Intronic
1062893654 10:1086085-1086107 GAGAAGCTGTGACCTGTCTGAGG - Intronic
1064095571 10:12422091-12422113 GAGCCACTGTGCCCAGTCTTGGG + Intronic
1068291446 10:55006673-55006695 AAGCAGCTCTGCCCAGCCTGCGG - Intronic
1069574026 10:69513489-69513511 GAGCCACCGTGCCCAGTCTGTGG + Intergenic
1071384368 10:85104655-85104677 GAGCACCTGGGCCCAGTCTAAGG + Intergenic
1071702252 10:87952119-87952141 GAGTAACTATTCCCAGTCAGAGG + Exonic
1072291942 10:93972009-93972031 GAGAAGCTATTCCCTGTCTGTGG - Intergenic
1072532546 10:96332779-96332801 GAACAGTTATTCCCAGTGTGTGG + Intronic
1073393797 10:103201349-103201371 GAGCCACCATGCCCAGCCTGAGG - Intergenic
1073661899 10:105485211-105485233 GAGCAGCTTTGCAGATTCTGTGG - Intergenic
1077091218 11:779184-779206 AAGCGGCTAGGCCCAGCCTGTGG - Intronic
1077715496 11:4575931-4575953 TAGGAACTATGCCTAGTCTGGGG + Intronic
1078520556 11:12059752-12059774 GAGCTACCATGCCCAGCCTGGGG - Intergenic
1080444038 11:32321335-32321357 GAGCCACTGTGCCCAGCCTGTGG - Intergenic
1081678573 11:44985938-44985960 GAGCAGCCATGCCTATCCTGTGG + Intergenic
1081875450 11:46405233-46405255 GAGGGGCTTTGCCCAGCCTGTGG - Intronic
1084095967 11:66911746-66911768 GAGCCGCCATGCCCAGCCTAAGG - Intronic
1084191317 11:67500218-67500240 GAGCACCGAGGCCCGGTCTGCGG - Exonic
1084524075 11:69685043-69685065 CCCCAGCTATGCCCAGTATGGGG + Intergenic
1084550482 11:69838785-69838807 CAGCAGACATGCCCAGTCTTTGG + Intergenic
1087068328 11:94048644-94048666 GAGCCACTGTGCCCAGCCTGTGG + Intronic
1087088856 11:94247516-94247538 GAGCCACTGTGCCCAGCCTGTGG - Intergenic
1089110723 11:116053799-116053821 CAGCAGCTTTGACTAGTCTGAGG - Intergenic
1089121627 11:116139737-116139759 GAGCAGCTCTTCCCCTTCTGTGG + Intergenic
1090732186 11:129581520-129581542 TCGCAGCACTGCCCAGTCTGTGG - Intergenic
1092525855 12:9310023-9310045 GAGAAGCTGTGCCCAGGGTGGGG + Intergenic
1092541435 12:9421793-9421815 GAGAAGCTGTGCCCAGGGTGGGG - Intergenic
1094511608 12:31100710-31100732 GAGAAGCTGTGCCCAGGGTGGGG + Intronic
1095906516 12:47383613-47383635 GAGCCACTGTGCCCAGCCTGAGG + Intergenic
1097862481 12:64532164-64532186 GAGCAGCTCTGCCCCCTCTCAGG + Intergenic
1100324017 12:93524075-93524097 GAGCCACTATGCCCAGCCTATGG + Intergenic
1100615173 12:96225848-96225870 GAGGCACTATGCCCAGCCTGAGG - Intronic
1100620489 12:96267120-96267142 AAGCAGCTCTGTCCAGACTGGGG - Exonic
1102218113 12:111176330-111176352 GAGCCACCATGCCCAGTGTGAGG + Intronic
1103221443 12:119249347-119249369 GAGCCACCATGCCCAGCCTGGGG + Intergenic
1105331605 13:19421840-19421862 GAGCCACCATGCCCAGTCCGTGG - Intergenic
1105619430 13:22052592-22052614 GAGCAGGGATGCCTATTCTGGGG + Intergenic
1105880174 13:24598696-24598718 GAGCCACCACGCCCAGTCTGTGG + Intergenic
1107012779 13:35684566-35684588 GAGAACCTCTGCCCAGGCTGCGG + Intergenic
1109805797 13:67441276-67441298 GAGGTGCTATGCCCAGGTTGAGG - Intergenic
1112076163 13:95915752-95915774 GAGCAGCTATGCTCTGTTGGTGG - Intronic
1112829733 13:103434408-103434430 GAACAGCTAATCCCAGTGTGAGG + Intergenic
1112862300 13:103847703-103847725 GATCAACTAGGCCCAGTCTGTGG + Intergenic
1113671617 13:112179369-112179391 GAGCCCCTGTGCCCACTCTGCGG - Intergenic
1113729020 13:112626382-112626404 GAGCCGCTCTGCCCACTCTGGGG - Intergenic
1114211610 14:20620378-20620400 GAGCCACCATGCCCAGACTGGGG + Intergenic
1114472888 14:22975877-22975899 GAGCCACCATGCCCAGCCTGGGG - Intronic
1116502932 14:45642638-45642660 GAGCAACTGTGCCCAGCCTTAGG - Intergenic
1116908654 14:50433119-50433141 GAGCCACTGTGCCCAGCCTGGGG + Intronic
1117559248 14:56919000-56919022 GAGCTGCAATGCCTAGTTTGGGG + Intergenic
1117804464 14:59476547-59476569 GAGCAGCCATCGCCAGCCTGTGG - Intronic
1119385226 14:74253997-74254019 GAGCAGAAATCCCCAGTCTAGGG + Intronic
1119812921 14:77538853-77538875 GAGCCACTATCCCCAGCCTGTGG + Intronic
1120830340 14:88992457-88992479 GAGCAGCCATGCTGTGTCTGTGG + Intergenic
1121118515 14:91360611-91360633 GAGCTGCTCTGCCCAGCCCGAGG + Intronic
1122058420 14:99120783-99120805 GAGCCACTACGCCCAGCCTGAGG - Intergenic
1122452536 14:101821811-101821833 GAGCACCTATGCACAGGCTGCGG - Intronic
1124354935 15:28988039-28988061 GAGCCACCATGCCCAGCCTGTGG + Intronic
1125501470 15:40242415-40242437 GAGCAGGAAGGCCCAGGCTGCGG + Intronic
1128206760 15:65859422-65859444 GAGCCACTGTGCCCAGTCTAAGG + Intronic
1128410901 15:67395952-67395974 GAGCCACTACGCCCAGCCTGAGG + Intronic
1128653120 15:69434836-69434858 GAGCAGCTATGCCCTGTGCCTGG - Intronic
1128749799 15:70140747-70140769 AAGCAGCTTGGCCCTGTCTGGGG + Intergenic
1129327630 15:74809541-74809563 GAGCAGCTATGCCTGTTCTTTGG - Intergenic
1129628405 15:77230481-77230503 GAGCCACTGTGCCCAGCCTGAGG + Intronic
1133285373 16:4688280-4688302 GAGCCCCAATGCCCAGACTGTGG - Intronic
1133784693 16:8964496-8964518 GAGCAGCTGCGCCCCGCCTGGGG - Intronic
1134116719 16:11554259-11554281 GAGCTGCTAGGCACAGTGTGAGG - Intronic
1134769212 16:16791493-16791515 GGTCAGCTATGCCCAGCCTATGG + Intergenic
1134886166 16:17794286-17794308 GAGCCACTACGCCCAGCCTGTGG - Intergenic
1135549349 16:23386299-23386321 GAGCCACTATGCCCAGTCTGTGG + Intergenic
1136080547 16:27849808-27849830 GAGCCACTGTGCCCAGCCTGGGG + Intronic
1137566562 16:49536699-49536721 GAGCCACTGTGCCCAGCCTGTGG + Intronic
1138560909 16:57800595-57800617 GATCAGCTCAGCTCAGTCTGAGG + Intronic
1139538590 16:67596234-67596256 GAGCCACCATGCCCAGTCTGGGG + Intronic
1139578958 16:67860553-67860575 GAGCTACTATGCCCAGCCTTGGG + Intronic
1139805100 16:69558149-69558171 GAGCCGCCATGCCTGGTCTGAGG + Intergenic
1139960310 16:70713825-70713847 GAGCCACTACGCCCAGCCTGTGG + Intronic
1141335244 16:83148220-83148242 GAGCCACTGTGCCCAGTTTGAGG + Intronic
1141348283 16:83268828-83268850 GAGCAGCTCTGGCCTCTCTGTGG - Intronic
1141451348 16:84105611-84105633 GATCAGCACTGCCCAGCCTGAGG + Intronic
1143545954 17:7595730-7595752 GAGCCACTGTGCCCAGTTTGAGG + Intronic
1145899180 17:28478906-28478928 GAGCAGCCCTCCCCAGGCTGTGG - Intronic
1146179599 17:30689081-30689103 GAGCCACTGTGCCCAGACTGGGG - Intergenic
1146781778 17:35680658-35680680 GAGCCACCATGCCCAGTCTATGG + Intronic
1147658018 17:42101986-42102008 GAGGAGAGAAGCCCAGTCTGAGG - Intronic
1147891021 17:43716975-43716997 ATGGAGCTATGCCCAGCCTGTGG + Intergenic
1147957311 17:44143220-44143242 GAGCCACCATGCCCAGCCTGTGG + Intronic
1148806214 17:50265320-50265342 GAGAGGCAATGCCCAGCCTGAGG + Intergenic
1150600550 17:66647065-66647087 GAGCATCAGTGCCCAGTCAGAGG - Intronic
1151736750 17:75947152-75947174 GAGCCACTGTGCCCAGCCTGTGG + Intronic
1151758391 17:76087551-76087573 GAGGAGGTATCTCCAGTCTGTGG - Intronic
1155584724 18:27351879-27351901 GAGCCACCATGCCCAGTCTGAGG - Intergenic
1155915422 18:31552576-31552598 GAGCCACTGTGCCCAGCCTGTGG - Intergenic
1158225697 18:55198841-55198863 AACCAGCTATGCCCAGACTGAGG + Intergenic
1158900887 18:61960996-61961018 GAGCCACCATGCCCAGTCTATGG + Intergenic
1159642537 18:70880398-70880420 TACCAGCTATGCTCAGTGTGAGG + Intergenic
1162097349 19:8318430-8318452 GAGCCACCATGCCCAGTCAGAGG + Intronic
1162336605 19:10065033-10065055 GAGCTGCCATGTCCAGTCTAAGG - Intergenic
1162353936 19:10169112-10169134 GAGCCACCATGCCCAGCCTGAGG + Intronic
1162729058 19:12706667-12706689 GAGCCGCTATGCCCACTGGGTGG - Exonic
1162790577 19:13060701-13060723 AAGCAACCAGGCCCAGTCTGGGG + Intronic
1162979011 19:14226490-14226512 GAGCCACCATGCCCAGACTGGGG + Intergenic
1163084153 19:14967243-14967265 GTGCTGCTATGTCCAGGCTGCGG + Intronic
1163853927 19:19684497-19684519 GAGCCACTGTGCCCAGCCTGGGG + Intergenic
1164019174 19:21282230-21282252 GAGCCACGATGCCCAGCCTGAGG + Intronic
1164776725 19:30858658-30858680 GAGCAGATAGGCGGAGTCTGTGG - Intergenic
1166278163 19:41770125-41770147 GAGCTACTGTGCCCAGCCTGGGG - Intronic
1166737556 19:45095072-45095094 GAGAAACTATTGCCAGTCTGTGG + Intronic
1166997423 19:46726358-46726380 GAGCCACTGTGCCCCGTCTGTGG - Intronic
1167789304 19:51662982-51663004 GAGCCACTATGCCCAGCCTCTGG - Intergenic
1168522615 19:57064610-57064632 GAGCCACTGTGCCCAGCCTGAGG + Intergenic
925214780 2:2085003-2085025 AAGCAGCTCTGCCCACCCTGTGG + Intronic
928692208 2:33811765-33811787 GAGCCACTGTGCCCAGTCAGAGG - Intergenic
928948554 2:36793451-36793473 GAGCAGCTATGACCAGCCCAGGG - Intronic
929558551 2:42941075-42941097 GAGCCACTATGCCCAGTCCCTGG + Intergenic
933542169 2:83660327-83660349 GAGCAACCATGCCCGGCCTGTGG + Intergenic
933745201 2:85565601-85565623 GAGCCACTGTGCCCAGTCTATGG - Intronic
933990443 2:87630056-87630078 CAGCACCTGTGCCCTGTCTGGGG + Intergenic
934950953 2:98575073-98575095 GAGCAGCTCTGCTCAAACTGGGG - Intronic
935347705 2:102124135-102124157 GAGCCACTGTGCCCAGTCTCGGG - Intronic
936303403 2:111320768-111320790 CAGCACCTGTGCCCTGTCTGGGG - Intergenic
936718410 2:115217904-115217926 GAGCATCTAAGCCTAGACTGGGG - Intronic
937087489 2:119181115-119181137 TAGCAGCAACGCCCAGCCTGAGG + Intergenic
937195897 2:120156236-120156258 AAGCAGGTATGGCCAGGCTGGGG - Intronic
937369729 2:121288865-121288887 CAGCACCTTTGCCCAGTGTGGGG - Intergenic
939765087 2:146238470-146238492 GAGCAGATGTGCTCAGTCTCAGG + Intergenic
941506301 2:166349686-166349708 GAGCCACCATGCCCGGTCTGAGG - Intronic
942802370 2:179890344-179890366 GAGCACCTTTGCCCAGAATGGGG + Intergenic
942955833 2:181772483-181772505 CAGCAGCTCTGCCCAGTTTTAGG - Intergenic
943313141 2:186352811-186352833 GAGCAACAATGTCCAGGCTGAGG + Intergenic
944083349 2:195815024-195815046 GAGCCACTGTGCCCAGGCTGGGG + Intronic
948234909 2:236380158-236380180 GAGCAGTGAGGCCCAGTCTCAGG - Intronic
948483859 2:238267730-238267752 GAACAGCTCTGACAAGTCTGGGG - Intronic
948958948 2:241316490-241316512 GAGCGACTAGGCCCTGTCTGCGG + Exonic
1169026399 20:2375063-2375085 GAGCAGCTGTGCCCTGTGGGTGG - Intergenic
1170344338 20:15366834-15366856 GAGCCACCATGCCCAGCCTGAGG + Intronic
1170463236 20:16598953-16598975 GAGCCGCTGTGCCCGGCCTGGGG - Intergenic
1170610803 20:17911294-17911316 GGACAGCTCTGCCCTGTCTGCGG + Intergenic
1171042348 20:21777053-21777075 GAGCTGCACTGCCAAGTCTGAGG - Intergenic
1171113543 20:22504964-22504986 GGGCAGCTATGGCCTGTTTGGGG - Intergenic
1172146238 20:32760371-32760393 GAGCCACCATGCCCAGCCTGGGG - Intergenic
1172269943 20:33649278-33649300 GAGCAGCCCTGCCCAGATTGCGG + Exonic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1174364445 20:50048031-50048053 GAGCCACTGTGCCCAGCCTGTGG + Intergenic
1175366840 20:58461526-58461548 GTGCAGCCGTGCCCAGCCTGTGG - Exonic
1176066521 20:63199694-63199716 CAGCAGCGAAGTCCAGTCTGGGG + Intronic
1179804093 21:43826208-43826230 GAGCAGCTGTCCCCAGGCTCAGG + Intergenic
1180980703 22:19876812-19876834 GAGCAGCTGTGGCCAGGCCGGGG + Intronic
1182500909 22:30746774-30746796 GAGCCACTGTGCCCAGCCTGAGG + Intronic
1183066295 22:35365444-35365466 GAGCTGCCATGCCCGGACTGAGG + Intergenic
1183382972 22:37499707-37499729 GAGCAGGTATTCCTGGTCTGTGG - Intronic
1183987933 22:41579512-41579534 GAGCAGCTATGCCCAGTCTGAGG + Intronic
1185065225 22:48628692-48628714 GGGCAGCCATGCCCTGTCTCTGG - Intronic
1185361786 22:50412465-50412487 GAGCCACCATGCCCAGCCTGGGG + Intronic
949960462 3:9307868-9307890 GAGCTGCCACGCCCAGCCTGTGG - Intronic
950078647 3:10205638-10205660 GAGCAGCGGTTCCCAGTGTGGGG + Intronic
950479921 3:13237876-13237898 GAGCAGCCAAGCCCAGGCAGGGG + Intergenic
950494713 3:13326843-13326865 GAACAGCTCTGCCAAGTCGGTGG - Intronic
952096011 3:29955133-29955155 GAGCAGCTATCACCATACTGTGG - Intronic
954188597 3:48939937-48939959 GAGCCACTGTGCCCAGCCTGGGG - Intronic
954465841 3:50654324-50654346 GAGCATCTCTGCCAGGTCTGAGG - Intergenic
954720480 3:52558010-52558032 GAGCAGCTCTTCCCTGGCTGTGG - Intronic
955320795 3:57972899-57972921 CAGCAAATATGCCCAGCCTGTGG + Intergenic
955536116 3:59925388-59925410 GAGCTACTATGTCCAGTATGTGG + Intronic
956135713 3:66096577-66096599 GAGCCACTTTGCCCAGCCTGTGG + Intergenic
957809517 3:85201796-85201818 GAGCCACTGTGCCCAGCCTGAGG - Intronic
958802488 3:98772393-98772415 TATCAGCTATGACAAGTCTGGGG - Intronic
959053154 3:101543555-101543577 GAGCCACCATGCCCAGCCTGGGG - Intergenic
963145594 3:141990516-141990538 GAGCCACCGTGCCCAGTCTGTGG + Intronic
964086177 3:152821278-152821300 GAGCCACCATGCCCAGCCTGTGG + Intergenic
964771631 3:160229631-160229653 GAGCCACCATGCCCAGCCTGTGG + Intronic
965351730 3:167620496-167620518 GAGCAGCTCTGCCCAGTTAATGG + Intronic
966289875 3:178343330-178343352 AAGCAGCCATGGCCAGGCTGGGG - Intergenic
967734402 3:192936651-192936673 GAGCCACTGTGCCCAGTCTTGGG + Intergenic
968727276 4:2253626-2253648 GAGCAGACATGCCAAGGCTGGGG - Intronic
968830433 4:2930813-2930835 GAGCCACTGTGCCCAGGCTGTGG - Exonic
968847385 4:3052702-3052724 GAGCCACCATGCCCAGCCTGAGG - Intergenic
969274094 4:6123534-6123556 GAGCCACCATGCCCAGCCTGAGG - Intronic
969283988 4:6191014-6191036 CAGCAGCTTTGCCCATACTGGGG + Intronic
973576835 4:52298152-52298174 GAGCCACCATGCCCAGCCTGTGG + Intergenic
974640282 4:64621528-64621550 GAGCCACCATGCCCAGCCTGTGG + Intergenic
975439049 4:74389299-74389321 GAGCCACCATGCCCAGCCTGGGG + Intergenic
975860787 4:78674677-78674699 GAGCCACCATGCCCAGCCTGTGG - Intergenic
976948517 4:90799567-90799589 AAGCAGTCATGGCCAGTCTGGGG + Intronic
979666439 4:123316062-123316084 GAGCCACCATGCCCAGCCTGTGG + Exonic
984253143 4:177358589-177358611 GAGCCACCATGCCCAGCCTGTGG + Intronic
984549805 4:181146692-181146714 GAGCAGGGATGCCAAGACTGAGG - Intergenic
985013054 4:185604146-185604168 TAGCAGCTATACCCAGATTGAGG - Intronic
985133114 4:186758924-186758946 GAGCAGCTGTGTCCCGTCTTCGG + Intergenic
985634684 5:1030204-1030226 GACCACCAATGCCCAGGCTGAGG - Intronic
987665460 5:20932734-20932756 GAGCCACCATGCCCAGTCAGTGG + Intergenic
988757232 5:34269444-34269466 GAGCCACCATGCCCAGTCAGTGG - Intergenic
990506362 5:56449338-56449360 GATCAGCCCTGCCCAGTCTTTGG + Intergenic
991075571 5:62532640-62532662 GAGCCACCATGCCCAGCCTGTGG + Intronic
991419114 5:66422726-66422748 CAGCAGCACTGCCCAGTCAGTGG + Intergenic
992697362 5:79303345-79303367 GAGCCACTGTGCCCAGCCTGAGG + Intronic
995484684 5:112628395-112628417 CAGCAGCTTTGGCCAGGCTGGGG - Intergenic
995693375 5:114852543-114852565 GAGCACTTTTGCCCATTCTGTGG + Intergenic
996764622 5:127023444-127023466 GAGCCACCATGCCCAGCCTGAGG - Intronic
998173346 5:139885334-139885356 GAGCAGGTATTCCCAGGCCGAGG + Intronic
999699805 5:154218041-154218063 GAACAGCAGTGCCCAGGCTGGGG - Intronic
1000706903 5:164523753-164523775 GAGCAGCCAGTACCAGTCTGTGG - Intergenic
1000804049 5:165766234-165766256 GAGCGTCTATGCCCAGCCTCAGG + Intergenic
1001162900 5:169337306-169337328 GAGCCACTGTGCCCAGTCTCTGG - Intergenic
1002106069 5:176879966-176879988 GAGCAGCTCTCCCCGGTGTGGGG - Exonic
1002127576 5:177058103-177058125 GAGCCACCATGCCCAGCCTGAGG + Intronic
1002210799 5:177598063-177598085 GAGCCACCATGCCCAGCCTGTGG - Intergenic
1003014545 6:2457484-2457506 GAGCCACTGTGCCCAGCCTGAGG + Intergenic
1003508055 6:6756147-6756169 GAGCCACTGTGCCCAGCCTGAGG - Intergenic
1004331510 6:14726235-14726257 GAGCCACTGTGCCCAGTCTGTGG - Intergenic
1006173511 6:32108713-32108735 GAGCAGCTGAGCCCAGGCTCTGG - Intronic
1006319072 6:33309108-33309130 GAGCCACTGTGCCCAGCCTGTGG - Intronic
1006532575 6:34669411-34669433 GAGCCACCATGCCCAGCCTGAGG + Intronic
1006731494 6:36239553-36239575 GAGCCACTGTGCCCGGTCTGAGG + Intergenic
1008084400 6:47229046-47229068 GAGCCACCATGCCCAGCCTGAGG - Intergenic
1008908724 6:56709806-56709828 GAGGAGCTTAACCCAGTCTGAGG + Intronic
1009558653 6:65209225-65209247 TAGCAGCAAAGCCCAGTGTGTGG + Intronic
1010550094 6:77211350-77211372 TAGCACCTATGCCCAGCCTACGG + Intergenic
1011441372 6:87390936-87390958 GAGCCACTGTGCCCAGCCTGGGG + Intronic
1011813565 6:91161324-91161346 GAGCTGCTATACCTAGTCTTGGG - Intergenic
1013347016 6:109270481-109270503 GAGCCACCATGCCCAGCCTGTGG - Intergenic
1016728173 6:147399704-147399726 GAGCCGCCATGCCCAGCCTCAGG - Intergenic
1017096727 6:150811554-150811576 GAGCCACTGTGCCCAGTCTTAGG + Intronic
1017899684 6:158708550-158708572 GAGAAGCTCTGCCCAGCCTGAGG - Intronic
1021012976 7:15494284-15494306 GCACAGCTATGCTCAGGCTGTGG + Intronic
1021552262 7:21883753-21883775 GAGCTGCCATGCCCAGCCTTAGG - Intronic
1022477423 7:30720650-30720672 GAGCAGGTATGCCCTGCCCGAGG - Intronic
1023246996 7:38215766-38215788 GAGCAGCTCTCTCTAGTCTGAGG - Intronic
1023766083 7:43512033-43512055 CAGCAGCTACGCCCACGCTGTGG - Intronic
1025100641 7:56132080-56132102 GAGCCACTGTGCCCAGCCTGAGG + Intergenic
1025192142 7:56903981-56904003 GAGCTGCTGTGCCCAGTCAGAGG + Intergenic
1025679809 7:63672950-63672972 GAGCTGCTGTGCCCAGTCAGAGG - Intergenic
1026226041 7:68442007-68442029 GAGCAGCAATGGGCAGTCAGGGG - Intergenic
1026626094 7:71993739-71993761 GAGCCACTGTGCCCAGCCTGAGG + Intronic
1028242043 7:88433475-88433497 GAGCAGATGAGCCAAGTCTGTGG + Intergenic
1029000686 7:97151455-97151477 GAGCAGCTTTACCCATTCTTTGG - Intronic
1029597715 7:101546558-101546580 GAGCCACTGTGCCCAGCCTGGGG + Intronic
1029669320 7:102018243-102018265 GAGCCACTGTGCCCAGTCAGAGG + Intronic
1029906870 7:104101419-104101441 GAGCCACTGTGCCCAGCCTGTGG - Intergenic
1030274440 7:107705018-107705040 AAGCAGCTGTGCCCATCCTGGGG - Intronic
1031070020 7:117151833-117151855 GAGCCACCATGCCCAGCCTGAGG - Intronic
1031980982 7:128124126-128124148 GAGCCACCGTGCCCAGTCTGTGG + Intergenic
1037158079 8:15730680-15730702 GAGCAGCCAGGCTCAGTTTGTGG + Exonic
1037993788 8:23338810-23338832 CAGAAGCTCTGGCCAGTCTGAGG - Intronic
1038138458 8:24816245-24816267 ATGCAGCTGTGCCCAGTGTGGGG + Intergenic
1038714231 8:29977471-29977493 GAGCCGCTGCGCCCAGCCTGTGG - Intergenic
1039077756 8:33707942-33707964 GAGCCACTTTGCCCAGTCAGAGG - Intergenic
1039089481 8:33813067-33813089 CAGCTGCTATGGACAGTCTGGGG - Intergenic
1039299326 8:36192429-36192451 GGGCTGCTCTGCCCTGTCTGAGG - Intergenic
1039418928 8:37419693-37419715 GAGCAGATATTCCAAGACTGTGG - Intergenic
1041177929 8:55216441-55216463 GAGCCACCATGCCCGGTCTGTGG - Intronic
1043561494 8:81499171-81499193 AAGCATCTATGACCTGTCTGAGG - Intergenic
1044234783 8:89818498-89818520 GAGCCACTATGCCCAGCCTCAGG - Intergenic
1045937545 8:107698203-107698225 GATCAGTTATTCCCAGTCTTTGG - Intergenic
1047740753 8:127804453-127804475 GAGCCACTGTGCCCAGGCTGTGG + Intergenic
1048119632 8:131564552-131564574 GAGCCTCCCTGCCCAGTCTGGGG - Intergenic
1048351670 8:133621531-133621553 GAGCCACGATGCCCAGTCTGAGG - Intergenic
1048397713 8:134030482-134030504 GAGTTGCTATGGCCAGTTTGTGG - Intergenic
1048470567 8:134700630-134700652 GAGGAGCTCTGGCCAGTCCGGGG + Intronic
1048771889 8:137903964-137903986 GAGCAGTTGTGGCCAGTCTATGG - Intergenic
1049374792 8:142284287-142284309 GAGGAGCCAGGCCCAGGCTGGGG - Intronic
1049906240 9:219610-219632 GAGCCACCATGCCCAGCCTGTGG - Intronic
1052888710 9:33676136-33676158 GAGTAACTATTCCCAGTCAGAGG - Intergenic
1053112830 9:35477580-35477602 GAGCCACTTTGCCCAGTCTTTGG - Intergenic
1055294973 9:74824973-74824995 GAGCCACCATGCCCAGCCTGTGG - Intronic
1056691149 9:88809682-88809704 AGGCAGCTGTGCCCAGACTGTGG + Intergenic
1056824655 9:89868505-89868527 GAGCACCCATGCCCACTGTGCGG - Intergenic
1057125275 9:92611533-92611555 CAGCAGATATGCCCAGTATGGGG + Intronic
1057223071 9:93268187-93268209 GGGCAGCTGTCCCCAGACTGGGG - Intronic
1057721223 9:97533733-97533755 GAGCACCAGTGCCCCGTCTGTGG + Intronic
1058500922 9:105615166-105615188 GAGCCACTGTGCCCAGCCTGGGG + Intronic
1059109130 9:111538228-111538250 GAGCCGCCATGCCCAGCCCGTGG - Intronic
1060294811 9:122336175-122336197 GAGCTGCTAAACCCAATCTGGGG - Intergenic
1061231994 9:129320628-129320650 GAGGAGCTGTGCTCAGTCTTGGG - Intergenic
1061504599 9:131024807-131024829 GAGGAGCTCTGTCCAGTGTGGGG + Intronic
1061990716 9:134157209-134157231 GAGCAGCTTCACCCAGCCTGGGG + Intronic
1185493803 X:539089-539111 GAGCCACTGCGCCCAGTCTGTGG - Intergenic
1185772845 X:2778456-2778478 GATCACCTGTGCCCAGGCTGAGG + Intronic
1186520906 X:10205901-10205923 GAGCCACTGTGCCCAGCCTGGGG + Intronic
1187497005 X:19803886-19803908 GAGCCACTGTGCCCAGCCTGGGG - Intronic
1188137198 X:26504857-26504879 GAGGCGGTATGCCCACTCTGGGG - Intergenic
1188416374 X:29940145-29940167 GAGCCACCGTGCCCAGTCTGAGG + Intronic
1188835337 X:34948055-34948077 AAGCAGCTGTGGCCAGGCTGGGG - Intergenic
1188837608 X:34978065-34978087 AAGCAGGTATGGCCAGGCTGGGG - Intergenic
1189007979 X:37014829-37014851 AAGCAGCTGTGGCCAGGCTGGGG - Intergenic
1191067810 X:56368504-56368526 GAGCTACCATGCCCAGCCTGTGG + Intergenic
1194055518 X:89127317-89127339 AAGCAGGTATGACCAGTCTGGGG + Intergenic
1195269932 X:103219577-103219599 GAGCCACCACGCCCAGTCTGGGG - Intergenic
1195888742 X:109670300-109670322 GAGCCACTATGCCCAGCCTGTGG - Intronic
1198769881 X:140119112-140119134 GAGCCACCATGCTCAGTCTGAGG - Intergenic
1200379242 X:155817363-155817385 CATAGGCTATGCCCAGTCTGAGG + Intergenic
1201985029 Y:19956841-19956863 AAGCAGGCATGGCCAGTCTGGGG - Intergenic