ID: 1183990667

View in Genome Browser
Species Human (GRCh38)
Location 22:41595251-41595273
Sequence GGATCCAAGCACTACGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183990667_1183990679 12 Left 1183990667 22:41595251-41595273 CCCTACCCGTAGTGCTTGGATCC No data
Right 1183990679 22:41595286-41595308 AGGTGGCCCACTGGGCAGGAGGG No data
1183990667_1183990676 4 Left 1183990667 22:41595251-41595273 CCCTACCCGTAGTGCTTGGATCC No data
Right 1183990676 22:41595278-41595300 CATCTGGAAGGTGGCCCACTGGG No data
1183990667_1183990678 11 Left 1183990667 22:41595251-41595273 CCCTACCCGTAGTGCTTGGATCC No data
Right 1183990678 22:41595285-41595307 AAGGTGGCCCACTGGGCAGGAGG No data
1183990667_1183990677 8 Left 1183990667 22:41595251-41595273 CCCTACCCGTAGTGCTTGGATCC No data
Right 1183990677 22:41595282-41595304 TGGAAGGTGGCCCACTGGGCAGG No data
1183990667_1183990675 3 Left 1183990667 22:41595251-41595273 CCCTACCCGTAGTGCTTGGATCC No data
Right 1183990675 22:41595277-41595299 ACATCTGGAAGGTGGCCCACTGG No data
1183990667_1183990683 29 Left 1183990667 22:41595251-41595273 CCCTACCCGTAGTGCTTGGATCC No data
Right 1183990683 22:41595303-41595325 GGAGGGGTGTTTGTCTCCTATGG No data
1183990667_1183990672 -8 Left 1183990667 22:41595251-41595273 CCCTACCCGTAGTGCTTGGATCC No data
Right 1183990672 22:41595266-41595288 TTGGATCCAGAACATCTGGAAGG No data
1183990667_1183990680 13 Left 1183990667 22:41595251-41595273 CCCTACCCGTAGTGCTTGGATCC No data
Right 1183990680 22:41595287-41595309 GGTGGCCCACTGGGCAGGAGGGG No data
1183990667_1183990673 -5 Left 1183990667 22:41595251-41595273 CCCTACCCGTAGTGCTTGGATCC No data
Right 1183990673 22:41595269-41595291 GATCCAGAACATCTGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183990667 Original CRISPR GGATCCAAGCACTACGGGTA GGG (reversed) Intergenic
No off target data available for this crispr