ID: 1183990684

View in Genome Browser
Species Human (GRCh38)
Location 22:41595308-41595330
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183990669_1183990684 29 Left 1183990669 22:41595256-41595278 CCCGTAGTGCTTGGATCCAGAAC No data
Right 1183990684 22:41595308-41595330 GGTGTTTGTCTCCTATGGACTGG No data
1183990682_1183990684 -8 Left 1183990682 22:41595293-41595315 CCACTGGGCAGGAGGGGTGTTTG No data
Right 1183990684 22:41595308-41595330 GGTGTTTGTCTCCTATGGACTGG No data
1183990674_1183990684 13 Left 1183990674 22:41595272-41595294 CCAGAACATCTGGAAGGTGGCCC No data
Right 1183990684 22:41595308-41595330 GGTGTTTGTCTCCTATGGACTGG No data
1183990670_1183990684 28 Left 1183990670 22:41595257-41595279 CCGTAGTGCTTGGATCCAGAACA No data
Right 1183990684 22:41595308-41595330 GGTGTTTGTCTCCTATGGACTGG No data
1183990681_1183990684 -7 Left 1183990681 22:41595292-41595314 CCCACTGGGCAGGAGGGGTGTTT No data
Right 1183990684 22:41595308-41595330 GGTGTTTGTCTCCTATGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183990684 Original CRISPR GGTGTTTGTCTCCTATGGAC TGG Intergenic