ID: 1183989816

View in Genome Browser
Species Human (GRCh38)
Location 22:41590141-41590163
Sequence GGGTTGATAGTGATTGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183989811_1183989816 7 Left 1183989811 22:41590111-41590133 CCGGAAGACAGGGGCGGGGCCAG No data
Right 1183989816 22:41590141-41590163 GGGTTGATAGTGATTGCAACAGG No data
1183989802_1183989816 30 Left 1183989802 22:41590088-41590110 CCGCAGGAAGTGAGAGGGTGAAC 0: 1
1: 0
2: 2
3: 18
4: 248
Right 1183989816 22:41590141-41590163 GGGTTGATAGTGATTGCAACAGG No data
1183989810_1183989816 8 Left 1183989810 22:41590110-41590132 CCCGGAAGACAGGGGCGGGGCCA No data
Right 1183989816 22:41590141-41590163 GGGTTGATAGTGATTGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183989816 Original CRISPR GGGTTGATAGTGATTGCAAC AGG Intergenic