ID: 1183990670

View in Genome Browser
Species Human (GRCh38)
Location 22:41595257-41595279
Sequence TGTTCTGGATCCAAGCACTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183990670_1183990676 -2 Left 1183990670 22:41595257-41595279 CCGTAGTGCTTGGATCCAGAACA No data
Right 1183990676 22:41595278-41595300 CATCTGGAAGGTGGCCCACTGGG No data
1183990670_1183990680 7 Left 1183990670 22:41595257-41595279 CCGTAGTGCTTGGATCCAGAACA No data
Right 1183990680 22:41595287-41595309 GGTGGCCCACTGGGCAGGAGGGG No data
1183990670_1183990679 6 Left 1183990670 22:41595257-41595279 CCGTAGTGCTTGGATCCAGAACA No data
Right 1183990679 22:41595286-41595308 AGGTGGCCCACTGGGCAGGAGGG No data
1183990670_1183990683 23 Left 1183990670 22:41595257-41595279 CCGTAGTGCTTGGATCCAGAACA No data
Right 1183990683 22:41595303-41595325 GGAGGGGTGTTTGTCTCCTATGG No data
1183990670_1183990675 -3 Left 1183990670 22:41595257-41595279 CCGTAGTGCTTGGATCCAGAACA No data
Right 1183990675 22:41595277-41595299 ACATCTGGAAGGTGGCCCACTGG No data
1183990670_1183990678 5 Left 1183990670 22:41595257-41595279 CCGTAGTGCTTGGATCCAGAACA No data
Right 1183990678 22:41595285-41595307 AAGGTGGCCCACTGGGCAGGAGG No data
1183990670_1183990677 2 Left 1183990670 22:41595257-41595279 CCGTAGTGCTTGGATCCAGAACA No data
Right 1183990677 22:41595282-41595304 TGGAAGGTGGCCCACTGGGCAGG No data
1183990670_1183990684 28 Left 1183990670 22:41595257-41595279 CCGTAGTGCTTGGATCCAGAACA No data
Right 1183990684 22:41595308-41595330 GGTGTTTGTCTCCTATGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183990670 Original CRISPR TGTTCTGGATCCAAGCACTA CGG (reversed) Intergenic
No off target data available for this crispr