ID: 1183993784

View in Genome Browser
Species Human (GRCh38)
Location 22:41617997-41618019
Sequence GAGGAAGAAGTAGCCACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 368}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183993784 Original CRISPR GAGGAAGAAGTAGCCACAGG AGG (reversed) Intronic
900326832 1:2112394-2112416 GAGGATGAACGAGCCTCAGGCGG + Intronic
900812849 1:4821117-4821139 AATGAAGATGTAACCACAGGAGG + Intergenic
900867508 1:5278725-5278747 ATGGAAGAGGAAGCCACAGGAGG - Intergenic
901182089 1:7348689-7348711 GGAGAAAAAGCAGCCACAGGGGG + Intronic
901197913 1:7450517-7450539 GATGCAGAAGTAGAGACAGGTGG + Intronic
901705114 1:11067650-11067672 GAGGAAAAAGTAAGCACATGTGG - Intronic
901871332 1:12140758-12140780 TAGGGAGAAGGAGCCACAGCTGG - Intronic
902722019 1:18310053-18310075 GAGGCACATGCAGCCACAGGCGG - Intronic
902839970 1:19068378-19068400 GAGCCAGGAGTAGCCAGAGGAGG + Intergenic
905115019 1:35631140-35631162 AATGAACAAGTAGCAACAGGAGG + Intronic
905433879 1:37943783-37943805 CTGGAAGAAGGTGCCACAGGGGG - Exonic
907267959 1:53274290-53274312 GAGGGAGAAGTGGGCACAGCAGG - Intronic
907437890 1:54461233-54461255 GGGGAAGAGGTAGACACAGGAGG - Intergenic
908022780 1:59915561-59915583 CAGGAAGAAGCAGCAGCAGGAGG + Intronic
908344852 1:63221847-63221869 CAGAAAGAAGTGGCCACAGCAGG + Intergenic
908393241 1:63702532-63702554 CAGGAAGCTGTAGCCACAGGAGG + Intergenic
908745266 1:67370456-67370478 GAGGAAGAAGAAGGCATAAGAGG - Intronic
910387361 1:86699820-86699842 GAGTAAGAAGTAGACTCAGTTGG + Intergenic
912525899 1:110282276-110282298 GAGGGAGAAGTCATCACAGGTGG - Intronic
912735540 1:112146680-112146702 GGGGAAGAAATAGCCAAGGGGGG - Intergenic
913331412 1:117671219-117671241 GAGGAAAAAGAAGCCAGAGGGGG + Intergenic
913481544 1:119293923-119293945 GAGGAAGCAAGAGCCAGAGGAGG - Intergenic
914252401 1:145932457-145932479 TAGAAAGAAGTAGACATAGGAGG + Intergenic
914387018 1:147179597-147179619 CAAGAAGAAGAAGGCACAGGAGG + Intronic
914444185 1:147735796-147735818 GAGATGGAAGAAGCCACAGGAGG + Intergenic
914919908 1:151839607-151839629 GGGGAAGGAGGAGCCAGAGGAGG - Intronic
915099850 1:153491305-153491327 GGGGAAGAAGCAGCCCCAGCTGG - Intergenic
915826788 1:159086512-159086534 GAGTAAGAATTAGCCAGATGGGG - Intronic
916002134 1:160627151-160627173 GAGGAAGTTGAAGCCACAGAGGG - Intronic
916332141 1:163628570-163628592 GAGGAAGAAGAAGGAAGAGGAGG - Intergenic
916415457 1:164588600-164588622 AAGGAAGAAGGAACCAGAGGTGG - Intronic
916730755 1:167564774-167564796 GTGTAAGGAGTAGCCACTGGAGG - Intergenic
917211151 1:172633172-172633194 AAGGAAGAAGGGGCCCCAGGTGG - Intergenic
917715219 1:177728573-177728595 GAGGAAGAAGGAAGGACAGGAGG + Intergenic
917956642 1:180106286-180106308 GAGAAAGACGTAGAGACAGGAGG - Intronic
920013966 1:202890688-202890710 AAGGAAGGAGGAGCCACATGAGG - Intergenic
920025809 1:202994674-202994696 GAGGAAGAAGAAATCACAGAGGG + Intergenic
920859873 1:209697024-209697046 GGGGATGAAGAAGCCACAGAGGG + Intronic
921640894 1:217552461-217552483 GTAGTAAAAGTAGCCACAGGAGG + Intronic
922585605 1:226732954-226732976 GATGAAGAAAGCGCCACAGGAGG + Intronic
922755257 1:228093051-228093073 GAAAGAGAAGTAGCCACTGGTGG + Intronic
922951707 1:229563218-229563240 GAGGGACAAGCACCCACAGGTGG - Intergenic
923339744 1:232997161-232997183 TTGGAAAAAGTAGCCACAGTTGG + Intronic
923893614 1:238243132-238243154 CAGGAAGAAGCAGCCACAGGAGG - Intergenic
924434459 1:244026565-244026587 GAGGTAGAAGTGGCCACAGATGG - Intergenic
1064115572 10:12574633-12574655 GAGGAAGAAGTCAGCAAAGGAGG - Intronic
1065773821 10:29101357-29101379 CAGGATGGAGCAGCCACAGGAGG + Intergenic
1066703316 10:38152484-38152506 GAGGAAGAAGCTTCCACAGTAGG - Intergenic
1066987467 10:42480732-42480754 GAGGAAGAAGCTTCCACAGTAGG + Intergenic
1068478405 10:57558086-57558108 GAGGAAGAAGAAGCAGGAGGAGG + Intergenic
1068886240 10:62099820-62099842 GAGTAACAACTAGCCACATGTGG - Intergenic
1070345452 10:75537275-75537297 GAGCCAGAAGTAGCCACAAGTGG - Intronic
1070412738 10:76158264-76158286 CAGGAAGAAGGAGGCAAAGGGGG - Intronic
1071322632 10:84479104-84479126 GAGGCTGAAGGAGCCAGAGGTGG - Intronic
1074103738 10:110374002-110374024 GAGGAAGAACAAGCCACATGGGG + Intergenic
1075227102 10:120639543-120639565 TAGGAAGAAGTATCCACTGCAGG + Intergenic
1075310090 10:121406531-121406553 GAGGAATAAGAAGCTTCAGGAGG + Intergenic
1075423963 10:122327463-122327485 GTGGGAGCAGTAGCCACAGGTGG - Intronic
1082567845 11:54701419-54701441 GAGGGAGAAGAAGCGACAGCAGG - Intergenic
1083758026 11:64801838-64801860 GAGGAAGAAGCAGCCTGAGTGGG - Intronic
1084365296 11:68693613-68693635 GAGGTAGATGATGCCACAGGGGG - Intergenic
1084406454 11:68976767-68976789 GGGGAAGAAGAGGCCACAGGGGG + Intergenic
1085249982 11:75136690-75136712 GAGGAAGATGAAGTCACAGAAGG - Intronic
1086598185 11:88600248-88600270 GAGGAAGAAGGAGGAAGAGGAGG - Intronic
1088347289 11:108841363-108841385 GAGGAAGATGATGACACAGGTGG + Exonic
1090823220 11:130363740-130363762 GAGGAAGTAGGAGGCAAAGGAGG - Intergenic
1090839771 11:130477697-130477719 AAGGAAGAACTAGCCAGAAGAGG + Intergenic
1091157538 11:133387350-133387372 AAGGAGGAAGCAGCCACCGGCGG + Intronic
1091469684 12:715872-715894 GATAGAGAAGTAGCCACAGAGGG - Intergenic
1091718726 12:2797006-2797028 GAGGGACAAGTAGGCAGAGGAGG + Intronic
1091750089 12:3016943-3016965 GAGGCAGGAGGGGCCACAGGAGG + Intronic
1092335500 12:7629125-7629147 CCTGAAGAAGTTGCCACAGGAGG - Intergenic
1092446667 12:8564455-8564477 CCTGAAGAAGTTGCCACAGGAGG + Intergenic
1094496224 12:30990986-30991008 GAGGAGGAAGAAGGCAGAGGAGG + Intronic
1096323436 12:50636485-50636507 GAGGAAAAAGAAGCCCCAAGAGG - Intronic
1096787029 12:54022927-54022949 GAGGAAGAAGCCGCAATAGGGGG - Intronic
1097369964 12:58766374-58766396 GAGGAAGAAGAAGAAAGAGGAGG + Intronic
1098850124 12:75586134-75586156 GAGGAAGATATAGCCACACTTGG + Intergenic
1100328539 12:93564917-93564939 GAGGAAGAAATGGTCACTGGTGG + Intergenic
1100909451 12:99341516-99341538 GAGAAGGCAGTAGCCACATGTGG - Intronic
1104058533 12:125248815-125248837 GGGGAAAAAGCAGCCACAGTGGG - Intronic
1104265664 12:127230530-127230552 GAAGAAAAAGTAGACACAGCAGG + Intergenic
1104266553 12:127238669-127238691 GAGGAAAAAGAAGGCATAGGAGG + Intergenic
1104587683 12:130060695-130060717 GAGAAGGAAGAAGCCACATGAGG + Intergenic
1104771251 12:131366217-131366239 GGGGAAGAAGCAGCCACCTGGGG - Intergenic
1105896334 13:24719646-24719668 GAGGAAGAAGAAGCAGAAGGAGG + Intergenic
1107720349 13:43242067-43242089 GATGAGGCAGTAGACACAGGTGG - Intronic
1107815489 13:44240815-44240837 ATGGAAGAAGGAGCCACAAGGGG + Intergenic
1108024492 13:46163248-46163270 TAGAAAGAAGTAGACATAGGAGG + Intronic
1110092508 13:71470956-71470978 GAGGCAGAACTAGTCCCAGGGGG + Intronic
1111685777 13:91499144-91499166 GAGGAAGAACAAGTCAAAGGTGG + Intronic
1112855409 13:103763503-103763525 GAGAAAGAAGTAGTCAAGGGAGG - Intergenic
1113215199 13:108032056-108032078 GAGGAAGAAAGAGCCAGAGGGGG + Intergenic
1113457824 13:110461480-110461502 GCAGTGGAAGTAGCCACAGGTGG - Intronic
1114043632 14:18702473-18702495 AAGGAAAAAGAAGCCTCAGGTGG + Intergenic
1114047916 14:18892915-18892937 AAGGAAAAAGAAGCCTCAGGTGG + Intergenic
1114114602 14:19508728-19508750 AAGGAAAAAGAAGCCTCAGGTGG - Intergenic
1114116299 14:19626491-19626513 AAGGAAAAAGAAGCCTCAGGTGG - Intergenic
1115217501 14:31026978-31027000 GAGGAATCAGTAACCACAGCCGG - Intronic
1115796145 14:36937718-36937740 GAGGAAGAATCAGCCACACAGGG + Intronic
1116480844 14:45390440-45390462 TAGAAAGAAGTGGACACAGGAGG + Intergenic
1116863883 14:50015920-50015942 CAGGAAGAAGTTGCCATATGAGG + Intergenic
1116968812 14:51043331-51043353 GAGGAAGGAGTTTCCAAAGGGGG + Intronic
1117220630 14:53601614-53601636 AAGGACAAAGAAGCCACAGGGGG - Intergenic
1118717680 14:68571917-68571939 GGGGAAGAAGGAGCTACAAGAGG + Intronic
1118853928 14:69606560-69606582 GAGGAAGATCTAGGCTCAGGAGG - Intergenic
1119031438 14:71195931-71195953 GAGGCAAAAGAAGCCACAGGAGG - Intergenic
1119196530 14:72721079-72721101 GAGGACTCAGTAGCCACATGTGG + Intronic
1120085184 14:80263918-80263940 TAGGTAGAAGCAGCCAGAGGTGG - Intronic
1121538282 14:94706272-94706294 CAGGAAGCAGTGGCCACGGGAGG - Intergenic
1121643462 14:95501693-95501715 GTGGAGGAGGTGGCCACAGGAGG + Intergenic
1122325867 14:100880359-100880381 GATGAAGAAGCAGGCACAGCAGG - Intergenic
1122501378 14:102202260-102202282 GAGGAAGGAGCTGCCACAGGAGG - Intronic
1122600309 14:102918045-102918067 GAGGAAGGAGCCGCCACTGGGGG - Intergenic
1122670005 14:103364246-103364268 GAGGAAGAAGAAGAAAGAGGAGG - Intergenic
1123133606 14:106007703-106007725 GAGGAGGAAGCAGCCACTGTCGG + Intergenic
1123192320 14:106583178-106583200 GAGGCAGAAGATGTCACAGGAGG - Intergenic
1125547267 15:40515247-40515269 GAGAGAGAAGTAGCAGCAGGGGG - Intergenic
1125730627 15:41890882-41890904 GTGGAAGATGGAGCCACAGGGGG - Intronic
1125953172 15:43771188-43771210 GAAGAAGAAGAAGGCACAGGAGG + Exonic
1126117796 15:45224766-45224788 CAGAAAGAAGTGGTCACAGGAGG - Intergenic
1127327379 15:57908570-57908592 GAGGAAGAAATAGAACCAGGAGG + Intergenic
1128359942 15:66954936-66954958 AAGGAAGGTGTAGTCACAGGTGG - Intergenic
1129349999 15:74950429-74950451 GAGGAAAATGCAGCCACAGGAGG - Intergenic
1130134858 15:81174024-81174046 GAGGAAGAAGGAGCAGCAGAGGG + Intronic
1130186308 15:81687071-81687093 AAGGAAGAAGGAAGCACAGGAGG + Intergenic
1130226089 15:82059130-82059152 GAGGAGGAAGAAGCAGCAGGAGG - Intergenic
1130249066 15:82284516-82284538 GAGGAAGAACCAGCCCCAGCAGG + Exonic
1130391353 15:83458440-83458462 GAGGAAGATGTAGCCAGGGACGG - Intronic
1130450939 15:84051356-84051378 GAGGAAGAACCAGCCCCAGCAGG - Intergenic
1132518563 16:377132-377154 CTGGAAGACGTAGGCACAGGTGG + Exonic
1132666645 16:1083906-1083928 GAGGGAGACGTAGCCAGAGGCGG - Intergenic
1133255029 16:4511522-4511544 GAGGAAGGAGCAGCCACAAGTGG - Exonic
1133582798 16:7162798-7162820 GAGGAAGAAGGAGAAAGAGGAGG - Intronic
1135738032 16:24948831-24948853 AAGGAAAAAGTGGCCTCAGGTGG - Intronic
1138229830 16:55328792-55328814 GAGGAGGTAGTGGCCACAGCTGG + Exonic
1138938398 16:61759346-61759368 GAGGAAGAAGGAGGAAGAGGAGG + Intronic
1139514516 16:67445384-67445406 GAGGCAGAGATAGCGACAGGAGG + Intronic
1140920621 16:79534295-79534317 GAGGTAGAAGGAGACACAGGAGG - Intergenic
1142164814 16:88580620-88580642 GAGAAAGAGGCAGGCACAGGAGG - Intronic
1142300981 16:89257600-89257622 GAGGGAGCAGCAGCCACCGGCGG - Intergenic
1142782880 17:2195025-2195047 GAGGAAGACCTAGCAAGAGGCGG + Intronic
1143764857 17:9130726-9130748 GAGGAGGAAGAAACCACTGGAGG - Intronic
1143953393 17:10651377-10651399 GAGGAAGAAGGAGCCAAAAGAGG - Intronic
1145800923 17:27684142-27684164 AAGGAAAAAGAAGCCTCAGGTGG + Intergenic
1146055583 17:29579152-29579174 GAGGAAGAGCAAGCCAGAGGAGG - Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1146916755 17:36682890-36682912 GAGGAAGGAGAAGGCACAAGGGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1148196617 17:45718298-45718320 GAAGAAGAAGGAGGCAGAGGAGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149891857 17:60396959-60396981 GAAGAAAAAGCAGCCACTGGTGG - Intronic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150281512 17:63931903-63931925 GTGGAAGAACTAGGCTCAGGAGG - Intronic
1150630708 17:66878476-66878498 GAGGCAGAAGAAGCCAGAGTTGG - Intronic
1151292598 17:73161385-73161407 GAAGAAGAGGTAGCCCCATGTGG + Intergenic
1152294528 17:79459003-79459025 AAGGACGAAGTGGGCACAGGTGG - Intronic
1152702872 17:81828209-81828231 GAGGAAGAAGTAGGGAGAGGTGG - Intronic
1153185225 18:2478791-2478813 GAGGAAGAAGGAGAAAGAGGAGG + Intergenic
1153761307 18:8334886-8334908 GAGGATGAAGTGGGAACAGGAGG - Intronic
1154162783 18:11992279-11992301 CAGGAAGATGTGGCCACTGGAGG - Intronic
1157429989 18:47616741-47616763 GAGGAATAAGAAGCCACAGGTGG + Intergenic
1158625512 18:59068063-59068085 GATCAAGATGCAGCCACAGGGGG - Intergenic
1158644982 18:59237843-59237865 GAGGAAGAAGAAGGAAGAGGAGG + Intergenic
1160303168 18:77704820-77704842 GACGGAGAAGTTGCCACAGGTGG + Intergenic
1160393934 18:78558525-78558547 GAAGACGAAGCAGCTACAGGAGG - Intergenic
1160565492 18:79784388-79784410 GGGGAAGAAGTGGACACAGTCGG + Intergenic
1160571078 18:79818107-79818129 CAGGAAGAACGAGCCACAGAGGG + Intergenic
1161749790 19:6087267-6087289 GAGGGAGGAGTAGCCACCTGTGG - Intronic
1161957973 19:7506778-7506800 GAGGAGGAAGGAGCCAGGGGAGG - Intronic
1162329208 19:10017079-10017101 GGGGAAGAAGGAGACACTGGAGG + Exonic
1163113040 19:15172999-15173021 GAGGAAGAAGAAGGAAGAGGGGG - Intronic
1163606573 19:18279183-18279205 CAGGAGGAAGTTGGCACAGGTGG - Intergenic
1164156117 19:22598374-22598396 GAGGAAGGAGAATCCACAGGAGG - Intergenic
1164908972 19:31990149-31990171 GAGAAAGCAGTAGCCACAGAAGG - Intergenic
1165345637 19:35247753-35247775 GAGTGAGGAGGAGCCACAGGAGG + Intergenic
1165595353 19:37008004-37008026 CAGGATGAAGAAACCACAGGCGG + Intronic
1165596171 19:37012523-37012545 CAGGATGATGAAGCCACAGGCGG + Intronic
1165601695 19:37059548-37059570 GAGGATGACGAAACCACAGGCGG + Intronic
1165733895 19:38163833-38163855 GAGTAAGATGGAGCCACAGGTGG + Intronic
1166346413 19:42168894-42168916 GAGGAAAAAGGGGCTACAGGAGG - Intronic
1166846577 19:45732137-45732159 GAAGAAGAAGAAGCTCCAGGAGG + Intergenic
1166997419 19:46726345-46726367 CAGGTAAAAGTAGCCACAGACGG + Intronic
1167015550 19:46838698-46838720 GAGGCTGAAGGAGCCAGAGGAGG - Intronic
1168178979 19:54646678-54646700 GCGGAAGAAGAAGACACTGGCGG - Intronic
1168236669 19:55068027-55068049 GAGAGAGAAGGAGACACAGGAGG - Intronic
1168348484 19:55662278-55662300 GAGGAAGCAGTAGCAAGAGACGG - Intronic
925255368 2:2481211-2481233 GAAGAAGAAGTAGCCAGCTGTGG - Intergenic
925361970 2:3286032-3286054 TAGGAAGATGGAGCCACAGCTGG - Intronic
927079114 2:19610340-19610362 GAGGAAGCAGTGGTCACAGGTGG - Intergenic
928198540 2:29231998-29232020 GAGGAAGAAGGAATCTCAGGGGG + Intronic
928221413 2:29406330-29406352 GAGGAAGAAATGGAAACAGGAGG - Intronic
928357857 2:30636899-30636921 GAGGTAGAAGGAGCTACATGGGG + Intronic
928918662 2:36502425-36502447 TAGGAAGAAATAGGTACAGGAGG + Intronic
929034718 2:37679745-37679767 CAGGAAGAGGAAGGCACAGGAGG - Intronic
931786464 2:65623321-65623343 GAGGATGAAGTAGATGCAGGTGG + Intergenic
932238655 2:70141064-70141086 GAGGCAGAAGAAGCCCCAGAGGG - Intergenic
934712121 2:96523090-96523112 GGGGAGGAAGCAGCCACAGATGG - Intergenic
934935680 2:98463679-98463701 CAGGAAGTAGTAGCCACCTGCGG + Intronic
934943512 2:98519770-98519792 GAGGAAGAAGTGACCAGAAGGGG + Intronic
935092085 2:99904998-99905020 GAGGAGGAAGAAGCCAGTGGTGG - Intronic
935262761 2:101369328-101369350 GAGGGAGAAGGAGCCACAGCTGG + Intronic
936716289 2:115190988-115191010 GAGGAAGAAGGAGGTGCAGGAGG + Intronic
937174137 2:119909828-119909850 GGGGAGGAAGTAACTACAGGTGG + Intronic
937904478 2:127046179-127046201 GTGGAGGAAATAGCAACAGGTGG - Intergenic
937916540 2:127101947-127101969 CAGGAAGAAGGTGCCACATGTGG + Intronic
938425291 2:131181438-131181460 AAGGAAAAAGAAGCCTCAGGTGG + Intronic
938641901 2:133289887-133289909 GAGGAAGAAGCAAGCAAAGGTGG + Intronic
938792282 2:134687311-134687333 GGGTAAGAAGTAGCCATGGGAGG + Intronic
938893361 2:135727294-135727316 GAGGTAGAAGCACACACAGGAGG + Intergenic
940216124 2:151305380-151305402 GAGGAAGAAGAAGAAAAAGGAGG + Intergenic
940670355 2:156660055-156660077 GAGGGAGAAGTAATTACAGGTGG - Intergenic
940932976 2:159457834-159457856 GAGGAGGAAGTAGACATAGCAGG - Intronic
941802375 2:169674175-169674197 CAGGATGAAGCAGCCACATGGGG - Intronic
942738374 2:179142563-179142585 AAGGAAGCAGTAGGCACAGTGGG - Intronic
948230817 2:236348246-236348268 CAGGAGAAAGTTGCCACAGGAGG + Intronic
948385494 2:237578187-237578209 GAGGACGAGGTTGCCACATGCGG + Intronic
948410902 2:237759854-237759876 GAGAAAGAAGTAGCCTTTGGAGG + Intronic
948455967 2:238104808-238104830 GAGGGAGTAGTGGCCACGGGCGG - Exonic
1169301410 20:4444899-4444921 GAGGAATAAAAAGCCACAGTTGG - Intergenic
1169997731 20:11577270-11577292 GAGGAAGAAATAGACAAGGGCGG - Intergenic
1170094704 20:12633297-12633319 GAGGAAGAAGAAGAGAAAGGGGG - Intergenic
1170363393 20:15572828-15572850 GAGAAAGATGTAGCCCCAGGAGG + Intronic
1170939879 20:20839948-20839970 GAGGAAGTAATAGACAGAGGAGG - Intergenic
1171069166 20:22049577-22049599 GAGGAAGGAGCACCAACAGGAGG - Intergenic
1171227522 20:23453560-23453582 GAGAAGGAAGAAGCCACTGGTGG + Intergenic
1171277546 20:23870741-23870763 GAGTAAGAAGGAGCAGCAGGAGG + Intergenic
1171559375 20:26108926-26108948 AAAAAACAAGTAGCCACAGGGGG + Intergenic
1171784186 20:29448155-29448177 GAGGCAGAGGTAGCCAGACGAGG + Intergenic
1173257416 20:41404754-41404776 GAAGAAGAAGAAGACAAAGGGGG - Exonic
1176651577 21:9553136-9553158 AAAAAACAAGTAGCCACAGGGGG - Intergenic
1178699540 21:34821157-34821179 GAGGAATAAGGAGACACCGGGGG + Intronic
1179142876 21:38742159-38742181 GAGGAAGAAGTAGAGAAGGGAGG + Intergenic
1180466452 22:15615591-15615613 AAGGAAAAAGAAGCCTCAGGTGG + Intergenic
1181260573 22:21594263-21594285 CAGGAAGAAGCATCTACAGGAGG - Intronic
1181291427 22:21796946-21796968 CAGGGAGAAGTAGCCAGAGAGGG - Intronic
1181403981 22:22668853-22668875 GAGGAAGAAGGTGACACAGATGG - Intergenic
1181594791 22:23907127-23907149 TAGAAAGAAGTAGACATAGGAGG + Intergenic
1182379072 22:29871904-29871926 GAGGAAGAGGTACTCTCAGGAGG + Intergenic
1182656842 22:31897507-31897529 GACTAACAAGAAGCCACAGGAGG - Exonic
1183330078 22:37214756-37214778 GAGGAACAGGTGGCCATAGGAGG - Intergenic
1183354874 22:37352808-37352830 ATGCAAGAAGTAGCCACTGGAGG + Intergenic
1183725600 22:39587550-39587572 GAGGCAGCTGTGGCCACAGGTGG + Intronic
1183762337 22:39833104-39833126 CAAGAAGAAGTAGCCTTAGGGGG - Intronic
1183945697 22:41324618-41324640 GAGGGAGCATTAGCCACAGGAGG + Intronic
1183993784 22:41617997-41618019 GAGGAAGAAGTAGCCACAGGAGG - Intronic
1184673277 22:46027016-46027038 GAGGAAGAATTTGCCCCAAGGGG + Intergenic
949716755 3:6941011-6941033 GAGGCTTAAGTGGCCACAGGCGG - Intronic
950976160 3:17247963-17247985 GTGGAGGAAGTAACCACATGGGG - Intronic
952858922 3:37795960-37795982 GAGGAATGAGAAGCCACTGGAGG - Intronic
953830754 3:46295717-46295739 GAGGAAGAAGAAGTCAAAGATGG + Intergenic
954138467 3:48593193-48593215 GAAGAAGAAGAAGTCACTGGTGG + Exonic
954460741 3:50625517-50625539 GGGGAACAAGGAGCCTCAGGAGG + Intronic
954623953 3:52012231-52012253 GAGGCAGAAGTCACAACAGGAGG - Intergenic
956123537 3:65990109-65990131 GAGGAAGTAGCAGACACAGGAGG + Intronic
956989362 3:74745391-74745413 GAGGAAGAAGTAGTAAGAGGAGG - Intergenic
957171590 3:76744270-76744292 GAAGAAGAAGAAGTAACAGGCGG - Intronic
958118451 3:89253549-89253571 TAGAAAGAAATATCCACAGGTGG + Intronic
959315661 3:104803117-104803139 GAGGAAAAAGAAGAAACAGGAGG + Intergenic
959827352 3:110814425-110814447 GATGAGGAAATACCCACAGGCGG + Intergenic
960818200 3:121696130-121696152 GAGGATAAAGCAGCTACAGGTGG - Exonic
961079586 3:124014728-124014750 GAGGAAGAAGTAAGAAGAGGAGG - Intergenic
961163032 3:124745652-124745674 AAGGAAGAAGTGGCCACAGAAGG + Intergenic
962481942 3:135805700-135805722 GAGGAAGAATTATCCAACGGAGG + Intergenic
962935540 3:140077275-140077297 AAGGAAGAGGTAGCCACTGGCGG - Intronic
965617111 3:170605489-170605511 GAGTAAGAAGTAACCACCAGGGG - Intronic
966594477 3:181713114-181713136 GAGGAAGAGGTAACCACAGGGGG - Exonic
967815571 3:193795672-193795694 GAGGCAGGAGTGGACACAGGTGG - Intergenic
968518561 4:1024922-1024944 GAGGACGAGGAGGCCACAGGTGG - Exonic
969049851 4:4365023-4365045 GAGGAAGGAGTTGCCACCTGAGG - Intronic
971551877 4:27967503-27967525 GAAGAAAAAGCAGACACAGGTGG + Intergenic
971950853 4:33343718-33343740 AATGAGGAGGTAGCCACAGGTGG + Intergenic
972775645 4:42237437-42237459 AAGGAAGAAGTGGGGACAGGTGG + Intergenic
974237888 4:59205966-59205988 CAGAATGAAGTAGCCACATGAGG + Intergenic
974382468 4:61159155-61159177 AAGAAAGCAGTATCCACAGGTGG + Intergenic
974633736 4:64530670-64530692 GAGTTAGAAGTAGCAACAGATGG - Intergenic
976294518 4:83456113-83456135 GAGGAAGAAGTTGACACACTTGG + Exonic
976383896 4:84433372-84433394 GAGAAAGAAGCAGAGACAGGTGG + Intergenic
980079870 4:128332897-128332919 GAGGAAGAAGAAGCAAGAGGAGG + Intergenic
980425667 4:132624624-132624646 GAAGAAGGAGTAGGAACAGGAGG - Intergenic
981614651 4:146634136-146634158 GAGGAAAAAGAAGACACAAGAGG - Intergenic
981619329 4:146676301-146676323 GAGGAAGAAGAAGGAAAAGGAGG - Intergenic
982080335 4:151783486-151783508 CATGAAGAAGTAGGCAGAGGTGG - Intergenic
983940810 4:173532448-173532470 GAGGAAGAAGAGTCCAGAGGAGG + Intergenic
985485690 5:146874-146896 AAGTAAGAAGAAACCACAGGCGG - Intronic
985631335 5:1015632-1015654 GAGGAAGCAGGAGCCACTGCTGG + Intronic
985653855 5:1119882-1119904 GAGGCAGAAGCAGCCACAGGGGG - Intergenic
985993806 5:3585045-3585067 AAGGAAGAAGGAGGGACAGGAGG + Intergenic
986026210 5:3853788-3853810 GAGGAAGAAGGAGGAAGAGGAGG + Intergenic
986205970 5:5625559-5625581 GTGGAAAAAGTAGCCACAGCAGG + Intergenic
986374363 5:7115040-7115062 GAGCAAGATGAAGCAACAGGGGG + Intergenic
987291650 5:16513849-16513871 AAGGAAGAAGTGGACAGAGGTGG - Intronic
990439119 5:55826326-55826348 GAGGAAGAAGAAGGTAAAGGGGG + Intergenic
990662394 5:58030671-58030693 AAGGAAGAAATAGACACAGTAGG + Intergenic
992667858 5:79028621-79028643 GAAGAAGAAGCAGTCAAAGGTGG - Exonic
994886016 5:105562977-105562999 TAGAAAGAAGTGGCCACAGCAGG - Intergenic
996551761 5:124737949-124737971 GAGAAAGAATTAGACACAGAGGG + Intronic
997854875 5:137364256-137364278 GTTGATGAAGCAGCCACAGGTGG - Intronic
998354613 5:141524687-141524709 CAGGAAGACTTAGCCACTGGAGG - Intronic
998762328 5:145446440-145446462 GAGAAAGAGCTAGCCATAGGAGG + Intergenic
998900196 5:146845002-146845024 GATGAAGAAGTGGCCAAAAGTGG - Intronic
999094106 5:148962920-148962942 GAGGAAGAAAGAGCAGCAGGTGG + Intronic
999393139 5:151208830-151208852 GAGGAAGCAGAAGCCAGAGTGGG - Intronic
1001049721 5:168404470-168404492 GAGGCTGAAGTAACCGCAGGGGG + Intronic
1002915915 6:1527553-1527575 CAGGCAGAAGTAACCAGAGGAGG - Intergenic
1003128313 6:3373697-3373719 GAGGAAGCAGCAGCAACAGCAGG + Intronic
1004627590 6:17391564-17391586 GAGGAAGAAGTGTTCACTGGGGG + Intergenic
1007410283 6:41657420-41657442 GAGGGAGAAGCAGGGACAGGAGG + Intergenic
1008485945 6:52035897-52035919 AAGGGAGAAGTAGTGACAGGAGG + Intronic
1009788525 6:68369458-68369480 TAGGAAGAAGTAACCATAAGTGG + Intergenic
1010155802 6:72791164-72791186 GAGAAAGAGCCAGCCACAGGAGG + Intronic
1011417450 6:87137350-87137372 GAGGAAGAAGAAGAAGCAGGAGG - Intergenic
1011633507 6:89349864-89349886 GATGAAGAAGCTGCCAAAGGAGG + Intronic
1012099096 6:95007564-95007586 CAGGTAGAAGTAGCAACATGGGG - Intergenic
1012541040 6:100362078-100362100 GAGGGAGAAGAAGGCACAGTGGG + Intergenic
1012990661 6:105922582-105922604 GAGGAAGAAGGAGGAAGAGGAGG + Intergenic
1013272813 6:108559449-108559471 GAGGAAGAAGTGGGGAGAGGAGG - Intergenic
1014548162 6:122756219-122756241 GGGGAAGAATGAGCCAAAGGCGG - Intergenic
1016262033 6:142183264-142183286 GAGGAAGAATTAGAGACAGCTGG + Intronic
1016570552 6:145507640-145507662 CTGGAAGCAGTAGCCACAGCAGG + Intronic
1018422948 6:163655128-163655150 GAGGAAGAAAAAGCCAGAGCTGG - Intergenic
1018784735 6:167099129-167099151 GAGGAAGAAGGAGGAAGAGGAGG + Intergenic
1020807056 7:12802894-12802916 GATGAGAAAATAGCCACAGGAGG + Intergenic
1021395218 7:20139185-20139207 GAGCAAGAAGAAGCCACATTAGG - Exonic
1022037236 7:26546035-26546057 GAGGAAAAAGTAGCCAGATGGGG - Intergenic
1022536525 7:31101994-31102016 AAGGAAGGAGGAGACACAGGGGG - Intronic
1022850564 7:34257328-34257350 GGGGAAAGAGAAGCCACAGGGGG - Intergenic
1024591966 7:50894595-50894617 GAGGAAGGAGGAGCCACAAGAGG + Intergenic
1024764303 7:52639039-52639061 GAGTCAGATGTAGCCACAGGAGG + Intergenic
1025278256 7:57604138-57604160 AAAAAACAAGTAGCCACAGGGGG - Intergenic
1027937031 7:84619814-84619836 GAGGAAGAAGAAGAAAGAGGAGG - Intergenic
1030120020 7:106100909-106100931 AAGGAAAAAGTAGCAACATGAGG - Intronic
1030289085 7:107854672-107854694 GAGGGATATGTAGACACAGGTGG - Intergenic
1030837405 7:114306901-114306923 GTGGAAGAGGTAGGCAGAGGAGG - Intronic
1030943798 7:115690862-115690884 GGTGAAGAAGTAGCTACAGTGGG - Intergenic
1031009502 7:116511171-116511193 GGGGAAGAAGTTGACAGAGGAGG + Intergenic
1031377229 7:121042335-121042357 GAGGAAGAAATAACTACAGCAGG - Intronic
1032301270 7:130689585-130689607 TAGGAGGAAGTGGCCACAGGTGG + Intergenic
1032675091 7:134122550-134122572 CAGGAAGAAATAATCACAGGAGG - Intergenic
1032793916 7:135262502-135262524 GAAGAAGAAGAAGACAGAGGTGG + Intergenic
1033329207 7:140404125-140404147 GAGGAAGAAGGGGGCACTGGGGG + Exonic
1033529689 7:142249200-142249222 GAGCAAGAAGGAGGCACAGAGGG - Intergenic
1034289055 7:149913539-149913561 AAGGAAGAATAAGCCACATGTGG + Intergenic
1034662016 7:152779310-152779332 AAGGAAGAATAAGCCACATGTGG - Intronic
1035698182 8:1616723-1616745 GATAAAAAAGTAGCCACATGTGG - Intronic
1036458826 8:8933953-8933975 GAGGAAGAAGTTGACACACCTGG - Intergenic
1037586286 8:20278620-20278642 GAGAAAGAATTAGACAGAGGAGG - Intronic
1037804429 8:22051104-22051126 GAGCATGGAGTAGCCACAGGGGG + Intronic
1038671787 8:29588997-29589019 GAGGCAGAAGGAGGCACAAGAGG - Intergenic
1039197804 8:35051922-35051944 GTGGAAGAATTGACCACAGGTGG - Intergenic
1040616184 8:49041276-49041298 TAGAAAGAAGTAGACATAGGAGG - Intergenic
1040802696 8:51361067-51361089 GAGAAAGCAGTGGCCACAGTGGG - Intronic
1042120400 8:65481260-65481282 CAGGAAGAAGAAGAAACAGGTGG - Intergenic
1042250604 8:66752683-66752705 GAAGAGGAAGTAGCTAAAGGGGG + Intronic
1042487642 8:69363959-69363981 GAGGAAGAAGTAGCAGGAGAGGG + Intergenic
1043997773 8:86840330-86840352 GAGAAAAAAGTAGTCACAGTAGG + Intergenic
1044096478 8:88072465-88072487 GAGGAAAGAGTTGCCACAGCAGG + Intronic
1047376439 8:124301610-124301632 GAGGAAGAGGTAACCACAGCGGG - Intergenic
1047514522 8:125542056-125542078 GAGAAAGAAATAGCTACAGAAGG + Intergenic
1048200206 8:132367021-132367043 GAGCAAGAATTAGCCAGGGGAGG + Intronic
1048509395 8:135048731-135048753 GAAGAAGAAGGAGGCACAGAAGG - Intergenic
1049010640 8:139884789-139884811 GAGGAGGAAGAGGCCACAGAAGG + Intronic
1049224213 8:141441912-141441934 CAGGAGGGAGTAGCCCCAGGGGG - Intergenic
1049264787 8:141661844-141661866 GAGGATGGAGCAGCCACAGAAGG + Intergenic
1049671071 8:143870111-143870133 GAGGCTCAAGTGGCCACAGGAGG - Exonic
1050828723 9:9984331-9984353 TGGGAAAAAGTAGCCACAGAAGG + Intronic
1050858685 9:10395919-10395941 AAGGAAGAAGAAGCCACAGAGGG + Intronic
1052756082 9:32543167-32543189 GATGAAGAACTTGTCACAGGAGG - Exonic
1052974968 9:34403431-34403453 AAGGAAGAAGAAGCCACTGAAGG + Intronic
1053269454 9:36740123-36740145 GGGGAAGAGGGAGCCACAGAAGG - Intergenic
1054874570 9:70081863-70081885 GAGGAAGTAATGGCCTCAGGGGG - Intronic
1057023791 9:91720892-91720914 GTGGAGAAAGCAGCCACAGGGGG + Intronic
1057076144 9:92139120-92139142 GAGGAAGAAGGAGACAGAGAAGG - Intergenic
1057263876 9:93601497-93601519 GAGGAGGAATTAGCCAGTGGTGG + Intronic
1058101054 9:100917932-100917954 GAGGCAGGAGTTACCACAGGAGG - Intergenic
1059072414 9:111152789-111152811 GAGGAAGAAGGAGGCAGAGGAGG + Intergenic
1060812786 9:126619349-126619371 GCAGAAGAAGTAGCCAGAGAAGG - Intronic
1061803899 9:133127701-133127723 GAGGAGGAAGAAGCCACCAGAGG - Intronic
1203629308 Un_KI270750v1:56690-56712 AAAAAACAAGTAGCCACAGGGGG - Intergenic
1185456573 X:313777-313799 GAGGCAGAAGGAGCCCCTGGAGG + Intronic
1185887114 X:3792714-3792736 GAGGAAGAAGGAGCTGGAGGAGG + Intergenic
1186643784 X:11484511-11484533 AAGGAAGAAGGAGGCAGAGGAGG + Intronic
1187938096 X:24355237-24355259 GAGGAAGACATATCCCCAGGTGG + Intergenic
1188683383 X:33039995-33040017 GAGGAAGAAGTAGTCATCGTAGG + Intronic
1189497132 X:41518968-41518990 GAGGAAGGAGAGACCACAGGTGG + Intronic
1190804910 X:53825910-53825932 GAGGAAGAAGTTGACACACCTGG + Intergenic
1190937139 X:55007395-55007417 GAGGAAGAAGTTGCACCGGGAGG - Exonic
1192548037 X:72029544-72029566 GAGGCAGGAGCAGCCACAGTGGG - Intergenic
1193420026 X:81271892-81271914 GAGCAAGAAGAAGCCAATGGTGG + Intronic
1195952414 X:110289211-110289233 GAGGTAGAAATTGCCACATGTGG - Intronic
1197193967 X:123679691-123679713 TAGAAAGAAGTAGACATAGGAGG + Intronic
1197205608 X:123787275-123787297 CATGAAGAAGTAGCCATTGGAGG + Intergenic
1198321478 X:135521837-135521859 GAGGAAGGAGGGGCCAGAGGAGG - Intronic
1198859199 X:141051274-141051296 GAGAATGAAGAAGCCACATGAGG - Intergenic
1198903496 X:141536116-141536138 GAGAATGAAGAAGCCACATGAGG + Intergenic
1199298157 X:146182540-146182562 GATAAAGAGGCAGCCACAGGTGG + Intergenic
1199606739 X:149584632-149584654 GAGGAAGTAGAAGCCCCAGCAGG - Intronic
1199632384 X:149784736-149784758 GAGGAAGTAGAAGCCCCAGCAGG + Intronic
1199690988 X:150308942-150308964 GGGGGAGAAGGATCCACAGGAGG - Intergenic
1199845969 X:151693580-151693602 GAAGTAGAAGTAGCCTCATGTGG + Intergenic
1201300200 Y:12498579-12498601 GAGGAAGAAGAAGCAGCAGCAGG - Intergenic
1201300222 Y:12498677-12498699 GAAGAAGAAGCAGCAGCAGGAGG - Intergenic
1201300223 Y:12498680-12498702 GAGGAAGAAGAAGCAGCAGCAGG - Intergenic
1201685371 Y:16695951-16695973 GAGGAGAAAGTAGCAACAGAAGG - Intergenic