ID: 1183990669

View in Genome Browser
Species Human (GRCh38)
Location 22:41595256-41595278
Sequence GTTCTGGATCCAAGCACTAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183990669_1183990679 7 Left 1183990669 22:41595256-41595278 CCCGTAGTGCTTGGATCCAGAAC No data
Right 1183990679 22:41595286-41595308 AGGTGGCCCACTGGGCAGGAGGG No data
1183990669_1183990683 24 Left 1183990669 22:41595256-41595278 CCCGTAGTGCTTGGATCCAGAAC No data
Right 1183990683 22:41595303-41595325 GGAGGGGTGTTTGTCTCCTATGG No data
1183990669_1183990684 29 Left 1183990669 22:41595256-41595278 CCCGTAGTGCTTGGATCCAGAAC No data
Right 1183990684 22:41595308-41595330 GGTGTTTGTCTCCTATGGACTGG No data
1183990669_1183990678 6 Left 1183990669 22:41595256-41595278 CCCGTAGTGCTTGGATCCAGAAC No data
Right 1183990678 22:41595285-41595307 AAGGTGGCCCACTGGGCAGGAGG No data
1183990669_1183990675 -2 Left 1183990669 22:41595256-41595278 CCCGTAGTGCTTGGATCCAGAAC No data
Right 1183990675 22:41595277-41595299 ACATCTGGAAGGTGGCCCACTGG No data
1183990669_1183990677 3 Left 1183990669 22:41595256-41595278 CCCGTAGTGCTTGGATCCAGAAC No data
Right 1183990677 22:41595282-41595304 TGGAAGGTGGCCCACTGGGCAGG No data
1183990669_1183990680 8 Left 1183990669 22:41595256-41595278 CCCGTAGTGCTTGGATCCAGAAC No data
Right 1183990680 22:41595287-41595309 GGTGGCCCACTGGGCAGGAGGGG No data
1183990669_1183990673 -10 Left 1183990669 22:41595256-41595278 CCCGTAGTGCTTGGATCCAGAAC No data
Right 1183990673 22:41595269-41595291 GATCCAGAACATCTGGAAGGTGG No data
1183990669_1183990676 -1 Left 1183990669 22:41595256-41595278 CCCGTAGTGCTTGGATCCAGAAC No data
Right 1183990676 22:41595278-41595300 CATCTGGAAGGTGGCCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183990669 Original CRISPR GTTCTGGATCCAAGCACTAC GGG (reversed) Intergenic