ID: 1183990679

View in Genome Browser
Species Human (GRCh38)
Location 22:41595286-41595308
Sequence AGGTGGCCCACTGGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183990669_1183990679 7 Left 1183990669 22:41595256-41595278 CCCGTAGTGCTTGGATCCAGAAC No data
Right 1183990679 22:41595286-41595308 AGGTGGCCCACTGGGCAGGAGGG No data
1183990667_1183990679 12 Left 1183990667 22:41595251-41595273 CCCTACCCGTAGTGCTTGGATCC No data
Right 1183990679 22:41595286-41595308 AGGTGGCCCACTGGGCAGGAGGG No data
1183990670_1183990679 6 Left 1183990670 22:41595257-41595279 CCGTAGTGCTTGGATCCAGAACA No data
Right 1183990679 22:41595286-41595308 AGGTGGCCCACTGGGCAGGAGGG No data
1183990665_1183990679 18 Left 1183990665 22:41595245-41595267 CCTGGGCCCTACCCGTAGTGCTT No data
Right 1183990679 22:41595286-41595308 AGGTGGCCCACTGGGCAGGAGGG No data
1183990674_1183990679 -9 Left 1183990674 22:41595272-41595294 CCAGAACATCTGGAAGGTGGCCC No data
Right 1183990679 22:41595286-41595308 AGGTGGCCCACTGGGCAGGAGGG No data
1183990668_1183990679 11 Left 1183990668 22:41595252-41595274 CCTACCCGTAGTGCTTGGATCCA No data
Right 1183990679 22:41595286-41595308 AGGTGGCCCACTGGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183990679 Original CRISPR AGGTGGCCCACTGGGCAGGA GGG Intergenic
No off target data available for this crispr