ID: 1183990674

View in Genome Browser
Species Human (GRCh38)
Location 22:41595272-41595294
Sequence GGGCCACCTTCCAGATGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183990674_1183990684 13 Left 1183990674 22:41595272-41595294 CCAGAACATCTGGAAGGTGGCCC No data
Right 1183990684 22:41595308-41595330 GGTGTTTGTCTCCTATGGACTGG No data
1183990674_1183990679 -9 Left 1183990674 22:41595272-41595294 CCAGAACATCTGGAAGGTGGCCC No data
Right 1183990679 22:41595286-41595308 AGGTGGCCCACTGGGCAGGAGGG No data
1183990674_1183990683 8 Left 1183990674 22:41595272-41595294 CCAGAACATCTGGAAGGTGGCCC No data
Right 1183990683 22:41595303-41595325 GGAGGGGTGTTTGTCTCCTATGG No data
1183990674_1183990678 -10 Left 1183990674 22:41595272-41595294 CCAGAACATCTGGAAGGTGGCCC No data
Right 1183990678 22:41595285-41595307 AAGGTGGCCCACTGGGCAGGAGG No data
1183990674_1183990680 -8 Left 1183990674 22:41595272-41595294 CCAGAACATCTGGAAGGTGGCCC No data
Right 1183990680 22:41595287-41595309 GGTGGCCCACTGGGCAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183990674 Original CRISPR GGGCCACCTTCCAGATGTTC TGG (reversed) Intergenic
No off target data available for this crispr