ID: 1183999236

View in Genome Browser
Species Human (GRCh38)
Location 22:41660139-41660161
Sequence CCTCCATGCTTGGCAAATAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183999230_1183999236 -9 Left 1183999230 22:41660125-41660147 CCAGCAAGAGCTCCCCTCCATGC 0: 1
1: 0
2: 0
3: 9
4: 241
Right 1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG 0: 1
1: 0
2: 1
3: 10
4: 188
1183999228_1183999236 15 Left 1183999228 22:41660101-41660123 CCAGCATTGTGCCATCTAGGTAC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG 0: 1
1: 0
2: 1
3: 10
4: 188
1183999229_1183999236 4 Left 1183999229 22:41660112-41660134 CCATCTAGGTACACCAGCAAGAG 0: 1
1: 0
2: 0
3: 3
4: 88
Right 1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG 0: 1
1: 0
2: 1
3: 10
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183999236 Original CRISPR CCTCCATGCTTGGCAAATAC GGG Intronic
900118563 1:1039015-1039037 CCTCTAAGCTTTGCAGATACTGG + Intronic
902707991 1:18219666-18219688 GCTCCCTGATTGGCAAATAGGGG + Intronic
902894124 1:19467161-19467183 CCACCATGCCTGGCAACTACGGG + Intronic
904057029 1:27677836-27677858 CCACCATGCTTGGCTAATTATGG - Intergenic
904783902 1:32971252-32971274 CCTCGCTTCTTGGCAAATGCTGG + Intergenic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908332765 1:63086924-63086946 CCTCCGTGCATGACAAATGCAGG + Intergenic
908449919 1:64243613-64243635 CTTCAATGCTATGCAAATACAGG - Intronic
909789545 1:79658163-79658185 GCTGCATTCTTGGCAATTACAGG + Intergenic
910401040 1:86838475-86838497 CCACCATGCTTGGCTTCTACTGG - Intergenic
920245094 1:204581948-204581970 GCACCATGCTTGTCAAAGACAGG - Intergenic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922290625 1:224206355-224206377 CCACCATGCCTGGCTAATTCTGG + Intergenic
922342351 1:224668074-224668096 GCTCCATCCTTGGCAATTATTGG - Intronic
1063075594 10:2713299-2713321 CCTCCTTCCTTGGCACATAATGG + Intergenic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065153365 10:22845165-22845187 CATCCATGCCTGGCCAATGCAGG - Intergenic
1065831818 10:29621440-29621462 CCACCATGCTTGGGAAACAGGGG + Intronic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1067031963 10:42884313-42884335 CCTCCAGTCTTGCCAAATTCTGG - Intergenic
1067052498 10:43030099-43030121 CCTCCTTGCTGAGCAAGTACAGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1070795443 10:79213619-79213641 TCCCCATGTTTGGCCAATACTGG - Intronic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1071430413 10:85602396-85602418 CCTCCATGCAGTGCAAACACAGG - Exonic
1072121309 10:92407653-92407675 CCTCCATGCCTGGCTAATTTTGG + Intergenic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1074543783 10:114386855-114386877 CCTCCATGCTTCGCAAAATGAGG + Intronic
1076264244 10:129097195-129097217 CCTAAAAGCTTGACAAATACGGG + Intergenic
1077742350 11:4860301-4860323 CCTCCATGCTCAGCATCTACTGG - Exonic
1077819076 11:5718255-5718277 CCTCCAAGATTGGCAAAGTCTGG + Intronic
1080518442 11:33045065-33045087 CCACCATGCCTGGCCAATCCTGG - Intronic
1083224232 11:61274490-61274512 CCACCATACCTGGCAAACACAGG + Exonic
1084726858 11:70947506-70947528 CCACCATGCCTGGCTAATCCTGG + Intronic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1089206461 11:116767818-116767840 CCTCCATGCCTGGCTAATTTTGG - Intronic
1091719577 12:2803013-2803035 CCACCAGGCTTGGCCTATACAGG + Intronic
1094459996 12:30685770-30685792 CCACCATGCTTGGCTAATTTTGG - Intronic
1099318483 12:81114674-81114696 TTTCCATGCTTGGTAAATAGGGG + Intronic
1104849508 12:131864894-131864916 CCACCACGCCTGGCTAATACGGG - Intergenic
1107589123 13:41883227-41883249 CCTCCATGCCTGGTAAAGAATGG + Intronic
1108337414 13:49459245-49459267 CCTCCAAGTTTGGCAAAGAAGGG - Intronic
1112005605 13:95251073-95251095 CCACCAAGCTTGGCCAATAGTGG + Intronic
1113527402 13:110991831-110991853 CATCCATGCTTGGCTGATGCTGG - Intergenic
1117866719 14:60157702-60157724 CCTCAGTGCTTAGCAAAGACTGG + Intronic
1120055127 14:79915454-79915476 CCTCCTTGATTAGAAAATACAGG - Intergenic
1124851647 15:33345252-33345274 GCTCCATGCCTGGCACATAGTGG - Intronic
1125086872 15:35740348-35740370 CCTCCATGCTTGGGAACTGATGG - Intergenic
1126636591 15:50786116-50786138 CCACCATGCTTGGCTAATTTTGG + Intergenic
1127981969 15:64041962-64041984 CCTCCATGCTTGGCCAGGGCTGG + Intronic
1129111042 15:73337316-73337338 CCTCCATGCTTAGCACAAGCAGG + Intronic
1132482561 16:173739-173761 CCTCCATTGTTGGCACATTCCGG - Intergenic
1134764114 16:16741400-16741422 CCATGATGCTTGGCAAACACAGG - Intergenic
1134981943 16:18617809-18617831 CCATGATGCTTGGCAAACACAGG + Intergenic
1135094448 16:19553756-19553778 CCACCATGCCTGGCTAATATCGG - Intergenic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1137357898 16:47784130-47784152 CCTCCAGGCTGGGCAACTAAGGG + Intergenic
1137630182 16:49937775-49937797 CCACCATGCCTGGCCAATCCAGG + Intergenic
1138088305 16:54153910-54153932 CCTCCATGCTTGGCTACTTTAGG + Intergenic
1142378446 16:89718657-89718679 CCTCCATGCTGGACAAATTGTGG - Intronic
1143236989 17:5411274-5411296 CCACCGTGCTTGGCCAATATTGG - Intronic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1146061584 17:29610466-29610488 CCTCAATGCCTGGCACATAAAGG + Intronic
1146634713 17:34495338-34495360 TATCCATGCATGGCATATACAGG + Intergenic
1148194707 17:45705065-45705087 CTTACATGCTTGGTAAATATTGG + Intergenic
1150286524 17:63957512-63957534 CCTCCCTGCTTGGCAGCTGCGGG - Exonic
1153910553 18:9702809-9702831 CCTCCATGCTTGGGATTTATCGG + Intergenic
1158560993 18:58513587-58513609 CCACCATGCCTGGCAAATTTGGG - Intronic
1160753155 19:744604-744626 CCACCATGCCTGGCCATTACAGG - Intronic
1161219994 19:3114043-3114065 CCTCCATGCTTGGCAGGCAGAGG + Intronic
1161523374 19:4738429-4738451 CCTCCCTGCCTGGCTAATTCGGG - Intergenic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1165927741 19:39337452-39337474 CCTCCATGGTGGGCAAACCCCGG + Intronic
1166200938 19:41237774-41237796 TCTCCTTGCTTTGCAAATCCAGG + Intronic
1166706996 19:44913595-44913617 CCACCATGCCTGGCTAATGCAGG + Intergenic
1166709167 19:44926155-44926177 CCACCATGCCTGGCCAATGCAGG + Intergenic
1167003662 19:46761121-46761143 TCACCATACTTGGCCAATACTGG - Intronic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
925556244 2:5134210-5134232 GCTCAATGCGTGGCAAATACAGG - Intergenic
927383628 2:22507547-22507569 CCTCCAGGGTTGGAAAATACTGG - Intergenic
929456364 2:42068946-42068968 CCTCCATGCTTGGAATAGTCGGG - Intergenic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
931474333 2:62571986-62572008 CCACCATGCCTGACAAATATGGG + Intergenic
932425261 2:71630104-71630126 AGTCCTTGCTTGTCAAATACTGG + Intronic
933548536 2:83744214-83744236 CATCTATGCTTGGTAAATGCCGG + Intergenic
935728763 2:106047332-106047354 CCTCCATGCTGGGCACAGAGGGG - Intergenic
937510175 2:122586725-122586747 CTTCCATTCTTGCCAAATCCAGG - Intergenic
937577796 2:123445154-123445176 CCTCAATGCTTGGCACAAAAGGG - Intergenic
938150236 2:128876046-128876068 CCTCCAAGCTTGCCACATTCAGG + Intergenic
938716448 2:134026747-134026769 CTCCTATGCCTGGCAAATACTGG + Intergenic
939141145 2:138356107-138356129 TCTCATTGCTTGGCAAAAACTGG - Intergenic
939492393 2:142892198-142892220 CCGCCATGCCTGGCCAATATTGG + Intronic
943747903 2:191481265-191481287 CCTCCATGCCTGGCTAATTTGGG + Intergenic
946488059 2:220120021-220120043 CCTCCAGGCTTGGCATACGCAGG - Intergenic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
1170557400 20:17525760-17525782 CCTTGATGCTTGGCAAGCACAGG + Intronic
1170758371 20:19225428-19225450 CCACAATGCTTGGAAAATACCGG - Intronic
1172178020 20:32984406-32984428 CCCTCTTGCTTGGCAAAAACGGG - Intronic
1173413992 20:42839578-42839600 CCTACATGCTTTACAAATAAGGG + Intronic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1176993698 21:15528835-15528857 CCTCCATGCTTGTTAAATTTGGG - Intergenic
1178404146 21:32310930-32310952 CCTCCATGCTTGGCACAGGGAGG + Intronic
1179269672 21:39840955-39840977 CCTCCCTGTGTGGCAAAGACAGG - Intergenic
1181958875 22:26608750-26608772 CATCCTTGCTGGGTAAATACTGG + Intronic
1182034989 22:27191055-27191077 CTTCAATGCTTGGCACATATAGG + Intergenic
1183399459 22:37593563-37593585 CCACCATGCCTGGCCTATACTGG + Intergenic
1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG + Intronic
1184632418 22:45793637-45793659 CCTGCATCCTTGGCAAAGGCTGG - Intronic
949253526 3:2017569-2017591 CCTACATTCTTGACAAACACTGG + Intergenic
953217984 3:40939097-40939119 CCTCCCTGTTTTGCACATACTGG + Intergenic
954283413 3:49600883-49600905 CCTCCATGCATGCCATACACAGG - Intronic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
957453126 3:80405262-80405284 CCTCCATGCCTGGCTAATTTTGG + Intergenic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
964745272 3:160006511-160006533 CCTCCAGGCATTTCAAATACTGG + Intergenic
966394542 3:179488695-179488717 CCGCCATGCATGGCCAAGACAGG - Intergenic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
968618117 4:1591410-1591432 CCTTCATTCCTGGCAAGTACAGG - Intergenic
969949616 4:10821623-10821645 CTTCCATGCACGGAAAATACAGG - Intergenic
972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG + Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974134985 4:57804004-57804026 CCAGCATGCTTGGCAAAGAAAGG + Intergenic
980359667 4:131748606-131748628 CCTCCATGCTTCTCAGAGACGGG - Intergenic
980910040 4:138986061-138986083 CCACAATGCTTGGCTAATCCTGG - Intergenic
980947276 4:139334237-139334259 CCTCCATGCTCTGCAAATTTGGG - Exonic
985208069 4:187561946-187561968 CCTCCATGCTTGCCATGTGCAGG - Intergenic
985283666 4:188312278-188312300 CCTCCATGGTTGGCATTTTCAGG + Intergenic
986783170 5:11085710-11085732 CCTCCATGCTGGGGAAAGAAAGG + Intronic
987269081 5:16286708-16286730 CCTCAATGCTTGGAACATAATGG - Intergenic
993851944 5:93021468-93021490 CCTTTATGCTTGGTAAATAGAGG - Intergenic
994757608 5:103814525-103814547 CCTTAGTGCTTGGCAAATGCAGG - Intergenic
996126950 5:119736943-119736965 CCTTCATGGTTGGCAATGACAGG + Intergenic
996776924 5:127142804-127142826 CCTCCATGCTGTGGAAATCCAGG - Intergenic
999057170 5:148590447-148590469 CCACCATGCTTGGCTAATTTTGG + Intronic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1007505714 6:42333716-42333738 CCTCCATGGGAGGAAAATACAGG + Intronic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1010687525 6:78869954-78869976 CCACCATGCTTGGCTAATTTTGG - Intronic
1011287004 6:85735570-85735592 CCACCATGCCTAGCCAATACTGG + Intergenic
1011456853 6:87559839-87559861 GCTCCATTCATGGTAAATACAGG + Intronic
1014610741 6:123541561-123541583 GCTCCATGCTTGGGAAAGACAGG + Intronic
1015344417 6:132139026-132139048 CCACCATGACTGGCCAATACGGG - Intergenic
1017849813 6:158295600-158295622 CCACCATGCCTGGCCAATGCTGG - Intronic
1020918774 7:14234035-14234057 CCCCCTTGCCTGGCAAGTACAGG + Intronic
1021102369 7:16598575-16598597 CCTCCATGGTATGCAAAGACAGG + Intergenic
1021226027 7:18027377-18027399 CCTACATGCTTCTCAAATTCAGG - Exonic
1022337032 7:29431737-29431759 CCTCCCTGATTGCCCAATACAGG - Intronic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1026313270 7:69206764-69206786 CCACCATGCTTGGCTAATTTTGG - Intergenic
1027192401 7:76004414-76004436 CCACCATGCTTGGCCAAGATAGG - Intronic
1030984459 7:116224726-116224748 CCTCCATCCTAGGCAAAACCTGG - Intronic
1035281596 7:157781986-157782008 CCTCCAAGCTTGCCACAGACGGG + Intronic
1036539188 8:9687154-9687176 CCTCCATTCTTGCCAAATCTTGG + Intronic
1036548479 8:9795166-9795188 CCTACTAGATTGGCAAATACAGG + Intergenic
1036661938 8:10714572-10714594 CCTCCATGCTCGGGAGACACAGG + Intergenic
1040445813 8:47492312-47492334 CCTGCCTGCTTGCCAGATACTGG - Intronic
1042368211 8:67960472-67960494 CCTCCAGGCTTGGAAAAGACAGG - Intronic
1044215435 8:89604020-89604042 CCTCCATTCTTGGAATATATAGG + Intergenic
1046770105 8:118110135-118110157 CCTGCAAGCATGGCAAAGACTGG - Exonic
1048216776 8:132502860-132502882 CCTCCATGGTTTGCAAGTCCAGG + Intergenic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1051899768 9:22025704-22025726 GCTCCATCCCTGGGAAATACAGG + Intronic
1054773499 9:69105189-69105211 CCTCCATGCTCAGCAATCACTGG - Intergenic
1054895991 9:70311968-70311990 CCACCATGCTAGGCTAATACAGG - Intronic
1055134901 9:72817380-72817402 CCTCCCTGCTTGGAAAATGTAGG - Intronic
1055646214 9:78363845-78363867 CCTCCAAGATTGGCATATCCCGG - Intergenic
1056037435 9:82621751-82621773 CCTCCATGCTGGGTAAATTATGG + Intergenic
1056983188 9:91336342-91336364 CCACCATGCCTGGCCAATCCAGG - Intronic
1057214638 9:93221017-93221039 CCTCCATCGTGGGCAAAGACAGG - Intronic
1057776704 9:98017158-98017180 CCTACAGGCTTGGTAGATACTGG - Intergenic
1057914987 9:99048415-99048437 CCTCCCAGGTTGGCAAACACTGG + Intronic
1057974129 9:99586028-99586050 CAACCATGCTTGGCACATACTGG + Intergenic
1060344074 9:122801439-122801461 CCGCCATGCTTGGCTAATTTTGG - Intronic
1060630221 9:125151026-125151048 CCTACATGCTTCTCAAATTCAGG + Intronic
1060664521 9:125424775-125424797 CCACCATGCCCGGCAAAGACAGG + Intergenic
1060929955 9:127483090-127483112 CCTCCATGCATGGCCAACAGAGG - Intronic
1185693270 X:2174262-2174284 TCTACATGCTTGGGAATTACAGG - Intergenic
1185714971 X:2334315-2334337 CCACCATGCCTGGCTAATATTGG + Intronic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1186770054 X:12809311-12809333 CCTGCATGCTTCTCAGATACAGG + Exonic
1187247180 X:17563283-17563305 CCTCAATGCCTGGCACATAGGGG + Intronic
1189827414 X:44933728-44933750 CCACCATGCCTGGCTAATTCTGG + Intronic
1193305054 X:79939672-79939694 TATCCATGTTTGGCAAATAGTGG - Intergenic
1193559527 X:83000776-83000798 CATCTATGCTTGCCAAATCCAGG - Intergenic
1194760270 X:97788221-97788243 CCACCATGCCTGGCAAATTTTGG - Intergenic
1194973593 X:100371060-100371082 CCTCCAACCTAGGCAATTACTGG - Intronic
1195692696 X:107640979-107641001 CCTACATGCTTCTCAAATTCAGG + Exonic
1196344649 X:114639464-114639486 CCTCCATGCTTGGAAAATGCAGG + Intronic
1199829540 X:151535676-151535698 TTTCCTTGCTTGGCAAATAGTGG - Intergenic
1200095354 X:153656992-153657014 CCACCAAGCTAGGCAGATACAGG - Intergenic
1201450786 Y:14111651-14111673 CCACCATGCCTGGCAAATTTTGG + Intergenic
1201901744 Y:19050568-19050590 CCACCATGCTTGGCCAAGTCTGG + Intergenic