ID: 1183989816 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:41590141-41590163 |
Sequence | GGGTTGATAGTGATTGCAAC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1183989811_1183989816 | 7 | Left | 1183989811 | 22:41590111-41590133 | CCGGAAGACAGGGGCGGGGCCAG | No data | ||
Right | 1183989816 | 22:41590141-41590163 | GGGTTGATAGTGATTGCAACAGG | No data | ||||
1183989802_1183989816 | 30 | Left | 1183989802 | 22:41590088-41590110 | CCGCAGGAAGTGAGAGGGTGAAC | 0: 1 1: 0 2: 2 3: 18 4: 248 |
||
Right | 1183989816 | 22:41590141-41590163 | GGGTTGATAGTGATTGCAACAGG | No data | ||||
1183989810_1183989816 | 8 | Left | 1183989810 | 22:41590110-41590132 | CCCGGAAGACAGGGGCGGGGCCA | No data | ||
Right | 1183989816 | 22:41590141-41590163 | GGGTTGATAGTGATTGCAACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1183989816 | Original CRISPR | GGGTTGATAGTGATTGCAAC AGG | Intergenic | ||