ID: 1183990672

View in Genome Browser
Species Human (GRCh38)
Location 22:41595266-41595288
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183990667_1183990672 -8 Left 1183990667 22:41595251-41595273 CCCTACCCGTAGTGCTTGGATCC No data
Right 1183990672 22:41595266-41595288 TTGGATCCAGAACATCTGGAAGG No data
1183990662_1183990672 23 Left 1183990662 22:41595220-41595242 CCTAGAAACAGATGAAGTGCGAA No data
Right 1183990672 22:41595266-41595288 TTGGATCCAGAACATCTGGAAGG No data
1183990665_1183990672 -2 Left 1183990665 22:41595245-41595267 CCTGGGCCCTACCCGTAGTGCTT No data
Right 1183990672 22:41595266-41595288 TTGGATCCAGAACATCTGGAAGG No data
1183990668_1183990672 -9 Left 1183990668 22:41595252-41595274 CCTACCCGTAGTGCTTGGATCCA No data
Right 1183990672 22:41595266-41595288 TTGGATCCAGAACATCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183990672 Original CRISPR TTGGATCCAGAACATCTGGA AGG Intergenic